Name: application of rna interference in the pinewood nematode, bursaphelenchus xylophilus
Uploaded: 2022-03-09T15:00:00
Description: Watch this Scientific Journal Video about Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus at JoVE.com

This research was funded by the National Natural Science Foundation of China (31870637, 31200487) and jointly funded by the Zhejiang Key Research Plan (2019C02024, LGN22C160004).

The study was approved by the council for animal experimentation of Zhejiang Agricultural &#38; Forestry University. The B. xylophilus isolate NXY61 was originally extracted from a diseased Pinus massoniana in the Ningbo area of Zhejiang province, China11.
1. Gene cloning
NOTE: See the Table of Materials for details about the primers used in this protocol.
<ol>
	<li>Collect nematodes.
	<ol...

<ol>
	<li>Nicol, J. M., Jones, J., Gheysen, G., Fenoll, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+nematode+threats+to+world+agriculture.">Current nematode threats to world agriculture.</a> Genomics and Molecular Genetics of Plant-Nematode Interactions. , 21-43 (2011).</li><li>Jones, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Top+10+plant-parasitic+nematodes+in+molecular+plant+pathology.">Top 10 plant-parasitic nematodes in molecular plant pathology.</a> Molecular Plant Pathology. 14 (9), 946-961 (2013).</li><li>Kikuchi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+insights+into+the+origin+of+parasitism+in+the+emerging+plant+pathogen+Bursaphelenchus+xylophilus.">Genomic insights into the origin of parasitism in the emerging plant pathogen Bursaphelenchus xylophilus.</a> PLoS Pathogens. 7 (9), 1002219 (2011).</li><li>Megen, H. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+phylogenetic+tree+of+nematodes+based+on+about+1200+full-length+small+subunit+ribosomal+DNA+sequences.">A phylogenetic tree of nematodes based on about 1200 full-length small subunit ribosomal DNA sequences.</a> Nematology. 11 (6), 927-950 (2009).</li><li>Niu, J. H., Jian, H., Xu, J. M., Guo, Y. D., Liu, Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+technology+extends+its+reach:+Engineering+plant+resistance+against+harmful+eukaryotes.">RNAi technology extends its reach: Engineering plant resistance against harmful eukaryotes.</a> African Journal of Biotechnology. 9 (45), 7573-7582 (2010).</li><li>Fire, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 91 (6669), 806-811 (1998).</li><li>Shahid, M., Imran, A., Mazhar, H., Yusuf, Z., Rob, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+novel+traits+in+plants+through+RNA+interference.">Engineering novel traits in plants through RNA interference.</a> Trends in Plant Science. 11 (11), 559-565 (2006).</li><li>Marmonier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+acquisition+of+specific+small+interfering+RNAs+inhibits+the+expression+of+some+target+genes+in+the+plant+ectoparasite+Xiphinema+index.">In vitro acquisition of specific small interfering RNAs inhibits the expression of some target genes in the plant ectoparasite Xiphinema index.</a> International Journal of Molecular Sciences. 20 (13), 3266 (2019).</li><li>Iqbal, S., Fosu-Nyarko, J., Jones, M. G. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Attempt+to+silence+genes+of+the+RNAi+pathways+of+the+root-knot+nematode,+Meloidogyne+incognita+results+in+diverse+responses+including+increase+and+no+change+in+expression+of+some+genes.">Attempt to silence genes of the RNAi pathways of the root-knot nematode, Meloidogyne incognita results in diverse responses including increase and no change in expression of some genes.</a> Frontiers in Plant Science. 11, 328 (2020).</li><li>Zhou, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+and+functional+analysis+of+akt-1+in+pinewood+nematode,+Bursaphelenchus+xylophilus.">Molecular characterization and functional analysis of akt-1 in pinewood nematode, Bursaphelenchus xylophilus.</a> Forest Pathology. 51 (1), 12647 (2021).</li><li>Zhou, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+mab-3+in+spermatogenesis+and+ontogenesis+of+pinewood+nematode,+Bursaphelenchus+xylophilus.">The role of mab-3 in spermatogenesis and ontogenesis of pinewood nematode, Bursaphelenchus xylophilus.</a> Pest Management Science. 77 (1), 138-147 (2021).</li><li>Tang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bxy-fuca+encoding+&#945;-L-fucosidase+plays+crucial+roles+in+development+and+reproduction+of+the+pathogenic+pinewood+nematode,+Bursaphelenchus+xylophilus.">Bxy-fuca encoding &#945;-L-fucosidase plays crucial roles in development and reproduction of the pathogenic pinewood nematode, Bursaphelenchus xylophilus.</a> Pest Management Science. 76 (1), 205-214 (2020).</li><li>Wang, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+characterization+and+functional+analysis+of+daf-8+in+the+pinewood+nematode,+Bursaphelenchus+xylophilus.">Molecular characterization and functional analysis of daf-8 in the pinewood nematode, Bursaphelenchus xylophilus.</a> Journal of Forestry Research. , (2021).</li><li>Viglierchio, D. R., Schmitt, R. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+methodology+of+nematode+extraction+from+field+samples:+Baermann+funnel+modifications.">On the methodology of nematode extraction from field samples: Baermann funnel modifications.</a> Journal of Nematology. 15 (3), 438-444 (1983).</li><li>Zhu, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Observation+and+quantification+of+mating+behavior+in+the+pinewood+nematode,+Bursaphelenchus+xylophilus.">Observation and quantification of mating behavior in the pinewood nematode, Bursaphelenchus xylophilus.</a> Journal of Visualized Experiments: JoVE. (118), e54842 (2016).</li><li>Zhou, L. F., Chen, F. M., Ye, J. R., Pan, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+reliable+reference+genes+for+RT-qPCR+analysis+of+Bursaphelenchus+mucronatus+gene+expression+from+different+habitats+and+developmental+stages.">Selection of reliable reference genes for RT-qPCR analysis of Bursaphelenchus mucronatus gene expression from different habitats and developmental stages.</a> Frontiers in Genetics. 9, 269-279 (2018).</li><li>Wang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double-stranded+RNA-mediated+interference+of+dumpy+genes+in+Bursaphelenchus+xylophilus+by+feeding+on+filamentous+fungal+transformants.">Double-stranded RNA-mediated interference of dumpy genes in Bursaphelenchus xylophilus by feeding on filamentous fungal transformants.</a> International Journal for Parasitology. 46 (5-6), 351-360 (2016).</li><li>Ma, H. B., Lu, Q., Liang, J., Zhang, X. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+the+cellulose+gene+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus,+using+RNA+interference.">Functional analysis of the cellulose gene of the pine wood nematode, Bursaphelenchus xylophilus, using RNA interference.</a> Genetics and Molecular Research: GMR. 10 (3), 1931-1941 (2011).</li><li>Cheng, X. Y., Dai, S. M., Xiao, L., Xie, B. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+cellulase+gene+knock+down+by+dsRNA+interference+on+the+development+and+reproduction+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Influence of cellulase gene knock down by dsRNA interference on the development and reproduction of the pine wood nematode, Bursaphelenchus xylophilus.</a> Nematology. 12 (12), 225-233 (2010).</li><li>Xue, Q., Wu, X. Q., Zhang, W. J., Deng, L. N., Wu, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cathepsin+L-like+cysteine+proteinase+genes+are+associated+with+the+development+and+pathogenicity+of+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Cathepsin L-like cysteine proteinase genes are associated with the development and pathogenicity of pine wood nematode, Bursaphelenchus xylophilus.</a> International Journal of Molecular Sciences. 20 (1), 215 (2019).</li><li>Tabara, H., Grishok, A., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+in+C.+elegans:+Soaking+in+the+genome+sequence.">RNAi in C. elegans: Soaking in the genome sequence.</a> Science. 282 (5388), 430-431 (1998).</li><li>Urwin, P. E., Lilley, C. J., Atkinson, H. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ingestion+of+double-stranded+RNA+by+pre+parasitic+juvenile+cyst+nematodes+leads+to+RNA+interference.">Ingestion of double-stranded RNA by pre parasitic juvenile cyst nematodes leads to RNA interference.</a> Molecular Plant-Microbe Interactions: MPMI. 15 (8), 747-752 (2002).</li><li>Bakhetia, M., Charlton, W., Atkinson, H. J., McPherson, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference+of+dual+oxidase+in+the+plant+nematode+Meloidogyne+incognita.">RNA interference of dual oxidase in the plant nematode Meloidogyne incognita.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (10), 1099-1106 (2005).</li><li>Rosso, M. N., Dubrana, M. P., Cimbolini, N., Jaubert, S., Abad, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+RNA+interference+to+root-knot+nematode+genes+encoding+esophageal+gland+proteins.">Application of RNA interference to root-knot nematode genes encoding esophageal gland proteins.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (7), 615-620 (2005).</li><li>Chen, Q., Rehman, S., Smant, G., Jones, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+analysis+of+pathogenicity+proteins+of+the+potato+cyst+nematode+Globodera+rostochiensis+using+RNAi.">Functional analysis of pathogenicity proteins of the potato cyst nematode Globodera rostochiensis using RNAi.</a> Molecular Plant-Microbe Interactions: MPMI. 18 (7), 621-625 (2005).</li><li>Wang, D. D., Li, Y., Li, J., Xie, B. Y., Chen, G. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+clone+and+its+RNAi+interference+effect+analysis+of+mapk+gene+in+Bursaphelenchus+xylophilus+(+in+Chinese).">Molecular clone and its RNAi interference effect analysis of mapk gene in Bursaphelenchus xylophilus ( in Chinese).</a> Acta Phytopathologica Sinica. 46 (5), 662-669 (2016).</li><li>Qiu, X., Wu, X., Huang, L., Ye, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+Bxpel1+gene+silencing+by+dsRNA+interference+on+the+development+and+pathogenicity+of+the+pine+wood+nematode,+Bursaphelenchus+xylophilus.">Influence of Bxpel1 gene silencing by dsRNA interference on the development and pathogenicity of the pine wood nematode, Bursaphelenchus xylophilus.</a> International Journal of Molecular Sciences. 17 (1), 125 (2016).</li><li>Dulovic, A., Streit, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi-mediated+knockdown+of+daf-12+in+the+model+parasitic+nematode+Strongyloides+ratti.">RNAi-mediated knockdown of daf-12 in the model parasitic nematode Strongyloides ratti.</a> PLoS Pathogens. 15 (3), 1007705 (2019).</li><li>Li, L., Zhao, H., Cui, Y., Wei, H., Li, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Research+progress+of+gene+editing+technology.">Research progress of gene editing technology.</a> Life Science Research. 21 (3), 268-274 (2017).</li><li>Bindhya, C. Y., Karuppannan, V., Kuppuswamy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host-generated+double+stranded+RNA+induces+RNAi+in+plant-parasitic+nematodes+and+protects+the+host+from+infection.">Host-generated double stranded RNA induces RNAi in plant-parasitic nematodes and protects the host from infection.</a> Molecular and Biochemical Parasitology. 148 (2), 219-222 (2006).</li><li>Jiang, Z., Sher, A. K., David, G. H., Ralph, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+insect-resistant+plants:+RNAi-mediated+crop+protection.">Next-generation insect-resistant plants: RNAi-mediated crop protection.</a> Trends in Biotechnology. 35 (9), 871-882 (2017).</li></ol>

Although the life history and parasitic environment of B. xylophilus are different from those of other nematodes, there has been limited research on the molecular pathogenesis of this plant pathogen. Despite great progress made in the application of CRISPR/Cas9 genome editing technology in C. elegans and other nematodes, only RNAi technology applied to B. xylophilus has been published to date17. RNAi is one of the most powerful tools available to study the gene function ...

Plant-parasitic nematodes (PPNs) are a continuing threat to food security and forest ecosystems. They cause an estimated 100 billion USD in economic losses each year1, the most problematic of which are primarily root-knot nematodes, cyst nematodes, and pinewood nematodes. The pinewood nematode, Bursaphelenchus xylophilus, is a migratory, endoparasitic nematode, which is the causal pathogen of pine wilt disease2. It has caused great harm to pine forests worldwide3. Using the terminology of Van Megen et al.4, B. xylophilus is a member of the Parasitaphelenchidae and belongs to clade 10, whereas most other major plant parasites belong to clade 12.
As an independent and recently evolved plant parasite, B. xylophilus is an attractive model for comparative studies. To date, there has been substantial research on root-knot nematodes and cyst nematodes belonging to clade 12, which are obligate, sedentary endoparasites and are some of the most intensely studied nematodes. However, conducting further research in this important area comes with a major challenge: the function of parasitism genes is a research bottleneck. Functional studies generally include ectopic expression and knockdown/out experiments but rely on effective genetic transformation protocols for the nematode. As a result, reverse genetics in PPNs almost exclusively relies on gene silencing by RNAi.
RNAi, a mechanism widely present in eukaryotic cells, silences gene expression by introducing double-stranded RNA (dsRNA)5. To date, the posttranscriptional gene-silencing mechanism induced by dsRNA has been found in all studied eukaryotes, and RNAi technology, as a tool of functional genomics research and other applications, has developed rapidly in many organisms. Since the discovery of the RNAi machinery in Caenorhabditis elegans in 19986, RNAi techniques have become effective methods for identifying the gene function of nematodes and are proposed as a new way to effectively control pathogenic nematodes7.
RNAi is technically facile-soaking the juveniles in dsRNA can suffice; however, the efficacy and reproducibility of this approach vary widely with the nematode species and the target gene8. The silencing of 20 genes involved in the RNAi pathways of the root-knot nematode, Meloidogyne incognita, was investigated using long dsRNAs as triggers, resulting in diverse responses, including an increase and no change in the expression of some genes9. These results show that target genes may respond to RNAi knockdown differently, necessitating an exhaustive assessment of their suitability as targets for nematode control via RNAi. However, there is currently a paucity of research on the developmental and reproductive biology of B. xylophilus.
As a continuation of previous work10,11,12,13, we describe here a protocol for applying RNAi to study the function of&#160;the ppm-1 gene of B. xylophilus, including the synthesis of dsRNA, synthetic neurostimulant soaking, and quantitative polymerase chain reaction (qPCR) detection. The knowledge gained from this experimental approach will likely contribute markedly to understanding basic biological systems and preventing pine wilt disease.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Baermann funnel</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to isolate nematodes</td>
		</tr>
		<tr>
			<td>Beacon Designer 7.9</td>
			<td>Shanghai kangyusheng information technology co.</td>
			<td>n/a</td>
			<td>to design qPCR primers</td>
		</tr>
		<tr>
			<td>Botrytis cinerea</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>as food for nematodes</td>
		</tr>
		<tr>
			<td>Bursaphelenchus xylophilus</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>its number was NXY61 and was it was originally extracted from diseased 
			Pinus massoniana in Ningbo, Zhejiang province, China.</td>
		</tr>
		<tr>
			<td>constant temperature incubator</td>
			<td>Shanghai Jing Hong Laboratory Instrument Co.</td>
			<td>H1703544</td>
			<td>to cultur nematodes</td>
		</tr>
		<tr>
			<td>Electrophoresis apparatus</td>
			<td>Bio-Rad Laboratories</td>
			<td>1704466</td>
			<td>to achieve electrophoretic analysis</td>
		</tr>
		<tr>
			<td>Ethanol, 75%</td>
			<td>Sinopharm Chemical Reagent Co.</td>
			<td>80176961</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>Ex Taq Polymerase Premix</td>
			<td>Takara Bio Inc.</td>
			<td>RR030A</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Ex Taq Polymerase Premix</td>
			<td>Takara Bio Inc.</td>
			<td>RR390A</td>
			<td>for PCR</td>
		</tr>
		<tr>
			<td>Gel imager</td>
			<td>LongGene Scientific Instruments Co.</td>
			<td>LG2020</td>
			<td>to make nucleic acid bands visible</td>
		</tr>
		<tr>
			<td>GraphPad Prism 8</td>
			<td>GraphPad Prism</td>
			<td>n/a</td>
			<td>to analyze the data and make figurs</td>
		</tr>
		<tr>
			<td>High Speed Centrifuge</td>
			<td>Hangzhou Allsheng Instruments Co.</td>
			<td>AS0813000</td>
			<td>centrifug</td>
		</tr>
		<tr>
			<td>High-flux tissue grinder</td>
			<td>Bertin</td>
			<td></td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>ImageJ software</td>
			<td>National Institutes of Health</td>
			<td>n/a</td>
			<td>to measure the body lengths</td>
		</tr>
		<tr>
			<td>isopropyl alcohol</td>
			<td>Shanghai Aladdin Biochemical Technology Co.</td>
			<td>L1909022</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>Leica DM4B microscope</td>
			<td>Leica Microsystems Inc.</td>
			<td></td>
			<td>to observe nematodes</td>
		</tr>
		<tr>
			<td>magnetic beads</td>
			<td>Aoran science technology co.</td>
			<td>150010C</td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>MEGAscript T7 High Yield Transcription Kit</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>AM1333</td>
			<td>to synthesize dsRNA in vitro</td>
		</tr>
		<tr>
			<td>NanoDrop ND-2000 spectrophotometer</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>NanoDrop 2000/2000C</td>
			<td>to analyze the quality of the dsRNA</td>
		</tr>
		<tr>
			<td>PCR Amplifier</td>
			<td>Bio-Rad Life Medical Products Co.</td>
			<td>1851148</td>
			<td>to amplify nucleic acid sequence</td>
		</tr>
		<tr>
			<td>Petri dishes</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to cultur nematodes</td>
		</tr>
		<tr>
			<td>pGEM-T Easy vector</td>
			<td>Promega Corporation</td>
			<td>A1360</td>
			<td>for cloning</td>
		</tr>
		<tr>
			<td>Potato Dextrose Agar (Medium)</td>
			<td>n/a</td>
			<td>n/a</td>
			<td>to cultur Botrytis cinerea</td>
		</tr>
		<tr>
			<td>Prime Script RT reagent Kit with gDNA Eraser</td>
			<td>Takara Bio Inc.</td>
			<td>RR047B</td>
			<td>to synthetic cDNA</td>
		</tr>
		<tr>
			<td>Primer Premier 5.0</td>
			<td>PREMIER Biosoft</td>
			<td>n/a</td>
			<td>to design PCR primers</td>
		</tr>
		<tr>
			<td>primers:ppm-1-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-GATGCGAAGTTGCCAATCATTCT -3&#39;; R: 5&#39;- CCAGATCCAGTCCACCATACACC -3</td>
		</tr>
		<tr>
			<td>q-ppm-1-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-CATCCGAATGGCAATACAG-3&#39;; R: 5&#39;-ACTATCCTCAGCGTTAGC-3&#39;</td>
		</tr>
		<tr>
			<td>Real-time thermal cycler&#160;qTOWER 2.2</td>
			<td>Analytique Jena Instruments (Beijing) Co.</td>
			<td></td>
			<td>for qPCR</td>
		</tr>
		<tr>
			<td>shaking table</td>
			<td>Shanghai Zhicheng analytical instrument manufacturing co.</td>
			<td></td>
			<td>to soak nematodes</td>
		</tr>
		<tr>
			<td>stereoscopic microscope</td>
			<td>Chongqing Optec Instrument Co.</td>
			<td>1814120</td>
			<td>to observe nematodes</td>
		</tr>
		<tr>
			<td>T7-GFP-F/R</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>F: 5&#39;-TAATACGACTCACTATAGGGAAA 
			GGAGAAGAACTTTTCAC-3&#39;; R: 5&#39;-TAATACGACTCACTATAGGGCTG 
			TTACAAACTCAAGAAGG-3&#39;</td>
		</tr>
		<tr>
			<td>&#160;T7 promoter</td>
			<td>Tsingke Biotechnology Co.</td>
			<td>n/a</td>
			<td>TAATACGACTCACTATAGGG</td>
		</tr>
		<tr>
			<td>Takara MiniBEST Agarose Gel DNA Extraction Kit</td>
			<td>Takara Bio Inc.</td>
			<td>9762</td>
			<td>to recover DNA</td>
		</tr>
		<tr>
			<td>TaKaRa TB Green Premix Ex Taq (Tli RNaseH Plus)</td>
			<td>Takara Bio Inc.</td>
			<td>RR820A</td>
			<td>for qPCR</td>
		</tr>
		<tr>
			<td>trichloroethane</td>
			<td>Shanghai LingFeng Chemical Reagent Co.</td>
			<td></td>
			<td>to extract RNA</td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>Thermo Fisher Scientific Inc.</td>
			<td>15596026</td>
			<td>total RNA extraction reagent,to extract RNA</td>
		</tr>
	</tbody>
</table>

application of rna interference in the pinewood nematode, bursaphelenchus xylophilus

The pinewood nematode, Bursaphelenchus xylophilus, is one of the most destructive invasive species worldwide, causing the wilting and eventual death of pine trees. Despite the recognition of their economic and environmental significance, it has thus far been impossible to study the detailed gene functions of plant-parasitic nematodes (PPNs) using conventional forward genetics and transgenic methods. However, as a reverse genetics technology, RNA interference (RNAi) facilitates the study of the functional genes of nematodes, including B. xylophilus. 
This paper outlines a new protocol for RNAi of the ppm-1 gene in B. xylophilus, which has been reported to play crucial roles in the development and reproduction of other pathogenic nematodes. For RNAi, the T7 promoter was linked to the 5&#8242;-terminal of the target fragment by polymerase chain reaction (PCR), and double-stranded RNA (dsRNA) was synthesized by in vitro transcription. Subsequently, dsRNA delivery was accomplished by soaking the nematodes in a dsRNA solution mixed with synthetic neurostimulants. Synchronized juveniles of B. xylophilus (approximately 20,000 individuals) were washed and soaked in dsRNA (0.8 &#181;g/mL) in the soaking buffer for 24 h in the dark at 25 &#176;C.
The same quantity of nematodes was placed in a soaking buffer without dsRNA as a control. Meanwhile, another identical quantity of nematodes was placed in a soaking buffer with green fluorescent protein (gfp) gene dsRNA as a control. After soaking, the expression level of the target transcripts was determined using real-time quantitative PCR. The effects of RNAi were then confirmed using microscopic observation of the phenotypes and a comparison of the body size of the adults among the groups. The current protocol can help advance research to better understand the functions of the genes of B. xylophilus and other parasitic nematodes toward developing control strategies through genetic engineering.

Analysis of ppm-1 expression of B. xylophilus after RNAi 
The relative expression level of the ppm-1 gene of B. xylophilus soaked with GFP dsRNA and that soaked with target gene dsRNA was 0.92 and 0.52, respectively (the ppm-1 gene expression level of the ddH2O-treated control group was set to 1) (Figure 1). Thus, exogenous dsRNA has no effect on t...

Watch this Scientific Journal Video about Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus at JoVE.com

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

Here, we introduce a detailed soaking method of RNA interference in Bursaphelenchus xylophilus to facilitate the study of gene functions.

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

The pinewood nematode, Bursaphelenchus xylophilus, is one of the most destructive invasive species worldwide, causing the wilting and eventual death of ...

RNAi has become an effective method for identifying the function of genes in nematodes and are proposed as a new way to effectively control pathogenic nematodes. RNAi is soaking nematodes in dsRNA can suffice for the procedure. To begin, collect the nematodes by the Baermann funnel method.For this, place a clamped rubber tube below a funnel and place two layers of filter paper in the mouth of the funnel. Transfer the Botrytis cinerea fungal cultures to the funnel and add water to immerse the fungal mat. When nematodes are collected, add 500 microliters of extraction reagent and 100 microliters of magnetic beads to a two milliliter centrifuge tube.Aspirate 20 microliters of the nematodes and grind the samples at 9, 000 x g for 30 seconds. Incubate for five minutes and centrifuge at 12, 000 x g for 10 minutes at four degrees Celsius. Transfer the supernatant to a fresh centrifuge tube.Add 100 microliters of chloroform and mix by inverting the tube several times. Incubate for three minutes and then centrifuge at 12, 000 x g for 10 minutes at four degrees Celsius. Again, transfer the supernatant to a fresh centrifuge tube.Add 250 microliters of isopropyl alcohol and vortex vigorously. Centrifuge at 12, 000 x g for 10 minutes and vortex. Discard the supernatant and add 500 microliters of 75%ethanol to wash the RNA.Vortex the sample followed by centrifugation at 12, 000 x g for five minutes at four degrees Celsius. Air dry the RNA pellet for five minutes and resuspend it in 30 microliters of RNase free water. Calculate the RNA concentration using this formula and calculate the A260 to A280 ratio.Next, use a pair of primers to amplify the partial coding sequence of the BX ppm-1 gene from the B.xylophilus. Then clone the ppm-1 one gene sequences into a pGEM-T Easy vector containing the T7 promoter. Recover the 894 base pair long ppm-1 gene fragment by using the cloned plasmid as the template for pcr.Then, use an in vitro transcription kit to synthesize the dsRNA. Analyze the quality of the dsRNA using a spectrophotometer and visualize the products on a 1%agarose gel. Add four microliters of 5X soaking buffer and make up the volume to 20 microliters with double distilled water to get a final RNA concentration of 0.8 micrograms per milliliter.Then place the nematodes in the dish for 30 minutes and wait for the eggs to adhere to the bottom. Carefully remove the water and nematodes without disturbing the eggs until only the eggs remain in the dish. Hatch the collected eggs in the dark at 25 degree Celsius for 24 hours to obtain J2 larvae.Collect the larvae in a tube and wash them three times with double distilled water. Then, transfer the larvae into the tube containing the dsRNA solution. To this, add resorcinol solution to get a 1%solution.Place the larvae on a shaking table to ensure sufficient absorption of dsRNA into the larvae. For controls, soak the same quantity of nematodes in the soaking buffer without the dsRNA probe or with a GFP dsRNA probe. Perform a qPCR using the actB and tbb-2 genes as internal references to evaluate the changes in gene expression level.Use the delta delta Ct method to estimate the relative gene expression level from the dissolution curve and Ct value. After RNAi, culture the J2 larvae until adulthood on Botrytis cinerea lawns on PDA plates. Collect the adults using the Baermann funnel method as shown in section one.Acquire images of the adult nematodes under a microscope and use the ImageJ software to measure the body length of 50 male and 50 female nematodes. Analyze the data by calculating the mean and standard deviation for each sample. Apply Student's t test to compare the means of the samples from the different groups.Relative gene expression analysis after RNAi indicated that the ppm-1 dsRNA can effectively inhibit the expression of the ppm-1 one gene of B.Xylophilus. Whereas exogenous GFP dsRNA had no effect on the ppm-1 expression. After RNAi, the size of the adults markedly decreased despite attaining sexual maturity resulting in the small body size mutant phenotype.The mean body length of the mutant females and males was 544 and 526 micrometers compared to 971 and 912 micrometers for the control group The most important thing is to transfer the nematodes into the double strand RNA solution and add another reagent to stimulate the nematodes to feed. This method is suitable for large scale gene screen and is commonly used in cell research. Studying the gene function of B.Xylophilus by this method has guiding value for the biological control of B.Xylophilus.

application-rna-interference-pinewood-nematode-bursaphelenchus

Research

JoVE Journal

Biology

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence (T7, T3, SP6) and the gene to be transcribed (Figure 1A). A typical transcription reaction consists of the template DNA, RNA polymerase, ribonucleotide triphosphates, RNase inhibitor and buffer containing Mg2+ ions.
Large amounts of high quality RNA are often required for a variety of applications. Use of in vitro transcription has been reported for RNA structure and function studies such as splicing1, RNAi experiments in mammalian cells2, antisense RNA amplification by the "Eberwine method"3, microarray analysis4 and for RNA vaccine studies5. The technique can also be used for producing radiolabeled and dye labeled probes6. Warren, et al. recently reported reprogramming of human cells by transfection with in vitro transcribed capped RNA7. The T7 High Yield RNA Synthesis Kit from New England Biolabs has been designed to synthesize up to 180 &mu;g RNA per 20 &mu;l reaction. RNA of length up to 10kb has been successfully transcribed using this kit. Linearized plasmid DNA, PCR products and synthetic DNA oligonucleotides can be used as templates for transcription as long as they have the T7 promoter sequence upstream of the gene to be transcribed.
Addition of a 5' end cap structure to the RNA is an important process in eukaryotes. It is essential for RNA stability8, efficient translation9, nuclear transport10 and splicing11. The process involves addition of a 7-methylguanosine cap at the 5' triphosphate end of the RNA. RNA capping can be carried out post-transcriptionally using capping enzymes or co-transcriptionally using cap analogs. In the enzymatic method, the mRNA is capped using the Vaccinia virus capping enzyme12,13. The enzyme adds on a 7-methylguanosine cap at the 5' end of the RNA using GTP and S-adenosyl methionine as donors (cap 0 structure). Both methods yield functionally active capped RNA suitable for transfection or other applications14 such as generating viral genomic RNA for reverse-genetic systems15 and crystallographic studies of cap binding proteins such as eIF4E16.
In the method described below, the T7 High Yield RNA Synthesis Kit from NEB is used to synthesize capped and uncapped RNA transcripts of Gaussia luciferase (GLuc) and Cypridina luciferase (CLuc). A portion of the uncapped GLuc RNA is capped using the Vaccinia Capping System (NEB). A linearized plasmid containing the GLuc or CLuc gene and T7 promoter is used as the template DNA. The transcribed RNA is transfected into HeLa cells and cell culture supernatants are assayed for luciferase activity. Capped CLuc RNA is used as the internal control to normalize GLuc expression.

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

This method describes high yield in vitro synthesis of both capped and uncapped mRNA from a linearized plasmid containing the Gaussia luciferase (GLuc) gene. The RNA is purified and a fraction of the uncapped RNA is enzymatically capped using the Vaccinia virus capping enzyme. In the final step, the mRNA is transfected into HeLa cells and cell culture supernatants are assayed for luciferase activity.

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence ...

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

Double-strand RNA-mediated interference (RNAi) is an effective strategy to knock down target gene expression1-3. It has been applied to many model systems including plants, invertebrates and vertebrates. There are various methods to achieve RNAi in vivo4,5. For example, the target gene may be transformed into an RNAi vector, and then either permanently or transiently transformed into cell lines or primary cells to achieve gene knockdown effects; alternatively synthesized double-strand oligonucleotides from specific target genes (RNAi oligos) may be transiently transformed into cell lines or primary cells to silence target genes; or synthesized double-strand RNA molecules may be microinjected into an organism. Since the nematode C. elegans uses bacteria as a food source, feeding the animals with bacteria expressing double-strand RNA against target genes provides a viable strategy6. Here we present an RNAi feeding method to score body size phenotype. Body size in C. elegans is regulated primarily by the TGF- &beta; - like ligand DBL-1, so this assay is appropriate for identification of TGF-&beta; signaling components7. We used different strains including two RNAi hypersensitive strains to repeat the RNAi feeding experiments. Our results showed that rrf-3 strain gave us the best expected RNAi phenotype. The method is easy to perform, reproducible, and easily quantified. Furthermore, our protocol minimizes the use of specialized equipment, so it is suitable for smaller laboratories or those at predominantly undergraduate institutions.

Using RNA-mediated Interference Feeding Strategy to Screen for Genes Involved in Body Size Regulation in the Nematode C. elegans

We demonstrate how to use the RNAi feeding technique to knock down target genes and score body size phenotype in C. elegans. This method could be used for a large scale screen to identify potential genetic components of interest, such as those involved in body size regulation by DBL-1/TGF-&beta; signaling.

Double-strand RNA-mediated interference (RNAi) is an effective strategy to knock down target gene expression1-3. It has been applied to many model systems ...

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

The red flour beetle, Tribolium&#160;castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle&#8217;s body cavity.
In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting.

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

RNA interference (RNAi)-based gene knockdown techniques are at the core of Tribolium research. Here, we provide an overview of our larval RNAi technique in Tribolium castaneum. Larval RNAi is a simple, but powerful technique that provides quick access to loss-of-function phenotypes, allowing researchers to study gene functions in diverse contexts.

The red flour beetle, Tribolium&#160;castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully ...

Observation and Quantification of Mating Behavior in the Pinewood Nematode, Bursaphelenchus xylophilus

A method for observing and quantifying the mating behavior of the pinewood nematode, Bursaphelenchus xylophilus, was established under a stereomicroscope. To improve the mating efficiency of B. Xylophilus and to increase the chances of mating observation, virgin adults were cultured and used for the investigation. Eggs were obtained by keeping the nematodes in water and allowing the females to lay eggs for 10 min. The second-stage juveniles (J2) were synchronized by incubating the eggs for 24 h at 25 &#176;C in the dark, and the early J4 were obtained by culturing the J2 with grey mold, Botrytis cinerea, for another 52 h. At this time point, most J4 nematodes could be clearly distinguished as being male or female using their genital morphology. The male and female J4 were collected and cultured separately in two different Petri dishes for 24 h to get virgin adult nematodes. A virgin male and a virgin female were paired in a drop of water in the well of a concave slide. The mating behavior was filmed with a video recorder under a stereomicroscope. The whole period of the mating process was 82.8 &#177;3.91 min (mean &#177;SE) and could be divided into 4 different phases: searching, contacting, copulating, and lingering. The mean minutes of duration were 21.8 &#177; 2.0, 28.0 &#177; 1.9, 25.8 &#177; 0.7 and 7.2 &#177; 0.5, respectively. Eleven sub-behaviors were described: cruising, approaching, encountering, touching, hooping, locating, attaching, ejaculating, separating, quiescence, and roaming. Interestingly, obvious intra-sexual competition was observed when one female was grouped with 3 males or one male with 3 females. This protocol is useful and valuable, not only in investigating the mating behavior of B. xylophilus, but also in acting as a reference for ethological studies of other nematodes.

Observation and Quantification of Mating Behavior in the Pinewood Nematode, Bursaphelenchus xylophilus

A protocol for investigating the mating behavior of the pinewood nematode, Bursaphelenchus xylophilus, is presented. Behavioral features of B. xylophilus are described in the mating process.

A method for observing and quantifying the mating behavior of the pinewood nematode, Bursaphelenchus xylophilus, was established under a stereomicroscope. ...

Practical Use of RNA Interference: Oral Delivery of Double-stranded RNA in Liposome Carriers for Cockroaches

RNA interference (RNAi) has been widely applied for uncovering the biological functions of numerous genes, and has been envisaged as a pest control tool operating by disruption of essential gene expression. Although different methods, such as injection, feeding, and soaking, have been reported for successful delivery of double-stranded RNA (dsRNA), the efficiency of RNAi through oral delivery of dsRNA is highly variable among different insect groups. The German cockroach, Blattella germanica, is highly sensitive to the injection of dsRNA, as shown by many studies published previously. The present study describes a method to demonstrate that the dsRNA encapsulated with liposome carriers is sufficient to retard the degradation of dsRNA by midgut juice. Notably, the continuous feeding of dsRNA encapsulated by liposomes significantly reduces the tubulin expression in the midgut, and led to the death of cockroaches. In conclusion, the formulation and utilization of dsRNA lipoplexes, which protect dsRNA against nucleases, could be a practical use of RNAi for insect pest control in the future.

This manuscript demonstrates the depletion of gene expression in the midgut of the German cockroach through oral ingestion of double-stranded RNA encapsulated in liposomes.

RNA interference (RNAi) has been widely applied for uncovering the biological functions of numerous genes, and has been envisaged as a pest control tool ...

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological functions have been extensively studied. Indeed, the advent of next-generation deep sequencing and chromatin immunoprecipitation (ChIP) via specific histone modification antibodies has revolutionized our view of epigenetic regulation across the genome. Conversely, tissues typically consist of diverse cell types, and their complex mixture poses analytic challenges to investigating the epigenome in a particular cell type. To address the cell type-specific chromatin state in a genome-wide manner, we recently developed tandem chromatin immunoprecipitation sequencing (tChIP-Seq), which is based on the selective purification of chromatin by tagged core histone proteins from cell types of interest, followed by ChIP-Seq. The goal of this protocol is the introduction of best practices of tChIP-Seq. This technique provides a versatile tool for tissue-specific epigenome investigation in diverse histone modifications and model organisms.

We describe a step-by-step protocol for tandem chromatin immunoprecipitation sequencing (tChIP-Seq) that enables the analysis of cell-type-specific genome-wide histone modification.

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological ...

Nuclei Isolation from Adult Mouse Kidney for Single-Nucleus RNA-Sequencing

The kidneys regulate diverse biological processes such as water, electrolyte, and acid-base homeostasis. Physiological functions of the kidney are executed by multiple cell types arranged in a complex architecture across the corticomedullary axis of the organ. Recent advances in single-cell transcriptomics have accelerated the understanding of cell type-specific gene expression in renal physiology and disease. However, enzyme-based tissue dissociation protocols, which are frequently utilized for single-cell RNA-sequencing (scRNA-seq), require mostly fresh (non-archived) tissue, introduce transcriptional stress responses, and favor the selection of abundant cell types of the kidney cortex resulting in an underrepresentation of cells of the medulla.
Here, we present a protocol that avoids these problems. The protocol is based on nuclei isolation at 4 &#176;C from frozen kidney tissue. Nuclei are isolated from a central piece of the mouse kidney comprised of the cortex, outer medulla, and inner medulla. This reduces the overrepresentation of cortical cells typical for whole-kidney samples for the benefit of medullary cells such that data will represent the entire corticomedullary axis at sufficient abundance. The protocol is simple, rapid, and adaptable and provides a step towards the standardization of single-nuclei transcriptomics in kidney research.

Here, we present a protocol to isolate high-quality nuclei from frozen mouse kidneys that improve the representation of medullary kidney cell types and avoids the gene expression artifacts from enzymatic tissue dissociation.

The kidneys regulate diverse biological processes such as water, electrolyte, and acid-base homeostasis. Physiological functions of the kidney are ...

Effective Oral RNA Interference (RNAi) Administration to Adult Anopheles gambiae Mosquitoes

RNA interference has been a heavily utilized tool for reverse genetic analysis for two decades. In adult mosquitoes, double-stranded RNA (dsRNA) administration has been accomplished primarily via injection, which requires significant time and is not suitable for field applications. To overcome these limitations, here we present a more efficient method for robust activation of RNAi by oral delivery of dsRNA to adult Anopheles gambiae. Long dsRNAs were produced in Escherichia coli strain HT115 (DE3), and a concentrated suspension of heat-killed dsRNA-containing bacteria in 10% sucrose was offered on cotton balls ad-libitum to adult mosquitoes. Cotton balls were replaced every 2 days for the duration of the treatment. Use of this method to target doublesex (a gene involved in sex differentiation) or fork head (which encodes a salivary gland transcription factor) resulted in reduced target gene expression and/or protein immunofluorescence signal, as measured by quantitative Real-Time PCR (qRT-PCR) or fluorescence confocal microscopy, respectively. Defects in salivary gland morphology were also observed. This highly flexible, user-friendly, low-cost, time-efficient method of dsRNA delivery could be broadly applicable to target genes important for insect vector physiology and beyond.

Effective Oral RNA Interference RNAi Administration to Adult Anopheles gambiae Mosquitoes

The oral administration of dsRNA produced by bacteria, a delivery method for RNA interference (RNAi) that is routinely used in Caenorhabditis elegans, was successfully applied here to adult mosquitoes. Our method allows for robust reverse genetics studies and transmission-blocking vector studies without the use of injection.

RNA interference has been a heavily utilized tool for reverse genetic analysis for two decades. In adult mosquitoes, double-stranded RNA (dsRNA) ...

Isolation and Characterization of the Natural Microbiota of the Model Nematode Caenorhabditis elegans

The nematode Caenorhabditis elegans interacts with a large diversity of microorganisms in nature. In general, C. elegans is commonly found in rotten plant matter, especially rotten fruits like apples or on compost heaps. It is also associated with certain invertebrate hosts such as slugs and woodlice. These habitats are rich in microbes, which serve as food for C. elegans and which can also persistently colonize the nematode gut. To date, the exact diversity and consistency of the native C. elegans microbiota across habitats and geographic locations is not fully understood. Here, we describe a suitable approach for isolating C. elegans from nature and characterizing the microbiota of worms. Nematodes can be easily isolated from compost material, rotting apples, slugs, or attracted by placing apples on compost heaps. The prime time for finding C. elegans in the Northern Hemisphere is from September until November. Worms can be washed out of collected substrate material by immersing the substrate in buffer solution, followed by the collection of nematodes and their transfer onto nematode growth medium or PCR buffer for subsequent analysis. We further illustrate how the samples can be used to isolate and purify the worm-associated microorganisms and to process worms for 16S ribosomal RNA analysis of microbiota community composition. Overall, the described methods may stimulate new research on the characterization of the C. elegans microbiota across habitats and geographic locations, thereby helping to obtain a comprehensive understanding of the diversity and stability of the nematode's microbiota as a basis for future functional research.

Isolation and Characterization of the Natural Microbiota of the Model Nematode Caenorhabditis elegans

Caenorhabditis elegans is one of the main model species in biology, yet almost all research is performed in the absence of its naturally associated microbes. The methods described here will help to improve our understanding of the diversity of associated microbes as a basis for future functional C. elegans research.

The nematode Caenorhabditis elegans interacts with a large diversity of microorganisms in nature. In general, C. elegans is commonly found in rotten plant ...

Investigating Collective Behaviors in Nematodes Using Dog Food Agar Medium

The Large-Scale Cultivation of Nematodes to Study Their Collective Behaviors

Animals exhibit dynamic collective behaviors, as observed in flocks of birds, schools of fish, and crowds of humans. The collective behaviors of animals have been investigated in the fields of both biology and physics. In the laboratory, researchers have used various model animals such as the fruit fly and zebrafish for approximately a century, but it has remained a major challenge to study large-scale complex collective behavior orchestrated by these genetically tractable model animals. This paper presents a protocol to create an experimental system of collective behaviors in Caenorhabditis elegans. The propagated worms climb on the lid of the Petri plate and show collective swarming behavior. The system also controls worm interactions and behaviors by changing the humidity and light stimulation. This system allows us to examine the mechanisms underlying collective behaviors by changing environmental conditions and examining the effects of individual-level locomotion on collective behaviors using mutants. Thus, the system is useful for future research in both physics and biology.

Author Spotlight: Collective Behavioral Analysis of the Nematode, &lt;em&gt;Caenorhabditis elegans&lt;/em&gt;

Here, a system is reported for studying the collective behaviors of nematodes by culturing them in bulk using dog food agar medium. This system allows researchers to propagate large numbers of dauer worms and can be applied to Caenorhabditis elegans and other related species.

Animals exhibit dynamic collective behaviors, as observed in flocks of birds, schools of fish, and crowds of humans. The collective behaviors of animals ...