우리는 그들의 조언과 의견을 자신의 지원과 Geula 다비도프, 노암 Grimberg와 첸 박사 Guttman에 대한 아미르 Aharoni을 인정합니다.

1. E.에 엄마가 진의 복제와 표현 대장균 5&#39; - GCATTACGCATATGGACGACATCCGCCAGGTG - 3 &#39;와 5&#39; - GCGCGGCAGCCATA - TGGCATACG - 3&#39;돌연변이 유전자 mamAΔ41는 primers와 Magnetospirillum magneticum AMB - 1의 게놈 DNA의 중합 효소의 연쇄 반응 (PCR)을 사용하여 증폭되었습니다. 증폭된 DNA 조각에서 NcoI 사이트는 개시 코돈 ATG에서 도입하고 종료 코돈은 ScoI 사이트로 교체되었습니다. 조각은 NcoI와 SacI와 소화하고 pET52b (+)의 각 사이트에 복제, pET52bMamAΔ41 - AMB1에 상승을 제공했다. 이 구조에서 mamAΔ41 유전자는 C - 말단에있는 10 그 태그로 프레임에 융합되었다. 플라스미드는 대장균 E. 스트레인 BL21에 electroporated되었습니다. E. 대장균은 pET52bMamAΔ41을 품고 BL21가 (15) 자동 유도에서 3 시간 동안 암피실린 (50 MG / ML) 310 ° K를 포함하는 매체를 성장했다 변형. 재배 온도는 310 °에서 다음 300 ° K로 이동 300 ° K.시 추가 48 H에 대한 유지되었다 세포는 277에서 10 분 ° K. 대한 5,465그램에서 원심 분리에 의해 수확했다 8리터 문화가 젖어 세포 펠렛 60 그램 생산. 2. 생물 정보학 계산 ProtParam 서버 (http://www.expasy.ch/tools/protparam.html)를 사용하여 분자량 (MW), 아미노산 순서에 따라와 280nm에서 단백질의 1mg/1ml의 예측 흡수의 계산. 10His 태그 - MamAΔ41에 대한 MW는 22529 다 (240 아미노산)이며 MamAΔ41 (트롬빈에 의해 그의 태그 제거 후 남은 9 아미노산 포함)에 대한 MW가 20596.5Da (187 아미노산)입니다. 10His 태그 - MamAΔ41에 대한 280nm에서 단백질의 1mg/1ml의 예측 흡수는 0.595이고 0.579 MamAΔ41위한 것입니다. 또한, 아미노산 서열은 시스테인 잔류물을 포함하지 않습니다. 따라서, 감소 대리인은 정화 과정 필요는 없습니다. 3. MamAΔ41의 정제 <ol><li> 재고 솔루션 준비, 밖으로 무게 다음과 같은 농도에서 (200 ML 각) 준비 : 이미다졸 (MW 228.2 g / 몰) 4M 솔루션, NaCl (MW 58.44 g / 몰) 5M 솔루션 트리스 - HCL (MW 121.3 g / 몰 ) 1M 솔루션은 산도 = 8을 조정합니다. 솔루션 분명히 때까지 소용돌이를 사용하여 두 증류수 (DDW)과 혼합을 추가합니다. 0.22μm 필터 및 실온에서 보관과 필터 솔루션을 제공합니다. </li><li> 준비 및 재고 솔루션 (Table1)로부터 6 신선한 버퍼를 필터링합니다. </li><li> 희석 및 버퍼 1시 2분 비율, 세포의 g는 버퍼로 볼륨 (ML)에서 세포를 일시 중지합니다. </li><li> 샘플의 DNA 조각을 깰하기 위해 DNase I (1 MG / ML)의 박테리아의 각 10gr에 대한 10μl를 추가합니다. EDTA (에틸렌 다이아 민 테트라 초산) 무료 프로 테아제 억제제 칵테일의 박테리아의 각 20gr을위한 1ml를 추가합니다. 얼음 20 분 알을 품다. </li><li> 25,000 PSI 프랑스어 언론의 두 사이클에 의해 세포를 중단. sonication 달리, 프랑스 언론은 얇은 구멍을 통해 높은 압력 하에서 세포를 강제하여 대량 (&gt; 10ml) 세포 압출 것을 목표로하고 있습니다. 피스톤은 온도 상승으로 인해 그 사용 및 조립하기 전에 십분 얼음에 냉각해야합니다. </li><li> 25ml 초원 심 분리기 튜브에 lysed 세포를 전송 및 샘플은 튜브의 목 라인에 도달할 때까지 버퍼와 (50mg) 정확하게 그 균형을. </li><li> 277에서 1 시간 동안 27만g에서 울트라 원심 분리하여 별도의 세포 부스러기 ° K. </li><li> 컬럼에 20 % 에탄올에 보존 아르 니켈 NTA 수지, 4 ML을 추가하여 만든 중력 니켈 NTA 칼럼 (2.5cm 직경)를 준비합니다. 완전히 액체 포기 후 DDW 40 ML로 세척하고 완전히 유체 포기. 버퍼 A. 40 ML과 열의 사전 equilibrated 수지 </li><li> 중력 니켈 NTA 칼럼에서 울트라 원심 분리 튜브에서 용해 분수를 적용합니다. -을 통해 흐름을 수집 (언바운드 단백질)와 277K에서 보존, 액체 포기. </li><li> 펠렛을 스크랩하기 위해 작은 팁을 사용하여 울트라 원심 분리 튜브에서 펠렛 샘플을 수집합니다. 50μl 5 % 2X의 β - 메르 캅 토 에탄올 SDS - PAGE 샘플 버퍼에 제보를 섞는다. </li><li> -을 통해 흐름을 수집하고 277K에서 보존, 유체 포기 100 ML 버퍼 B.있는 컬럼을 씻으십시오. </li><li> 15 표시 eppendorf 튜브 (1.5ml)을 준비합니다. </li><li> 용리 - 가까이 열 밸브 다음 컬럼에 버퍼 C의 1ml를 로드할 수, 밸브 열고 흐름을 통해 컬렉션의 다음 3 분 알을 품다. 이 단계를 세 번 반복합니다. </li><li> Elute 정지 나머지 한 ML 버퍼 C 증가에와 밸브를 닫습니다. </li><li> 분수의 280nm에서 OD를 측정하여 단백질 피크의 위치를​​ 평가하고, OD 아직도&gt; 0.3 경우, 추가 샘플이 필요합니다. </li><li> 수집 분수의 SDS - PAGE 분석. 이러한 분석은 다음 예제와 함께 수행되어야 흐름을 통해 언바운드 단백질은 -을 통해 흐름을 씻고 Ultra - 원심 분리 펠렛 샘플. 10μl 5 % 2X SDS - PAGE 샘플 버퍼의 β - 메르 캅 토 에탄올 각 샘플에서 10μl를 섞습니다. 15% SDS - PAGE에 샘플을로드 180 볼트에서 45 분 동안 실행. </li><li> InstantBlue 솔루션 15 ML에 젤 스테인, 1 시간 동안 흔들. 플라스틱 상자를 커버하고 빛으로부터 보호되어 있는지 확인합니다. </li><li> 젤을 평가, 단백질 표현이 나타내는 밴드에 따라 높이와 특정 경우, 선택한 eluted 분수를 병합합니다. </li><li> 10 그분의 태그를 제거하기 위해 결합 샘플을 제조 업체의 추천에 따라, 소 트롬빈 (10 대 / μl), 1 MG 단백질 당 10μl 트롬빈를 추가합니다. </li><li> 투석은 초과 이미다졸 제거를 위해 사용되며 이온 교환 바인딩을하는 동안 필요한 수준에 NaCl 농도를 감소합니다. 투석을위한 7 KD 분자량의 원하는 길이를 잘라 (MWCO) 투석 튜브를 잘라. DDW로 씻어 한 끝 (또는 클립 인감)에서 매듭을합니다. 상단의 일부 공간을 떠나있는 동안 가방에 병합된 단백질 솔루션을 전송 최대 클램프. </li><li> 4 리터 냉장 투석 버퍼에 잠수함 투석 튜브 (버퍼 D). 277에서 천천히 밤을 통해 솔루션을 저어 ° K. </li><li> , 비커의 투석 튜브 출력을 가지고 작은 상처를 만들고 50ml 튜브에 단백질을 전송하기만하면됩니다. </li><li> 이온 교환 크로마 토그래피 : 빠른 성능 액체 크로마 토그래피 (FPLC)에 사전 포장 MonoQ 4.6/100 PE 열을 조립. DDW 여과 물 5 열 볼륨 (CV)로 컬럼을 씻으십시오. 버퍼 D. 5 CV와 Equilibrated 열 </li><li> DDW (두 루프 볼륨)와 사출 루프를 세척하고 주사 루프의 단백질을로드 버퍼 D.과 반복합니다. </li><li> 단백질 샘플을 (1 ML / 분 유량) 주사와 한정되지 않은 단백질의 SDS - PAGE 감지 분수를 수집 시작합니다. </li><li> 초기 단백질 볼륨 (3.23 단계)는 사출 루프보다 큰 경우에는 전체 표본이 칼럼에로드되기 전까지는, 루프를 세척하지 않고 단계 3.25-3.26를 반복합니다. </li><li> 억제할 수없는 단백질을 제거하기 위해 버퍼 C 3 CV와 컬럼을 씻으십시오. </li><li> 높은 흐름 속도가 비용에 사용될 수 있지만 버퍼 D &amp; E (100 % 버퍼 E는 그라디언트의 마지막 때), 유량 1 ML / 분 (사이 40 2000mM NaCl의 60 분 선형 그라디언트로 단백질을 Elute 큰 볼륨하지만, 덜 집중, 단백질 봉우리). 그들은 280nm 크로마토 그램에서 나타나는 단백질의 봉우리를 수집합니다. </li><li> 클린 사전 포장 열을 추천을 제조했다. </li><li> 수집 분수의 SDS - PAGE 분석. 이러한 분석은 다음 예제와 함께 수행되어야 억제할 수없는 단백질 흐름 통해 단백질 봉우리 흐름을 통해. SDS - PAGE를 실행하고 단계 3.17-3.18에 대한 언급으로 얼룩. </li><li> 단백질 미리 묻은 마커에 따라 예측된 MW에서 단백질 밴드 존재 젤을 평가해보십시오. 관련 단백질을 포함 선택 용출 분수를 병합합니다. </li><li> 크기 배제 크로마 토그래피에 필요한 NaCl 농도를 낮게하기 위해, 병합된 샘플을 Dialyze. 로 버퍼 F. 대해 단계 3.21-3.23에 언급된 투석을 수행 </li><li> 사용 Vivaspin - 15 10,000 MWCO 8 테이블 원심 분리기, 4000 RPM의 MG / ML.을 단백질 샘플을 집중 쿼츠 쿠베트에서 280nm에서 OD를 측정하여 원하는 농도를 확인합니다. 단백질이 너무 집중되면 버퍼 F로 희석하고 다시 측정합니다. </li><li> 크기 제외 미리 포장 열, FPLC에 HiLoad 60분의 26 Superdex 200, 조립, DDW 필터링 물 3 CV로 컬럼을 씻어. 버퍼 F. 3 CV와 Equilibrated 열 </li><li> 주사 루프의 단백질 시료에 대한 4 개 이상 ML을 로드할 수 없습니다 버퍼 F.와 동일한 볼륨에 의해 다음 5ml DDW (두 루프 볼륨)과 주사 루프를 씻으십시오. </li><li> 단백질 샘플을 (3.5 ML / 분 유량) 주사하고 그들이 280nm 크로마토 그램 나타나는 단백질 피크 분수를 수집 시작합니다. 그것이 열 볼륨에 도달할 때까지 버퍼 흐름을 보자. </li><li> 초기 단백질 볼륨 (3.23 단계)는 사출 루프보다 큰 경우에는 전체 표본이 칼럼에로드되기 전까지는, 루프를 세척하지 않고 단계 3.25-3.26를 반복합니다. </li><li> 제조 추천에 따라 청소 미리 포장 열. </li><li> 수집 분수의 SDS - PAGE 분석. 이러한 분석은 단백질 봉우리 샘플로 수행하여야한다. SDS - PAGE를 실행하고 단계 3.17-3.18에 대한 언급으로 얼룩. </li><li> 젤 평가 : 단백질 봉우리 특정하는 경우, 정확한 예측 MW에있는 단백질 미리 스테인드 마커와 한 밴드에 따라 관련 단백질의 eluted 분수를 선택 병합 볼 수 있습니다. </li><li> &gt; 20 테이블 원심 분리기에 MG / ML, 4000 RPM에 Vivaspin - 15 10,000 MWCO를 사용하여 단백질 샘플을 집중. 280nm에서 OD를 측정하여 원하는 농도를 확인합니다. 정화 MamAΔ41 그러면 26.5 결정화에 대한 MG / ML에 집중했다. </li> &lt;리튬&gt; 매트릭스를 이용한 레이저 탈착 / 이온화 (든 - TOF)를 사용하여 샘​​플 순도 및 단백질 식별을 확인합니다. </li><li> 각각 25 - 50μl 단백질, 단백질은 질량 분석기와 SDS - PAGE에 따라 투석을하는 경우, 사전 표시된 eppendorf 튜브에 집중 MamAΔ41를 나눕니다. </li><li> 플래시 193 ° K.에 액체 질소와 저장소에 냉동 </li></ol> 4. 대표 결과 이 프로토콜이 올바르게 완료되면 하나는 높은 정화, 크기 동질적인 농축 단백질 샘플을해야합니다. 이러한 단백질 샘플 결정화 실험을 위해뿐만 아니라 효소 반응 속도론, 구속력 친화력 등의 생화학 연구, 그리고 준비가되어 있습니다. 정화 프로토콜의 주요 단계의 대표적인 결과입니다 여기에 설명되어 있습니다. 니켈 - NTA 친화 칼럼의 용출 프로필 SDS - PAGE 분석 ~ 22kDa (그림 1)의 적절한 MW의 용해 분율로 표현 단백질 이상의 높은 공개한다. 흐름을 통해 한정되지 않은 단백질에 단백질이 통한 흐름과 울트라 원심 분리 펠렛 샘플 세척하면이 SDS - PAGE 분석도 최소를 공개해야합니다. 적절한 단백질 큰 대역이 샘플에 나타나지 않는 경우도 잘못된 버퍼 준비, 세포 파괴 또는 문화 자동 유도 조건과 성장의 문제에 문제를 고려해야합니다. 이온 교환 크로마 토그래피는 니켈 수지 (정전기 상호 작용이나 히스티딘 / 부정적인 아미노산 풍부한 단백질 루프에 의한)과 포경 그의 - 태그 바람직한 단백질에 묶인 채로 다른 E.coli의 단백질 위해 바람직한 단백질 간의 분리하기 위해 preformed입니다. 이 열은 증가 NaCl 농도에서 긍정적으로 충전 수지 자신의 바인딩 선호도에 따라 단백질을 분리합니다. 높은 부정 청구 단백질에 부정 청구 것들을 검토할 appose 높은 NaCl 농도에 elute 것입니다. 이 칼럼의 장점은 높은 흐름 속도와 바인딩 용량입니다. 이온 교환 크로마토 그램 (그림 2) 증가 NaCl 농도 3 단백질의 집단 사이 좋은 분리를 보여준다. SDS - PAGE 분석이 더욱 정화 단계가 필요한지 여부를 바람직한 하나 평가를 분리, 각 인구의 MW를 결정하기 위해 필요합니다. 두 번째 인구가 소 트롬빈에 의해 죽습 세 번째 인구가 낮은 농도로 인해 SDS - PAGE에서 탐지되지 않습니다되었습니다 MamAΔ41 + 그의 태그 (~ 22kDa) 동안 첫 번째 인구는 MamAΔ41 (~ 20 KDA)입니다. 단백질의 봉우리가 명확히 분리되지 않으면 하나는 잘못된 버퍼 준비를 고려하거나 NaCl 기울기의 기울기를 변경해야합니다. 크기 제외 크로마 토그래피는 니켈 - NTA 수지에 묶인 채로 및 이온 교환 크로마 토그래피 동안 분리되지 않은 다른 E.coli 세포 단백질 위해 바람직한 단백질 간의 분리하기 위해 preformed입니다. 이 항목은 자신의 크기에 따라 단백질을 분리합니다. 대형 단백질 큰 볼륨으로 eluted 것입니다 작은 반대 작은 용출 권 elute 것입니다. 칼럼 크로마토 그램 (그림 3)은 하나의 주 인구로 바람직한 단백질의 좋은 분리를 보여준다. 인구는 ~ 20 KDA의 MW로 적절한 단량체 크기 elute 나타납니다. ~ 80 KDA 밴드 (NI - NTA 수지를 바인딩 E.coli 전형적인 단백질)의 존재는 열 로딩하기 전에 SDS - PAGE에서 발견이 실행되는 동안 사라지게됩니다. 이 ~ 80 KDA 단백질의 농도가 시작하는 낮은 것이므로, 그 인구는 희석 및 SDS - PAGE 분석은 정화 효율을 결정하기 위해 필요에 의한 크로마토 그램에 나타나지 않습니다. 우리는 하나 반드시 해당 MW의 순수한 단백질의 존재를 확인할 수 있도록 SDS - PAGE로 주봉의 희석 및 농축 샘플을 로딩하는 것이 좋습니다. 이 단계에 의해 단백질이 정화이며 균질성이 든 - TOF에 의해 평가해야합니다. 이 분석은 10,176 다 (그림 4)에서 20,347 MW 다 다른의 MW의 단백질을 공개했다. ~ 10 KDA 단백질은 ~ 20 KDA 단백질이 부과 두 배가됩니다. 그의 태그 제거 후 남은 9 아미노산과 MamAΔ41의 예측 MW는 20596.5 다되었습니다. 얻은 든 - TOF MW에 비교하여 우리는 그들이 떨어져 248 다 것으로 나타났습니다. 이 차이가 든 - TOF 측정 오류 및 / 또는 첫 번째 메티오닌의 일반적인 저하와 두 번째 글리신으로 인해에서 발생할 수 있습니다. 결론을 위해서는 단백질이 높은 정화하고 추가 실험에 사용할 수 있습니다. <img src="/files/ftp_upload/1844/1844table.jpg" alt="표 1" /> 표 1. 버퍼 공법. <img src="/files/ftp_upload/1844/1844fig1.jpg" alt="그림 1" /> 그림 1. 니켈 - NTA 칼럼 정화의 대표 SDS - PAGE 분석 오른쪽에서 왼쪽으로,. P 울트라 원심 분리기 펠릿 (3.11 프로토콜 단계), W - 씻어 (3.12 프로토콜 단계), U - 억제할 수없는 단백질 (3.10 프로토콜 단계), E - 용출 샘프 다섯 차선레 (3.14 프로토콜 단계), M - 단백질 마커 (숫자 MW를 나타냅니다.) 화살표 MamAΔ41을 나타냅니다. <img src="/files/ftp_upload/1844/1844fig2.jpg" alt="그림 2" /> 그림 2. 이온 교환 크로마 토그래피 단계 (A) 이온 교환 (MonoQ 열) 크로마토 그램의 분석, 블루 - 수집 분수의 표시 - 흡수 280nm, 단백질 농도, 그린 - NaCl 농도, 레드를 나타냅니다. 이온 교환 정화 단계 (B) 대표 SDS - PAGE 분석. 왼쪽에서 오른쪽으로, M - 단백질 마커 (숫자 MW를 나타냅니다), A6 - 첫번째 피크 분율, A8 초 피크 ​​분수. <img src="/files/ftp_upload/1844/1844fig3.jpg" alt="그림 3" /> 그림 3. 크기 배제 크로마 토그래피 분석 (A) 크기 배제 (Superdex 200 열) 크로마토 그램, 블루 - 흡수 280nm, 단백질 농도, 수집 분수의 빨간 표시를 나타냅니다. 크기 제외 정화 단계 (B) 대표 SDS - PAGE 분석. 왼쪽에서 오른쪽으로, M - 단백질 마커 (숫자 MW를 나타냅니다), PreI - 사전 주입 샘플, 첫 번째 정상에서 수집한 A4 - 6 결합 분율, A4 - 6D - 희석 분율은 정상에서 수집했습니다. <img src="/files/ftp_upload/1844/1844fig4.jpg" alt="그림 4" /> 그림 4. 매트릭스 - 보조 레이저 탈착 / 이온화 (든 - TOF) 정화 MamAΔ41의 질량 스펙트럼. 매트릭스 Sinapic 산성 (SA)입니다. MamAΔ41도 같이 20,347 다에 나타난 것은 다 10176에 MamAΔ41의 두 배로 부과 수종입니다.

<ol>
	<li>Faivre, D., Schuler, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Magnetotactic+Bacteria+and+Magnetosomes.">Magnetotactic Bacteria and Magnetosomes.</a> Chem Rev. 108, 4875-4898 (2008).</li><li>D'Andrea, L. D., Regan, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TPR+proteins:+the+versatile+helix.">TPR proteins: the versatile helix.</a> Trends Biochem Sci. 28, 655-662 (2003).</li><li>Young, J. C., Barral, J. M., Hartl, U. l. r. i. c. h., F, . <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=More+than+folding:+localized+functions+of+cytosolic+chaperones.">More than folding: localized functions of cytosolic chaperones.</a> Trends Biochem Sci. 28, 541-547 (2003).</li><li>Brocard, C., Hartig, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peroxisome+targeting+signal+1:+is+it+really+a+simple+tripeptide?.">Peroxisome targeting signal 1: is it really a simple tripeptide?.</a> Biochim Biophys Acta. 1763, 1565-1573 (2006).</li><li>Fransen, M., Amery, L., Hartig, A., Brees, C., Rabijns, A., Mannaerts, G. P., Van Veldhoven, P. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+the+PTS1-+and+Rab8b-binding+properties+of+Pex5p+and+Pex5Rp/TRIP8b.">Comparison of the PTS1- and Rab8b-binding properties of Pex5p and Pex5Rp/TRIP8b.</a> Biochim Biophys Acta. 1783, 864-873 (2008).</li><li>Baker, M. J., Frazier, A. E., Gulbis, J. M., Ryan, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+protein-import+machinery:+correlating+structure+with+function.">Mitochondrial protein-import machinery: correlating structure with function.</a> Trends Cell Biol. 17, 456-464 (2007).</li><li>Mirus, O., Bionda, T., von Haeseler, A., Schleiff, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionarily+evolved+discriminators+in+the+3-TPR+domain+of+the+Toc64+family+involved+in+protein+translocation+at+the+outer+membrane+of+chloroplasts+and+mitochondria.">Evolutionarily evolved discriminators in the 3-TPR domain of the Toc64 family involved in protein translocation at the outer membrane of chloroplasts and mitochondria.</a> J Mol Model. 15, 971-982 (2009).</li><li>Gatsos, X., Perry, A. J., Anwari, K., Dolezal, P., Wolynec, P. P., Likic, V. A., Purcell, A. W., Buchanan, S. K., Lithgow, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+secretion+and+outer+membrane+assembly+in+Alphaproteobacteria.">Protein secretion and outer membrane assembly in Alphaproteobacteria.</a> FEMS Microbiol Rev. 32, 995-1009 (2008).</li><li>Tiwari, D., Singh, R. K., Goswami, K., Verma, S. K., Prakash, B., Nandicoori, V. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Key+residues+in+Mycobacterium+tuberculosis+protein+kinase+G+play+a+role+in+regulating+kinase+activity+and+survival+in+the+host.">Key residues in Mycobacterium tuberculosis protein kinase G play a role in regulating kinase activity and survival in the host.</a> J Biol Chem. 284, 27467-27479 (2009).</li><li>Edqvist, P. J., Broms, J. E., Betts, H. J., Forsberg, A., Pallen, M. J., Francis, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tetratricopeptide+repeats+in+the+type+III+secretion+chaperone,+LcrH:+their+role+in+substrate+binding+and+secretion.">Tetratricopeptide repeats in the type III secretion chaperone, LcrH: their role in substrate binding and secretion.</a> Mol Microbiol. 59, 31-44 (2006).</li><li>Grunberg, K., Muller, E. C., Otto, A., Reszka, R., Linder, D., Kube, M., Reinhardt, R., Schuler, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+and+proteomic+analysis+of+the+magnetosome+membrane+in+Magnetospirillum+gryphiswaldense.">Biochemical and proteomic analysis of the magnetosome membrane in Magnetospirillum gryphiswaldense.</a> Appl Environ Microbiol. 70, 1040-1050 (2004).</li><li>Komeili, A., Vali, H., Beveridge, T. J., Newman, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Magnetosome+vesicles+are+present+before+magnetite+formation,+and+MamA+is+required+for+their+activation.">Magnetosome vesicles are present before magnetite formation, and MamA is required for their activation.</a> Proc Natl Acad Sci USA. 101, 3839-3843 (2004).</li><li>Okuda, Y., Fukumori, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+and+characterization+of+a+magnetosome-associated+protein,+TPR-containing+MAM22,+in+Escherichia+coli.">Expression and characterization of a magnetosome-associated protein, TPR-containing MAM22, in Escherichia coli.</a> FEBS Lett. 491, 169-173 (2001).</li><li>Taoka, A., Asada, R., Sasaki, H., Anzawa, K., Wu, L. F., Fukumori, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+localizations+of+Mam22+and+Mam12+in+the+magnetosomes+of+Magnetospirillum+magnetotacticum.">Spatial localizations of Mam22 and Mam12 in the magnetosomes of Magnetospirillum magnetotacticum.</a> J Bacteriol. 188, 3805-3812 (2006).</li><li>Studier, F. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+by+auto-induction+in+high+density+shaking+cultures.">Protein production by auto-induction in high density shaking cultures.</a> Protein Expression and Purification. 41, 207-234 (2005).</li></ol>

단백질 정제는 생화학 단백질이나 구조 연구의 주요 단계입니다. 각각의 단백질 자체 동작과 독특한 있기 때문에 하나의 속성을 정의하고 이에 따라 그 정화를 수정해야합니다. 단백질 대상은 생물 정보학 도구를 사용하여 정화위한 첫 단계로 분석을해야합니다. 그들은 대상 ISO - 전기 지점을 계산 환경 및 특수 이온 / 리간드에 대한 필요성을 감소 / 산화에 대한 필요성을 평가하는 데 사용됩니?...

<table><tbody><tr><td>French Press</td><td>Equipment</td><td>Thermo Fisher Scientific, Inc.</td><td>FA-078A</td><td></td></tr><tr><td>Pressure cell</td><td>Equipment</td><td>Thermo Fisher Scientific, Inc.</td><td>FA-032</td><td></td></tr><tr><td>Ultra-centrifuge</td><td>Equipment</td><td>Sorvall, Thermo Scientific</td><td>Discovery 90SE</td><td></td></tr><tr><td>Rottor</td><td>Equipment</td><td>Beckman Coulter Inc.</td><td>Ti60</td><td></td></tr><tr><td>Ultra-centrifuge tubes; PC-Bottle+Cap Assay 26.3ml</td><td>Equipment</td><td>Beckman Coulter Inc.</td><td>BC-355618</td><td></td></tr><tr><td>2.5cm diameter, Glass Econo-Column Chromatography Columns</td><td>Equipment</td><td>Bio-Rad</td><td>737-2521</td><td></td></tr><tr><td>Ni-NTA His Bind resin</td><td>Equipment</td><td>Novagen, EMD Millipore</td><td>M0063428</td><td></td></tr><tr><td>Spectrophotometer</td><td>Equipment</td><td>Amersham</td><td>Ultraspec 2100 pro</td><td></td></tr><tr><td>Quartz cuvette</td><td>Equipment</td><td>Hellma</td><td>104-QS</td><td></td></tr><tr><td>Fast Performance Liquid Chromatography- AKTA purifier 10</td><td>Equipment</td><td>GE Healthcare</td><td>28-4062-64</td><td></td></tr><tr><td>Ion exchange column &amp;#8211; MonoQ 4.6/100 PE</td><td>Equipment</td><td>GE Healthcare</td><td>10025543</td><td></td></tr><tr><td>Size exclusion pre-packed column-HiLoad 26/60 Superdex 200</td><td>Equipment</td><td>GE Healthcare</td><td>17-1071-01</td><td></td></tr><tr><td>Centricon - Vivaspin15 &amp;#8211; 10,000 MWCO</td><td>Equipment</td><td>Sartorius AG</td><td>VS1501</td><td></td></tr><tr><td>Table centrifuge</td><td>Equipment</td><td>Thermo Fisher Scientific, Inc.</td><td>IEC CL30R</td><td></td></tr><tr><td>MALDI-TOF</td><td>Equipment</td><td>Bruker Corporation</td><td>Reflex IV</td><td></td></tr><tr><td>Tris-HCl (hydrotymethyl) aminomethane</td><td>Reagent</td><td>BioLab</td><td>20092391</td><td></td></tr><tr><td>Sodium Chloride</td><td>Reagent</td><td>FRUTROM</td><td>235553470</td><td></td></tr><tr><td>Imidazole</td><td>Reagent</td><td>Alfa Aesar</td><td>288-32-4</td><td></td></tr><tr><td>EDTA free protease inhibitors cocktail</td><td>Reagent</td><td>Sigma-Aldrich</td><td>P-8849</td><td></td></tr><tr><td>Dnase I (Deoxyribonuclease I)</td><td>Reagent</td><td>Sigma-Aldrich</td><td>DN-25</td><td></td></tr><tr><td>Bovine Thrombin</td><td>Reagent</td><td>Fisher Scientific</td><td>BP25432</td><td></td></tr><tr><td>Glycine</td><td>Reagent</td><td>BioLab</td><td>07132391</td><td></td></tr><tr><td>Soudim Dodecyl Sulfate (SDS)</td><td>Reagent</td><td>BioLab</td><td>19822391</td><td></td></tr><tr><td>Beta-mercapt&amp;#8211;thanol</td><td>Reagent</td><td>Sigma-Aldrich</td><td>M-3148</td><td></td></tr><tr><td>InstantBlue</td><td>Reagent</td><td>Expedeon</td><td>1SB01L</td><td></td></tr><tr><td>PageRuler Prestained Protein Ladder</td><td>Reagent</td><td>Fermentas</td><td>SM0671</td><td></td></tr></tbody></table>

purification of the m. magneticum strain amb-1 magnetosome associated protein mama&delta;41

Magnetotactic 박테리아는 지자기의 필드 함께 스스로를 동쪽을 향하게 수 있습니다 수생 미생물의 다양한 그룹을 구성. 이 문제는 적합한 환경에서 검색을 돕기 위해 생각됩니다<em&gt; (1)</em&gt;. 이 기능은 magnetosome에 의해 수여됩니다 지질의 선형 체인 어셈블리로 구성되어 subcellular organelle은 자철광 또는 greigite의 ~ 50 나노미터 크리스탈 biomineralize하고 묶으에 각 수 vesicles. 기능 vesicles의 형성에 필요한 것으로 표시되었다 magnetosome의 주요 구성 요소가 마마입니다. 엄마가 가장 특징 magnetosome - 관련 단백질 중 하나입니다 매우 풍부한 magnetosome - 관련 단백질입니다<em&gt; 생체내에</em&gt;<em&gt; (2-6)</em&gt;. 이 문서는, 엄마의 정화에 초점을 맞추고있는 연구 임에도 불구하고<em&gt; 생체내에</em&gt; 더 명확한 기능이나 구조 자세한 사항은 그것을 발견되지 않았습니다. 생물 정보학 분석 엄마가 단백질을 포함하는 테트라 - tricopeptide 반복 (TPR)입니다 것을 제안했습니다. TPR은 단백질의 다양한 큰 접어 이러한이나 성형 일환으로 발견 구조적 모티프이며, 그것은 단백질 - 단백질 상호 작용과 mediates 다중 단백질 단지에 대한 템플릿 역할<em&gt; (7)</em&gt;. TPRs는 진핵 세포 organelle 프로세스와 많은 세균 경로에 많은 중요한 작업에 참여<em&gt; (8-14).</em엄마 이해하기&gt; 위해서는 단백질을 포함하는 독특한 TPR은 매우 정제된 단백질은 첫 단계로 필요합니다. 이 문서에서는, 우리는에서 안정적인 엄마를 삭제 돌연변이 (MamAΔ41)에 대한 정화 프로토콜을 제시<em&gt; M. magneticum</em&gt; AMB - 1.

Watch this Scientific Journal Video about Purification of the M. magneticum Strain AMB-1 Magnetosome Associated Protein MamAÎ”41 at JoVE.com

Purification of the M. magneticum Strain AMB-1 Magnetosome Associated Protein MamA&Delta;41

엄마가 magnetosome 활성화에 참여하는 표시되었습니다 독특한 Magnetosome 관련된 단백질이다. 여기에서 엄마가 삭제 돌연변이의 정화 프로토콜 (MamAΔ41)을 제시<em&gt; M. magneticum</em&gt; AMB - 1.

의 정화 M. magneticum 스트레인 AMB - 1 Magnetosome 관련 단백질 MamAΔ41

Magnetotactic bacteria comprise a diverse group of aquatic microorganisms that are able to orientate themselves along geomagnetic fields. This behavior is ...

purification-m-magneticum-strain-amb-1-magnetosome-associated-protein

Research

JoVE Journal

Biology

13.5K 조회수.  Ben-Gurion University. 엄마가 magnetosome 활성화에 참여하는 표시되었습니다 독특한 Magnetosome 관련된 단백질이다. 여기에서 엄마가 삭제 돌연변이의 정화 프로토콜 (MamAΔ41)을 제시 M. magneticum AMB - 1.

비디오: Purification of the M. magneticum Strain AMB-1 Magnetosome Associated Protein MamAΔ41

Mitochondria-associated ER Membranes (MAMs) and Glycosphingolipid Enriched Microdomains (GEMs): Isolation from Mouse Brain

Intracellular organelles are highly dynamic structures with varying shape and composition, which are subjected to cell-specific intrinsic and extrinsic cues. Their membranes are often juxtaposed at defined contact sites, which become hubs for the exchange of signaling molecules and membrane components1,2,3,4. The inter-organellar membrane microdomains that are formed between the endoplasmic reticulum (ER) and the mitochondria at the opening of the IP3-sensitive Ca2+ channel are known as the mitochondria associated-ER membranes or MAMs4,5,6. The protein/lipid composition and biochemical properties of these membrane contact sites have been extensively studied particularly in relation to their role in regulating intracellular Ca2+ 4,5,6. The ER serves as the primary store of intracellular Ca2+, and in this capacity regulates a myriad of cellular processes downstream of Ca2+ signaling, including post-translational protein folding and protein maturation7. Mitochondria, on the other hand, maintain Ca2+ homeostasis, by buffering cytosolic Ca2+ concentration thereby preventing the initiation of apoptotic pathways downstream of Ca2+ unbalance4,8. The dynamic nature of the MAMs makes them ideal sites to dissect basic cellular mechanisms, including Ca2+ signaling and regulation of mitochondrial Ca2+ concentration, lipid biosynthesis and transport, energy metabolism and cell survival 4,9,10,11,12. Several protocols have been described for the purification of these microdomains from liver tissue and cultured cells13,14. 
	Taking previously published methods into account, we have adapted a protocol for the isolation of mitochondria and MAMs from the adult mouse brain. To this procedure we have added an extra purification step, namely a Triton X100 extraction, which enables the isolation of the glycosphingolipid enriched microdomain (GEM) fraction of the MAMs. These GEM preparations share several protein components with caveolae and lipid rafts, derived from the plasma membrane or other intracellular membranes, and are proposed to function as gathering points for the clustering of receptor proteins and for protein&#x2013;protein interactions4,15.

Mitochondria-associated ER Membranes MAMs and Glycosphingolipid Enriched Microdomains GEMs: Isolation from Mouse Brain

This procedure illustrates how to isolate from the adult mouse brain the mitochondria-associated ER membranes or MAMs and the glycosphingolipid-enriched microdomain fractions from MAMs and mitochondrial preparations.

미토콘드리아 - 관련 ER의 멤브레인 (MAMs)와 Glycosphingolipid 강화 Microdomains (보석) : 마우스 뇌에서 절연

Intracellular organelles are highly dynamic structures with varying shape and composition, which are subjected to cell-specific intrinsic and extrinsic ...

연구

신경과학

Reconstitution of Msp1 Extraction Activity with Fully Purified Components

As the center for oxidative phosphorylation and apoptotic regulation, mitochondria play a vital role in human health. Proper mitochondrial function depends on a robust quality control system to maintain protein homeostasis (proteostasis). Declines in mitochondrial proteostasis have been linked to cancer, aging, neurodegeneration, and many other diseases. Msp1 is a AAA+ ATPase anchored in the outer mitochondrial membrane that maintains proteostasis by removing mislocalized tail-anchored proteins. Using purified components reconstituted into proteoliposomes, we have shown that Msp1 is necessary and sufficient to extract a model tail-anchored protein from a lipid bilayer. Our simplified reconstituted system overcomes several of the technical barriers that have hindered detailed study of membrane protein extraction. Here, we provide detailed methods for the generation of liposomes, membrane protein reconstitution, and the Msp1 extraction assay.

Here, we present a detailed protocol for reconstitution of Msp1 extraction activity with fully purified components in defined proteoliposomes.

완전히 정제된 구성 요소로 Msp1 추출 활동의 재구성

As the center for oxidative phosphorylation and apoptotic regulation, mitochondria play a vital role in human health. Proper mitochondrial function ...

생화학

Synthesis of Cationized Magnetoferritin for Ultra-fast Magnetization of Cells

Many important biomedical applications, such as cell imaging and remote manipulation, can be achieved by labeling cells with superparamagnetic iron oxide nanoparticles (SPIONs). Achieving sufficient cellular uptake of SPIONs is a challenge that has traditionally been met by exposing cells to elevated concentrations of SPIONs or by prolonging exposure times (up to 72 hr). However, these strategies are likely to mediate toxicity. Here, we present the synthesis of the protein-based SPION magnetoferritin as well as a facile surface functionalization protocol that enables rapid cell magnetization using low exposure concentrations. The SPION core of magnetoferritin consists of cobalt-doped iron oxide with an average particle diameter of 8.2 nm mineralized inside the cavity of horse spleen apo-ferritin. Chemical cationization of magnetoferritin produced a novel, highly membrane-active SPION that magnetized human mesenchymal stem cells (hMSCs) using incubation times as short as one minute and iron concentrations as lows as 0.2 mM.

A protocol for the synthesis and cationization of cobalt-doped magnetoferritin is presented, as well as a method to rapidly magnetize stem cells with cationized magnetoferritin.

세포의 초고속 자화에 대한 양이온 Magnetoferritin의 합성

Many important biomedical applications, such as cell imaging and remote manipulation, can be achieved by labeling cells with superparamagnetic iron oxide ...

생체공학

Bacterial Expression and Purification of Human Matrix Metalloproteinase-3 using Affinity Chromatography

Matrix metalloproteinases (MMPs) belong to the family of metzincin proteases with central roles in extracellular matrix (ECM) degradation and remodeling, as well as interactions with several growth factors and cytokines. Overexpression of specific MMPs is responsible in several diseases such as cancer, neurodegenerative diseases, and cardiovascular disease. MMPs have been the center of attention recently as targets to develop therapeutics that can treat diseases correlated to MMP overexpression.
To study the MMP mechanism in solution, more facile and robust recombinant protein expression and purification methods are needed for the production of active, soluble MMPs. However, the catalytic domain of most MMPs cannot be expressed in Escherichia coli (E. coli) in soluble form due to lack of posttranslational machinery, whereas mammalian expression systems are usually costly and have lower yields. MMP inclusion bodies must undergo the tedious and laborious process of extensive purification and refolding, significantly reducing the yield of MMPs in native conformation. This paper presents a protocol using Rosetta2(DE3)pLysS (hereafter referred to as R2DP) cells to produce matrix metalloproteinase-3 catalytic domain (MMP-3cd), which contains an N-terminal His-tag followed by pro-domain (Hisx6-pro-MMP-3cd) for use in affinity purification. R2DP cells enhance the expression of eukaryotic proteins through a chloramphenicol-resistant plasmid containing codons normally rare in bacterial expression systems. Compared to the traditional cell line of choice for recombinant protein expression, BL21(DE3), purification using this new strain improved the yield of purified Hisx6-pro-MMP-3cd. Upon activation and desalting, the pro domain is cleaved along with the N-terminal His-tag, providing active MMP-3cd for immediate use in countless in vitro applications. This method does not require expensive equipment or complex fusion proteins and describes rapid production of recombinant human MMPs in bacteria.

His-tag purification, dialysis, and activation are employed to increase yields of soluble, active matrix metalloproteinase-3 catalytic domain protein expression in bacteria. Protein fractions are analyzed via SDS-PAGE gels.

박테리아 발현 및 친화성 크로마토그래피를 이용한 인간 매트릭스 메탈로프로테이나제-3의 정제

Matrix metalloproteinases (MMPs) belong to the family of metzincin proteases with central roles in extracellular matrix (ECM) degradation and remodeling, ...

Stable Aqueous Suspensions of Manganese Ferrite Clusters with Tunable Nanoscale Dimension and Composition

Manganese ferrite clusters (MFCs) are spherical assemblies of tens to hundreds of primary nanocrystals whose magnetic properties are valuable in diverse applications. Here we describe how to form these materials in a hydrothermal process that permits the independent control of product cluster size (from 30 to 120 nm) and manganese content of the resulting material. Parameters such as the total amount of water added to the alcoholic reaction media and the ratio of manganese to iron precursor are important factors in achieving multiple types of MFC nanoscale products. A fast purification method uses magnetic separation to recover the materials making production of grams of magnetic nanomaterials quite efficient. We overcome the challenge of magnetic nanomaterial aggregation by applying highly charged sulfonate polymers to the surface of these nanomaterials yielding colloidally stable MFCs that remain non-aggregating even in highly saline environments. These non-aggregating, uniform, and tunable materials are excellent prospective materials for biomedical and environmental applications.

We report a one-pot hydrothermal synthesis of manganese ferrite clusters (MFCs) that offers independent control over material dimension and composition. Magnetic separation allows rapid purification while surface functionalization using sulfonated polymers ensures the materials are non-aggregating in biologically relevant medium. The resulting products are well positioned for biomedical applications.

튜블 가능한 나노 스케일 치수 및 구성망간 페릿 클러스터의 안정적인 수성 현탁액

Manganese ferrite clusters (MFCs) are spherical assemblies of tens to hundreds of primary nanocrystals whose magnetic properties are valuable in diverse ...

화학

Purification of the Membrane Compartment for Endoplasmic Reticulum-associated Degradation of Exogenous Antigens in Cross-presentation

Dendritic cells (DCs) are highly capable of processing and presenting internalized exogenous antigens upon major histocompatibility class (MHC) I molecules also known as cross-presentation (CP). CP plays an important role not only in the stimulation of na&#239;ve CD8+ T cells and memory CD8+ T cells for infectious and tumor immunity but also in the inactivation of self-acting na&#239;ve T cells by T cell anergy or T cell deletion. Although the critical molecular mechanism of CP remains to be elucidated, accumulating evidence indicates that exogenous antigens are processed through endoplasmic reticulum-associated degradation (ERAD) after export from non-classical endocytic compartments. Until recently, characterizations of these endocytic compartments were limited because there were no specific molecular markers other than exogenous antigens. The method described here is a new vesicle isolation protocol, which allows for the purification of these endocytic compartments. Using this purified microsome, we reconstituted the ERAD-like transport, ubiquitination, and processing of the exogenous antigen in vitro, suggesting that the ubiquitin-proteasome system processed the exogenous antigen after export from this cellular compartment. This protocol can be further applied to other cell types to clarify the molecular mechanism of CP.

The method described here is a new vesicle isolation protocol, which allows for the purification of the cellular compartments where exogenous antigens are processed by endoplasmic reticulum-associated degradation in cross-presentation.

외 인 항 원 십자가-프레 젠 테이 션에의 바인딩과 그물 관련 성능 저하 막 구획의 정화

Dendritic cells (DCs) are highly capable of processing and presenting internalized exogenous antigens upon major histocompatibility class (MHC) I ...

면역학 및 감염병학

Collection, Isolation and Enrichment of Naturally Occurring Magnetotactic Bacteria from the Environment

Magnetotactic bacteria (MTB) are aquatic microorganisms that were first notably described in 19751 from sediment samples collected in salt marshes of Massachusetts (USA). Since then MTB have been discovered in stratified water- and sediment-columns from all over the world2. One feature common to all MTB is that they contain magnetosomes, which are intracellular, membrane-bound magnetic nanocrystals of magnetite (Fe3O4) and/or greigite (Fe3S4) or both3, 4. In the Northern hemisphere, MTB are typically attracted to the south end of a bar magnet, while in the Southern hemisphere they are usually attracted to the north end of a magnet3,5. This property can be exploited when trying to isolate MTB from environmental samples.
One of the most common ways to enrich MTB is to use a clear plastic container to collect sediment and water from a natural source, such as a freshwater pond. In the Northern hemisphere, the south end of a bar magnet is placed against the outside of the container just above the sediment at the sediment-water interface. After some time, the bacteria can be removed from the inside of the container near the magnet with a pipette and then enriched further by using a capillary racetrack6 and a magnet. Once enriched, the bacteria can be placed on a microscope slide using a hanging drop method and observed in a light microscope or deposited onto a copper grid and observed using transmission electron microscopy (TEM).
Using this method, isolated MTB may be studied microscopically to determine characteristics such as swimming behavior, type and number of flagella, cell morphology of the cells, shape of the magnetic crystals, number of magnetosomes, number of magnetosome chains in each cell, composition of the nanomineral crystals, and presence of intracellular vacuoles.

We demonstrate a method to collect magnetotactic bacteria (MTB) that can be applied to natural waters. MTB can be isolated and enriched from sediment samples using a relatively simple setup that takes advantage of the bacteria's natural magnetism. Isolated MTB can then be examined in detail using both light and electron microscopy.

당연히 환경에서 Magnetotactic 박테리아를 발생의 수집, 절연 및 강화

Magnetotactic bacteria (MTB) are aquatic microorganisms that were first notably described in 19751 from sediment samples collected in salt marshes of ...

생물학

Growing Magnetotactic Bacteria of the Genus Magnetospirillum: Strains MSR-1, AMB-1 and MS-1

Magnetotactic bacteria are Gram-negative, motile, mainly aquatic prokaryotes ubiquitous in freshwater and marine habitats. They are characterized by their ability to biomineralize magnetosomes, which are magnetic nanometer-sized crystals of magnetite (Fe3O4) or greigite (Fe3S4) surrounded by a lipid bilayer membrane, within their cytoplasm. For most known magnetotactic bacteria, magnetosomes are assembled in chains inside the cytoplasm, thereby conferring a permanent magnetic dipole moment to the cells and causing them to align passively with external magnetic fields. Because of these specific features, magnetotactic bacteria have a great potential for commercial and medical applications. However, most species are microaerophilic and have specific O2 concentration requirements, making them more difficult to grow routinely than many other bacteria such as Escherichia coli. Here we present detailed protocols for growing three of the most widely studied strains of magnetotactic bacteria, all belonging to the genus Magnetospirillum. These methods allow for precise control of the O2 concentration made available to the bacteria, in order to ensure that they grow normally and synthesize magnetosomes. Growing magnetotactic bacteria for further studies using these procedures does not require the experimentalist to be an expert in microbiology. The general methods presented in this article may also be used to isolate and culture other magnetotactic bacteria, although it is likely that growth media chemical composition will need to be modified.

Growing Magnetotactic Bacteria of the Genus Magnetospirillum: Strains MSR-1, AMB-1 and MS-1

We present a procedure for growing several strains of Magnetospirillum in two different types of growth media. Magnetospirillum gryphiswaldense strain MSR-1 is grown in both liquid and O2 concentration gradient semi-solid media while M. magneticum strain AMB-1 and M. magnetotacticum strain MS-1 are grown in liquid medium.

속 Magnetospirillum의 Magnetotactic 박테리아 성장: 변종 MSR-1, 자녀-1 및 MS-1

Magnetotactic bacteria are Gram-negative, motile, mainly aquatic prokaryotes ubiquitous in freshwater and marine habitats. They are characterized by their ...

Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples

Quasi-metagenomics sequencing refers to the sequencing-based analysis of modified microbiomes of food and environmental samples. In this protocol, microbiome modification is designed to concentrate genomic DNA of a target foodborne pathogen contaminant to facilitate the detection and subtyping of the pathogen in a single workflow. Here, we explain and demonstrate the sample preparation steps for the quasi-metagenomics analysis of Salmonella enterica from representative food and environmental samples including alfalfa sprouts, ground black pepper, ground beef, chicken breast and environmental swabs. Samples are first subjected to the culture enrichment of Salmonella for a shortened and adjustable duration (4&#8211;24 h). Salmonella cells are then selectively captured from the enrichment culture by immunomagnetic separation (IMS). Finally, multiple displacement amplification (MDA) is performed to amplify DNA from IMS-captured cells. The DNA output of this protocol can be sequenced by high throughput sequencing platforms. An optional quantitative PCR analysis can be performed to replace sequencing for Salmonella detection or assess the concentration of Salmonella DNA before sequencing.

Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples

Here, we present a protocol to prepare DNA samples from food and environmental microbiomes for concerted detection and subtyping of Salmonella through quasimetagenomic sequencing. The combined use of culture enrichment, immunomagnetic separation (IMS), and multiple displacement amplification (MDA) allows effective concentration of Salmonella genomic DNA from food and environmental samples.&#160;

음식과 환경 샘플에서 살 모 넬 라 의 준 metagenomic 분석

Quasi-metagenomics sequencing refers to the sequencing-based analysis of modified microbiomes of food and environmental samples. In this protocol, ...

2단계 미토콘드리아 분리를 사용한 향상된 단백질 정량 분석

Two-Step Tag-Free Isolation of Mitochondria for Improved Protein Discovery and Quantification

Most physiological and disease processes, from central metabolism to immune response to neurodegeneration, involve mitochondria. The mitochondrial proteome is composed of more than 1,000 proteins, and the abundance of each can vary dynamically in response to external stimuli or during disease progression. Here, we describe a protocol for isolating high-quality mitochondria from primary cells and tissues. The two-step procedure comprises (1) mechanical homogenization and differential centrifugation to isolate crude mitochondria, and (2) tag-free immune capture of mitochondria to isolate pure organelles and eliminate contaminants. Mitochondrial proteins from each purification stage are analyzed by quantitative mass spectrometry, and enrichment yields are calculated, allowing the discovery of novel mitochondrial proteins by subtractive proteomics. Our protocol provides a sensitive and comprehensive approach to studying mitochondrial content in cell lines, primary cells, and tissues.

저자 스포트라이트: 단백질 발견 및 정량화 개선을 위한 미토콘드리아의 Two-Step Tag-Free Isolation  

We present a two-step protocol for high-quality mitochondria isolation that is compatible with protein discovery and quantification at a proteome scale. Our protocol does not require genetic engineering and is thus suitable for studying mitochondria from any primary cells and tissues.