우리는 그들의 조언과 의견을 자신의 지원과 Geula 다비도프, 노암 Grimberg와 첸 박사 Guttman에 대한 아미르 Aharoni을 인정합니다.

1. E.에 엄마가 진의 복제와 표현 대장균 5&#39; - GCATTACGCATATGGACGACATCCGCCAGGTG - 3 &#39;와 5&#39; - GCGCGGCAGCCATA - TGGCATACG - 3&#39;돌연변이 유전자 mamAΔ41는 primers와 Magnetospirillum magneticum AMB - 1의 게놈 DNA의 중합 효소의 연쇄 반응 (PCR)을 사용하여 증폭되었습니다. 증폭된 DNA 조각에서 NcoI 사이트는 개시 코돈 ATG에서 도입하고 종료 코돈은 ScoI 사이트로 교체되었습니다. 조각은 NcoI와 SacI와 소화하고 pET52b (+)의 각 사이트에 복제, pET52bMamAΔ41 - AMB1에 상승을 제공했다. 이 구조에서 mamAΔ41 유전자는 C - 말단에있는 10 그 태그로 프레임에 융합되었다. 플라스미드는 대장균 E. 스트레인 BL21에 electroporated되었습니다. E. 대장균은 pET52bMamAΔ41을 품고 BL21가 (15) 자동 유도에서 3 시간 동안 암피실린 (50 MG / ML) 310 ° K를 포함하는 매체를 성장했다 변형. 재배 온도는 310 °에서 다음 300 ° K로 이동 300 ° K.시 추가 48 H에 대한 유지되었다 세포는 277에서 10 분 ° K. 대한 5,465그램에서 원심 분리에 의해 수확했다 8리터 문화가 젖어 세포 펠렛 60 그램 생산. 2. 생물 정보학 계산 ProtParam 서버 (http://www.expasy.ch/tools/protparam.html)를 사용하여 분자량 (MW), 아미노산 순서에 따라와 280nm에서 단백질의 1mg/1ml의 예측 흡수의 계산. 10His 태그 - MamAΔ41에 대한 MW는 22529 다 (240 아미노산)이며 MamAΔ41 (트롬빈에 의해 그의 태그 제거 후 남은 9 아미노산 포함)에 대한 MW가 20596.5Da (187 아미노산)입니다. 10His 태그 - MamAΔ41에 대한 280nm에서 단백질의 1mg/1ml의 예측 흡수는 0.595이고 0.579 MamAΔ41위한 것입니다. 또한, 아미노산 서열은 시스테인 잔류물을 포함하지 않습니다. 따라서, 감소 대리인은 정화 과정 필요는 없습니다. 3. MamAΔ41의 정제 <ol><li> 재고 솔루션 준비, 밖으로 무게 다음과 같은 농도에서 (200 ML 각) 준비 : 이미다졸 (MW 228.2 g / 몰) 4M 솔루션, NaCl (MW 58.44 g / 몰) 5M 솔루션 트리스 - HCL (MW 121.3 g / 몰 ) 1M 솔루션은 산도 = 8을 조정합니다. 솔루션 분명히 때까지 소용돌이를 사용하여 두 증류수 (DDW)과 혼합을 추가합니다. 0.22μm 필터 및 실온에서 보관과 필터 솔루션을 제공합니다. </li><li> 준비 및 재고 솔루션 (Table1)로부터 6 신선한 버퍼를 필터링합니다. </li><li> 희석 및 버퍼 1시 2분 비율, 세포의 g는 버퍼로 볼륨 (ML)에서 세포를 일시 중지합니다. </li><li> 샘플의 DNA 조각을 깰하기 위해 DNase I (1 MG / ML)의 박테리아의 각 10gr에 대한 10μl를 추가합니다. EDTA (에틸렌 다이아 민 테트라 초산) 무료 프로 테아제 억제제 칵테일의 박테리아의 각 20gr을위한 1ml를 추가합니다. 얼음 20 분 알을 품다. </li><li> 25,000 PSI 프랑스어 언론의 두 사이클에 의해 세포를 중단. sonication 달리, 프랑스 언론은 얇은 구멍을 통해 높은 압력 하에서 세포를 강제하여 대량 (&gt; 10ml) 세포 압출 것을 목표로하고 있습니다. 피스톤은 온도 상승으로 인해 그 사용 및 조립하기 전에 십분 얼음에 냉각해야합니다. </li><li> 25ml 초원 심 분리기 튜브에 lysed 세포를 전송 및 샘플은 튜브의 목 라인에 도달할 때까지 버퍼와 (50mg) 정확하게 그 균형을. </li><li> 277에서 1 시간 동안 27만g에서 울트라 원심 분리하여 별도의 세포 부스러기 ° K. </li><li> 컬럼에 20 % 에탄올에 보존 아르 니켈 NTA 수지, 4 ML을 추가하여 만든 중력 니켈 NTA 칼럼 (2.5cm 직경)를 준비합니다. 완전히 액체 포기 후 DDW 40 ML로 세척하고 완전히 유체 포기. 버퍼 A. 40 ML과 열의 사전 equilibrated 수지 </li><li> 중력 니켈 NTA 칼럼에서 울트라 원심 분리 튜브에서 용해 분수를 적용합니다. -을 통해 흐름을 수집 (언바운드 단백질)와 277K에서 보존, 액체 포기. </li><li> 펠렛을 스크랩하기 위해 작은 팁을 사용하여 울트라 원심 분리 튜브에서 펠렛 샘플을 수집합니다. 50μl 5 % 2X의 β - 메르 캅 토 에탄올 SDS - PAGE 샘플 버퍼에 제보를 섞는다. </li><li> -을 통해 흐름을 수집하고 277K에서 보존, 유체 포기 100 ML 버퍼 B.있는 컬럼을 씻으십시오. </li><li> 15 표시 eppendorf 튜브 (1.5ml)을 준비합니다. </li><li> 용리 - 가까이 열 밸브 다음 컬럼에 버퍼 C의 1ml를 로드할 수, 밸브 열고 흐름을 통해 컬렉션의 다음 3 분 알을 품다. 이 단계를 세 번 반복합니다. </li><li> Elute 정지 나머지 한 ML 버퍼 C 증가에와 밸브를 닫습니다. </li><li> 분수의 280nm에서 OD를 측정하여 단백질 피크의 위치를​​ 평가하고, OD 아직도&gt; 0.3 경우, 추가 샘플이 필요합니다. </li><li> 수집 분수의 SDS - PAGE 분석. 이러한 분석은 다음 예제와 함께 수행되어야 흐름을 통해 언바운드 단백질은 -을 통해 흐름을 씻고 Ultra - 원심 분리 펠렛 샘플. 10μl 5 % 2X SDS - PAGE 샘플 버퍼의 β - 메르 캅 토 에탄올 각 샘플에서 10μl를 섞습니다. 15% SDS - PAGE에 샘플을로드 180 볼트에서 45 분 동안 실행. </li><li> InstantBlue 솔루션 15 ML에 젤 스테인, 1 시간 동안 흔들. 플라스틱 상자를 커버하고 빛으로부터 보호되어 있는지 확인합니다. </li><li> 젤을 평가, 단백질 표현이 나타내는 밴드에 따라 높이와 특정 경우, 선택한 eluted 분수를 병합합니다. </li><li> 10 그분의 태그를 제거하기 위해 결합 샘플을 제조 업체의 추천에 따라, 소 트롬빈 (10 대 / μl), 1 MG 단백질 당 10μl 트롬빈를 추가합니다. </li><li> 투석은 초과 이미다졸 제거를 위해 사용되며 이온 교환 바인딩을하는 동안 필요한 수준에 NaCl 농도를 감소합니다. 투석을위한 7 KD 분자량의 원하는 길이를 잘라 (MWCO) 투석 튜브를 잘라. DDW로 씻어 한 끝 (또는 클립 인감)에서 매듭을합니다. 상단의 일부 공간을 떠나있는 동안 가방에 병합된 단백질 솔루션을 전송 최대 클램프. </li><li> 4 리터 냉장 투석 버퍼에 잠수함 투석 튜브 (버퍼 D). 277에서 천천히 밤을 통해 솔루션을 저어 ° K. </li><li> , 비커의 투석 튜브 출력을 가지고 작은 상처를 만들고 50ml 튜브에 단백질을 전송하기만하면됩니다. </li><li> 이온 교환 크로마 토그래피 : 빠른 성능 액체 크로마 토그래피 (FPLC)에 사전 포장 MonoQ 4.6/100 PE 열을 조립. DDW 여과 물 5 열 볼륨 (CV)로 컬럼을 씻으십시오. 버퍼 D. 5 CV와 Equilibrated 열 </li><li> DDW (두 루프 볼륨)와 사출 루프를 세척하고 주사 루프의 단백질을로드 버퍼 D.과 반복합니다. </li><li> 단백질 샘플을 (1 ML / 분 유량) 주사와 한정되지 않은 단백질의 SDS - PAGE 감지 분수를 수집 시작합니다. </li><li> 초기 단백질 볼륨 (3.23 단계)는 사출 루프보다 큰 경우에는 전체 표본이 칼럼에로드되기 전까지는, 루프를 세척하지 않고 단계 3.25-3.26를 반복합니다. </li><li> 억제할 수없는 단백질을 제거하기 위해 버퍼 C 3 CV와 컬럼을 씻으십시오. </li><li> 높은 흐름 속도가 비용에 사용될 수 있지만 버퍼 D &amp; E (100 % 버퍼 E는 그라디언트의 마지막 때), 유량 1 ML / 분 (사이 40 2000mM NaCl의 60 분 선형 그라디언트로 단백질을 Elute 큰 볼륨하지만, 덜 집중, 단백질 봉우리). 그들은 280nm 크로마토 그램에서 나타나는 단백질의 봉우리를 수집합니다. </li><li> 클린 사전 포장 열을 추천을 제조했다. </li><li> 수집 분수의 SDS - PAGE 분석. 이러한 분석은 다음 예제와 함께 수행되어야 억제할 수없는 단백질 흐름 통해 단백질 봉우리 흐름을 통해. SDS - PAGE를 실행하고 단계 3.17-3.18에 대한 언급으로 얼룩. </li><li> 단백질 미리 묻은 마커에 따라 예측된 MW에서 단백질 밴드 존재 젤을 평가해보십시오. 관련 단백질을 포함 선택 용출 분수를 병합합니다. </li><li> 크기 배제 크로마 토그래피에 필요한 NaCl 농도를 낮게하기 위해, 병합된 샘플을 Dialyze. 로 버퍼 F. 대해 단계 3.21-3.23에 언급된 투석을 수행 </li><li> 사용 Vivaspin - 15 10,000 MWCO 8 테이블 원심 분리기, 4000 RPM의 MG / ML.을 단백질 샘플을 집중 쿼츠 쿠베트에서 280nm에서 OD를 측정하여 원하는 농도를 확인합니다. 단백질이 너무 집중되면 버퍼 F로 희석하고 다시 측정합니다. </li><li> 크기 제외 미리 포장 열, FPLC에 HiLoad 60분의 26 Superdex 200, 조립, DDW 필터링 물 3 CV로 컬럼을 씻어. 버퍼 F. 3 CV와 Equilibrated 열 </li><li> 주사 루프의 단백질 시료에 대한 4 개 이상 ML을 로드할 수 없습니다 버퍼 F.와 동일한 볼륨에 의해 다음 5ml DDW (두 루프 볼륨)과 주사 루프를 씻으십시오. </li><li> 단백질 샘플을 (3.5 ML / 분 유량) 주사하고 그들이 280nm 크로마토 그램 나타나는 단백질 피크 분수를 수집 시작합니다. 그것이 열 볼륨에 도달할 때까지 버퍼 흐름을 보자. </li><li> 초기 단백질 볼륨 (3.23 단계)는 사출 루프보다 큰 경우에는 전체 표본이 칼럼에로드되기 전까지는, 루프를 세척하지 않고 단계 3.25-3.26를 반복합니다. </li><li> 제조 추천에 따라 청소 미리 포장 열. </li><li> 수집 분수의 SDS - PAGE 분석. 이러한 분석은 단백질 봉우리 샘플로 수행하여야한다. SDS - PAGE를 실행하고 단계 3.17-3.18에 대한 언급으로 얼룩. </li><li> 젤 평가 : 단백질 봉우리 특정하는 경우, 정확한 예측 MW에있는 단백질 미리 스테인드 마커와 한 밴드에 따라 관련 단백질의 eluted 분수를 선택 병합 볼 수 있습니다. </li><li> &gt; 20 테이블 원심 분리기에 MG / ML, 4000 RPM에 Vivaspin - 15 10,000 MWCO를 사용하여 단백질 샘플을 집중. 280nm에서 OD를 측정하여 원하는 농도를 확인합니다. 정화 MamAΔ41 그러면 26.5 결정화에 대한 MG / ML에 집중했다. </li> &lt;리튬&gt; 매트릭스를 이용한 레이저 탈착 / 이온화 (든 - TOF)를 사용하여 샘​​플 순도 및 단백질 식별을 확인합니다. </li><li> 각각 25 - 50μl 단백질, 단백질은 질량 분석기와 SDS - PAGE에 따라 투석을하는 경우, 사전 표시된 eppendorf 튜브에 집중 MamAΔ41를 나눕니다. </li><li> 플래시 193 ° K.에 액체 질소와 저장소에 냉동 </li></ol> 4. 대표 결과 이 프로토콜이 올바르게 완료되면 하나는 높은 정화, 크기 동질적인 농축 단백질 샘플을해야합니다. 이러한 단백질 샘플 결정화 실험을 위해뿐만 아니라 효소 반응 속도론, 구속력 친화력 등의 생화학 연구, 그리고 준비가되어 있습니다. 정화 프로토콜의 주요 단계의 대표적인 결과입니다 여기에 설명되어 있습니다. 니켈 - NTA 친화 칼럼의 용출 프로필 SDS - PAGE 분석 ~ 22kDa (그림 1)의 적절한 MW의 용해 분율로 표현 단백질 이상의 높은 공개한다. 흐름을 통해 한정되지 않은 단백질에 단백질이 통한 흐름과 울트라 원심 분리 펠렛 샘플 세척하면이 SDS - PAGE 분석도 최소를 공개해야합니다. 적절한 단백질 큰 대역이 샘플에 나타나지 않는 경우도 잘못된 버퍼 준비, 세포 파괴 또는 문화 자동 유도 조건과 성장의 문제에 문제를 고려해야합니다. 이온 교환 크로마 토그래피는 니켈 수지 (정전기 상호 작용이나 히스티딘 / 부정적인 아미노산 풍부한 단백질 루프에 의한)과 포경 그의 - 태그 바람직한 단백질에 묶인 채로 다른 E.coli의 단백질 위해 바람직한 단백질 간의 분리하기 위해 preformed입니다. 이 열은 증가 NaCl 농도에서 긍정적으로 충전 수지 자신의 바인딩 선호도에 따라 단백질을 분리합니다. 높은 부정 청구 단백질에 부정 청구 것들을 검토할 appose 높은 NaCl 농도에 elute 것입니다. 이 칼럼의 장점은 높은 흐름 속도와 바인딩 용량입니다. 이온 교환 크로마토 그램 (그림 2) 증가 NaCl 농도 3 단백질의 집단 사이 좋은 분리를 보여준다. SDS - PAGE 분석이 더욱 정화 단계가 필요한지 여부를 바람직한 하나 평가를 분리, 각 인구의 MW를 결정하기 위해 필요합니다. 두 번째 인구가 소 트롬빈에 의해 죽습 세 번째 인구가 낮은 농도로 인해 SDS - PAGE에서 탐지되지 않습니다되었습니다 MamAΔ41 + 그의 태그 (~ 22kDa) 동안 첫 번째 인구는 MamAΔ41 (~ 20 KDA)입니다. 단백질의 봉우리가 명확히 분리되지 않으면 하나는 잘못된 버퍼 준비를 고려하거나 NaCl 기울기의 기울기를 변경해야합니다. 크기 제외 크로마 토그래피는 니켈 - NTA 수지에 묶인 채로 및 이온 교환 크로마 토그래피 동안 분리되지 않은 다른 E.coli 세포 단백질 위해 바람직한 단백질 간의 분리하기 위해 preformed입니다. 이 항목은 자신의 크기에 따라 단백질을 분리합니다. 대형 단백질 큰 볼륨으로 eluted 것입니다 작은 반대 작은 용출 권 elute 것입니다. 칼럼 크로마토 그램 (그림 3)은 하나의 주 인구로 바람직한 단백질의 좋은 분리를 보여준다. 인구는 ~ 20 KDA의 MW로 적절한 단량체 크기 elute 나타납니다. ~ 80 KDA 밴드 (NI - NTA 수지를 바인딩 E.coli 전형적인 단백질)의 존재는 열 로딩하기 전에 SDS - PAGE에서 발견이 실행되는 동안 사라지게됩니다. 이 ~ 80 KDA 단백질의 농도가 시작하는 낮은 것이므로, 그 인구는 희석 및 SDS - PAGE 분석은 정화 효율을 결정하기 위해 필요에 의한 크로마토 그램에 나타나지 않습니다. 우리는 하나 반드시 해당 MW의 순수한 단백질의 존재를 확인할 수 있도록 SDS - PAGE로 주봉의 희석 및 농축 샘플을 로딩하는 것이 좋습니다. 이 단계에 의해 단백질이 정화이며 균질성이 든 - TOF에 의해 평가해야합니다. 이 분석은 10,176 다 (그림 4)에서 20,347 MW 다 다른의 MW의 단백질을 공개했다. ~ 10 KDA 단백질은 ~ 20 KDA 단백질이 부과 두 배가됩니다. 그의 태그 제거 후 남은 9 아미노산과 MamAΔ41의 예측 MW는 20596.5 다되었습니다. 얻은 든 - TOF MW에 비교하여 우리는 그들이 떨어져 248 다 것으로 나타났습니다. 이 차이가 든 - TOF 측정 오류 및 / 또는 첫 번째 메티오닌의 일반적인 저하와 두 번째 글리신으로 인해에서 발생할 수 있습니다. 결론을 위해서는 단백질이 높은 정화하고 추가 실험에 사용할 수 있습니다. <img src="/files/ftp_upload/1844/1844table.jpg" alt="표 1" /> 표 1. 버퍼 공법. <img src="/files/ftp_upload/1844/1844fig1.jpg" alt="그림 1" /> 그림 1. 니켈 - NTA 칼럼 정화의 대표 SDS - PAGE 분석 오른쪽에서 왼쪽으로,. P 울트라 원심 분리기 펠릿 (3.11 프로토콜 단계), W - 씻어 (3.12 프로토콜 단계), U - 억제할 수없는 단백질 (3.10 프로토콜 단계), E - 용출 샘프 다섯 차선레 (3.14 프로토콜 단계), M - 단백질 마커 (숫자 MW를 나타냅니다.) 화살표 MamAΔ41을 나타냅니다. <img src="/files/ftp_upload/1844/1844fig2.jpg" alt="그림 2" /> 그림 2. 이온 교환 크로마 토그래피 단계 (A) 이온 교환 (MonoQ 열) 크로마토 그램의 분석, 블루 - 수집 분수의 표시 - 흡수 280nm, 단백질 농도, 그린 - NaCl 농도, 레드를 나타냅니다. 이온 교환 정화 단계 (B) 대표 SDS - PAGE 분석. 왼쪽에서 오른쪽으로, M - 단백질 마커 (숫자 MW를 나타냅니다), A6 - 첫번째 피크 분율, A8 초 피크 ​​분수. <img src="/files/ftp_upload/1844/1844fig3.jpg" alt="그림 3" /> 그림 3. 크기 배제 크로마 토그래피 분석 (A) 크기 배제 (Superdex 200 열) 크로마토 그램, 블루 - 흡수 280nm, 단백질 농도, 수집 분수의 빨간 표시를 나타냅니다. 크기 제외 정화 단계 (B) 대표 SDS - PAGE 분석. 왼쪽에서 오른쪽으로, M - 단백질 마커 (숫자 MW를 나타냅니다), PreI - 사전 주입 샘플, 첫 번째 정상에서 수집한 A4 - 6 결합 분율, A4 - 6D - 희석 분율은 정상에서 수집했습니다. <img src="/files/ftp_upload/1844/1844fig4.jpg" alt="그림 4" /> 그림 4. 매트릭스 - 보조 레이저 탈착 / 이온화 (든 - TOF) 정화 MamAΔ41의 질량 스펙트럼. 매트릭스 Sinapic 산성 (SA)입니다. MamAΔ41도 같이 20,347 다에 나타난 것은 다 10176에 MamAΔ41의 두 배로 부과 수종입니다.

<ol>
	<li>Faivre, D., Schuler, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Magnetotactic+Bacteria+and+Magnetosomes.">Magnetotactic Bacteria and Magnetosomes.</a> Chem Rev. 108, 4875-4898 (2008).</li><li>D'Andrea, L. D., Regan, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TPR+proteins:+the+versatile+helix.">TPR proteins: the versatile helix.</a> Trends Biochem Sci. 28, 655-662 (2003).</li><li>Young, J. C., Barral, J. M., Hartl, U. l. r. i. c. h., F, . <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=More+than+folding:+localized+functions+of+cytosolic+chaperones.">More than folding: localized functions of cytosolic chaperones.</a> Trends Biochem Sci. 28, 541-547 (2003).</li><li>Brocard, C., Hartig, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peroxisome+targeting+signal+1:+is+it+really+a+simple+tripeptide?.">Peroxisome targeting signal 1: is it really a simple tripeptide?.</a> Biochim Biophys Acta. 1763, 1565-1573 (2006).</li><li>Fransen, M., Amery, L., Hartig, A., Brees, C., Rabijns, A., Mannaerts, G. P., Van Veldhoven, P. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+the+PTS1-+and+Rab8b-binding+properties+of+Pex5p+and+Pex5Rp/TRIP8b.">Comparison of the PTS1- and Rab8b-binding properties of Pex5p and Pex5Rp/TRIP8b.</a> Biochim Biophys Acta. 1783, 864-873 (2008).</li><li>Baker, M. J., Frazier, A. E., Gulbis, J. M., Ryan, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+protein-import+machinery:+correlating+structure+with+function.">Mitochondrial protein-import machinery: correlating structure with function.</a> Trends Cell Biol. 17, 456-464 (2007).</li><li>Mirus, O., Bionda, T., von Haeseler, A., Schleiff, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionarily+evolved+discriminators+in+the+3-TPR+domain+of+the+Toc64+family+involved+in+protein+translocation+at+the+outer+membrane+of+chloroplasts+and+mitochondria.">Evolutionarily evolved discriminators in the 3-TPR domain of the Toc64 family involved in protein translocation at the outer membrane of chloroplasts and mitochondria.</a> J Mol Model. 15, 971-982 (2009).</li><li>Gatsos, X., Perry, A. J., Anwari, K., Dolezal, P., Wolynec, P. P., Likic, V. A., Purcell, A. W., Buchanan, S. K., Lithgow, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+secretion+and+outer+membrane+assembly+in+Alphaproteobacteria.">Protein secretion and outer membrane assembly in Alphaproteobacteria.</a> FEMS Microbiol Rev. 32, 995-1009 (2008).</li><li>Tiwari, D., Singh, R. K., Goswami, K., Verma, S. K., Prakash, B., Nandicoori, V. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Key+residues+in+Mycobacterium+tuberculosis+protein+kinase+G+play+a+role+in+regulating+kinase+activity+and+survival+in+the+host.">Key residues in Mycobacterium tuberculosis protein kinase G play a role in regulating kinase activity and survival in the host.</a> J Biol Chem. 284, 27467-27479 (2009).</li><li>Edqvist, P. J., Broms, J. E., Betts, H. J., Forsberg, A., Pallen, M. J., Francis, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tetratricopeptide+repeats+in+the+type+III+secretion+chaperone,+LcrH:+their+role+in+substrate+binding+and+secretion.">Tetratricopeptide repeats in the type III secretion chaperone, LcrH: their role in substrate binding and secretion.</a> Mol Microbiol. 59, 31-44 (2006).</li><li>Grunberg, K., Muller, E. C., Otto, A., Reszka, R., Linder, D., Kube, M., Reinhardt, R., Schuler, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+and+proteomic+analysis+of+the+magnetosome+membrane+in+Magnetospirillum+gryphiswaldense.">Biochemical and proteomic analysis of the magnetosome membrane in Magnetospirillum gryphiswaldense.</a> Appl Environ Microbiol. 70, 1040-1050 (2004).</li><li>Komeili, A., Vali, H., Beveridge, T. J., Newman, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Magnetosome+vesicles+are+present+before+magnetite+formation,+and+MamA+is+required+for+their+activation.">Magnetosome vesicles are present before magnetite formation, and MamA is required for their activation.</a> Proc Natl Acad Sci USA. 101, 3839-3843 (2004).</li><li>Okuda, Y., Fukumori, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+and+characterization+of+a+magnetosome-associated+protein,+TPR-containing+MAM22,+in+Escherichia+coli.">Expression and characterization of a magnetosome-associated protein, TPR-containing MAM22, in Escherichia coli.</a> FEBS Lett. 491, 169-173 (2001).</li><li>Taoka, A., Asada, R., Sasaki, H., Anzawa, K., Wu, L. F., Fukumori, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+localizations+of+Mam22+and+Mam12+in+the+magnetosomes+of+Magnetospirillum+magnetotacticum.">Spatial localizations of Mam22 and Mam12 in the magnetosomes of Magnetospirillum magnetotacticum.</a> J Bacteriol. 188, 3805-3812 (2006).</li><li>Studier, F. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+by+auto-induction+in+high+density+shaking+cultures.">Protein production by auto-induction in high density shaking cultures.</a> Protein Expression and Purification. 41, 207-234 (2005).</li></ol>

단백질 정제는 생화학 단백질이나 구조 연구의 주요 단계입니다. 각각의 단백질 자체 동작과 독특한 있기 때문에 하나의 속성을 정의하고 이에 따라 그 정화를 수정해야합니다. 단백질 대상은 생물 정보학 도구를 사용하여 정화위한 첫 단계로 분석을해야합니다. 그들은 대상 ISO - 전기 지점을 계산 환경 및 특수 이온 / 리간드에 대한 필요성을 감소 / 산화에 대한 필요성을 평가하는 데 사용됩니?...

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">	
		
		<div>
		<table border="1">
		<thead>
		<tr>
		<th>Material Name</th>
		<th>Type</th>
		<th>Company</th>
		<th>Catalogue Number</th>
		<th>Comment</th>
		</tr>
		</thead>
		<tbody>
		
<tr>
<td>French Press</td>
<td>Equipment</td>
<td>Thermo scientific</td>
<td>FA-078A</td>
<td>&nbsp;</td>
<tr>
<td>Pressure cell</td>
<td>Equipment</td>
<td>Thermo scientific</td>
<td>FA-032</td>
<td>&nbsp;</td>
<tr>
<td>Ultra-centrifuge</td>
<td>Equipment</td>
<td>Sorvall</td>
<td>Discovery 90SE</td>
<td>&nbsp;</td>
<tr>
<td>Rottor</td>
<td>Equipment</td>
<td>Beckman</td>
<td>Ti60</td>
<td>&nbsp;</td>
<tr>
<td>Ultra-centrifuge tubes; PC-Bottle+Cap Assay 26.3ml</td>
<td>Equipment</td>
<td>Beckman</td>
<td>BC-355618</td>
<td>&nbsp;</td>
<tr>
<td>2.5cm diameter, Glass Econo-Column Chromatography Columns</td>
<td>Equipment</td>
<td>BioRad</td>
<td>737-2521</td>
<td>&nbsp;</td>
<tr>
<td>Ni-NTA His Bind resin</td>
<td>Equipment</td>
<td>Novagen</td>
<td>M0063428</td>
<td>&nbsp;</td>
<tr>
<td>Spectrophotometer</td>
<td>Equipment</td>
<td>Amersham Biosiences</td>
<td>Ultraspec 2100 pro</td>
<td>&nbsp;</td>
<tr>
<td>Quartz cuvette</td>
<td>Equipment</td>
<td>Hellma</td>
<td>104-QS</td>
<td>&nbsp;</td>
<tr>
<td>Fast Performance Liquid Chromatography- AKTA purifier 10</td>
<td>Equipment</td>
<td>GE Healthcare Biosciences</td>
<td>28-4062-64</td>
<td>&nbsp;</td>
<tr>
<td>Ion exchange column &#x2013; MonoQ 4.6/100 PE</td>
<td>Equipment</td>
<td>GE Healthcare Biosciences</td>
<td>10025543</td>
<td>&nbsp;</td>
<tr>
<td>Size exclusion pre-packed column-HiLoad 26/60 Superdex 200</td>
<td>Equipment</td>
<td>GE Healthcare Biosciences</td>
<td>17-1071-01</td>
<td>&nbsp;</td>
<tr>
<td>Centricon - Vivaspin15 &#x2013; 10,000 MWCO</td>
<td>Equipment</td>
<td>Sartorius Stedim Biotech GmbH</td>
<td>VS1501</td>
<td>&nbsp;</td>
<tr>
<td>Table centrifuge</td>
<td>Equipment</td>
<td>Thermo scientific</td>
<td>IEC CL30R</td>
<td>&nbsp;</td>
<tr>
<td>MALDI-TOF</td>
<td>Equipment</td>
<td>Bruker Daltonics</td>
<td>Reflex IV</td>
<td>&nbsp;</td>
<tr>
<td>Tris-HCl (hydrotymethyl) aminomethane</td>
<td>Reagent</td>
<td>BioLab</td>
<td>20092391</td>
<td>&nbsp;</td>
<tr>
<td>Sodium Chloride</td>
<td>Reagent</td>
<td>FRUTROM</td>
<td>235553470</td>
<td>&nbsp;</td>
<tr>
<td>Imidazole</td>
<td>Reagent</td>
<td>Alfa Aesar</td>
<td>288-32-4</td>
<td>&nbsp;</td>
<tr>
<td>EDTA free protease inhibitors cocktail</td>
<td>Reagent</td>
<td>Sigma</td>
<td>P-8849</td>
<td>&nbsp;</td>
<tr>
<td>Dnase I (Deoxyribonuclease I)</td>
<td>Reagent</td>
<td>Sigma</td>
<td>DN-25</td>
<td>&nbsp;</td>
<tr>
<td>Bovine Thrombin</td>
<td>Reagent</td>
<td>Fisher BioReagents</td>
<td>BP25432</td>
<td>&nbsp;</td>
<tr>
<td>Glycine</td>
<td>Reagent</td>
<td>BioLab</td>
<td>07132391</td>
<td>&nbsp;</td>
<tr>
<td>Soudim Dodecyl Sulfate (SDS)</td>
<td>Reagent</td>
<td>BioLab</td>
<td>19822391</td>
<td>&nbsp;</td>
<tr>
<td>Beta-mercaptoethanol</td>
<td>Reagent</td>
<td>Sigma</td>
<td>M-3148</td>
<td>&nbsp;</td>
<tr>
<td>InstantBlue</td>
<td>Reagent</td>
<td>Expedeon</td>
<td>1SB01L</td>
<td>&nbsp;</td>
<tr>
<td>PageRuler Prestained Protein Ladder</td>
<td>Reagent</td>
<td>Fermentas</td>
<td>SM0671</td>
<td>&nbsp;</td>		</tbody>
		</table>
		</div>

purification of the m. magneticum strain amb-1 magnetosome associated protein mama&delta;41

Magnetotactic 박테리아는 지자기의 필드 함께 스스로를 동쪽을 향하게 수 있습니다 수생 미생물의 다양한 그룹을 구성. 이 문제는 적합한 환경에서 검색을 돕기 위해 생각됩니다<em&gt; (1)</em&gt;. 이 기능은 magnetosome에 의해 수여됩니다 지질의 선형 체인 어셈블리로 구성되어 subcellular organelle은 자철광 또는 greigite의 ~ 50 나노미터 크리스탈 biomineralize하고 묶으에 각 수 vesicles. 기능 vesicles의 형성에 필요한 것으로 표시되었다 magnetosome의 주요 구성 요소가 마마입니다. 엄마가 가장 특징 magnetosome - 관련 단백질 중 하나입니다 매우 풍부한 magnetosome - 관련 단백질입니다<em&gt; 생체내에</em&gt;<em&gt; (2-6)</em&gt;. 이 문서는, 엄마의 정화에 초점을 맞추고있는 연구 임에도 불구하고<em&gt; 생체내에</em&gt; 더 명확한 기능이나 구조 자세한 사항은 그것을 발견되지 않았습니다. 생물 정보학 분석 엄마가 단백질을 포함하는 테트라 - tricopeptide 반복 (TPR)입니다 것을 제안했습니다. TPR은 단백질의 다양한 큰 접어 이러한이나 성형 일환으로 발견 구조적 모티프이며, 그것은 단백질 - 단백질 상호 작용과 mediates 다중 단백질 단지에 대한 템플릿 역할<em&gt; (7)</em&gt;. TPRs는 진핵 세포 organelle 프로세스와 많은 세균 경로에 많은 중요한 작업에 참여<em&gt; (8-14).</em엄마 이해하기&gt; 위해서는 단백질을 포함하는 독특한 TPR은 매우 정제된 단백질은 첫 단계로 필요합니다. 이 문서에서는, 우리는에서 안정적인 엄마를 삭제 돌연변이 (MamAΔ41)에 대한 정화 프로토콜을 제시<em&gt; M. magneticum</em&gt; AMB - 1.

Watch this Scientific Journal Video about Purification of the M. magneticum Strain AMB-1 Magnetosome Associated Protein MamAÎ”41 at JoVE.com

Purification of the &lt;em&gt;M. magneticum&lt;/em&gt; Strain AMB-1 Magnetosome Associated Protein MamA&amp;Delta;41

엄마가 magnetosome 활성화에 참여하는 표시되었습니다 독특한 Magnetosome 관련된 단백질이다. 여기에서 엄마가 삭제 돌연변이의 정화 프로토콜 (MamAΔ41)을 제시<em&gt; M. magneticum</em&gt; AMB - 1.

의 정화 M. magneticum 스트레인 AMB - 1 Magnetosome 관련 단백질 MamAΔ41

Magnetotactic bacteria comprise a diverse group of aquatic microorganisms that are able to orientate themselves along geomagnetic fields. This behavior is ...

purification-m-magneticum-strain-amb-1-magnetosome-associated-protein

Research

JoVE Journal

Biology

Purification of the M. magneticum Strain AMB-1 Magnetosome Associated Protein MamA&Delta;41

13.4K 조회수.  Ben-Gurion University. 엄마가 magnetosome 활성화에 참여하는 표시되었습니다 독특한 Magnetosome 관련된 단백질이다. 여기에서 엄마가 삭제 돌연변이의 정화 프로토콜 (MamAΔ41)을 제시 M. magneticum AMB - 1.

비디오: Purification of the M. magneticum Strain AMB-1 Magnetosome Associated Protein MamA&Delta;41

Staining of Proteins in Gels with Coomassie G-250 without Organic Solvent and Acetic Acid

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents (Methanol, Ethanol or 2-Propanol) and acetic acid are used for fixation, staining and destaining of proteins in a gel after SDS-PAGE. To speed up the procedure, heating the staining solution in the microwave oven for a short time is frequently used. This usually results in evaporation of toxic or hazardous Methanol, Ethanol or 2-Propanol and a strong smell of acetic acid in the lab which should be avoided due to safety considerations. In a protocol originally published in two patent applications by E.M. Wondrak (US2001046709 (A1), US6319720 (B1)), an alternative composition of the staining solution is described in which no organic solvent or acid is used. The CBB is dissolved in bidistilled water (60-80mg of CBB G-250 per liter) and 35 mM HCl is added as the only other compound in the staining solution. The CBB staning of the gel is done after SDS-PAGE and thorough washing of the gel in bidistilled water. By heating the gel during the washing and staining steps, the process can be finished faster and no toxic or hazardous compunds are evaporating. The staining of proteins occurs already within 1 minute after heating the gel in staining solution and is fully developed after 15-30 min with a slightly blue background that is destained completely by prolonged washing of the stained gel in bidistilled water, without affecting the stained protein bands.

A short protocol for protein staining with Coomassie Brilliant Blue (CBB) G-250 in polyacrylamide gels is described without using organic solvents or acetic acid as in the classical staining procedures with CBB.

유기 용매 및 초산없이 쿠매시 G - 250로 젤의 단백질 염색법

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents ...

연구

생물학

Using the GELFREE 8100 Fractionation System for Molecular Weight-Based Fractionation with Liquid Phase Recovery

The GELFREE 8100 Fractionation System is a novel protein fractionation system designed to maximize protein recovery during molecular weight based fractionation. The system is comprised of single-use, 8-sample capacity cartridges and a benchtop GELFREE Fractionation Instrument. During separation, a constant voltage is applied between the anode and cathode reservoirs, and each protein mixture is electrophoretically driven from a loading chamber into a specially designed gel column gel. Proteins are concentrated into a tight band in a stacking gel, and separated based on their respective electrophoretic mobilities in a resolving gel. As proteins elute from the column, they are trapped and concentrated in liquid phase in the collection chamber, free of the gel. The instrument is then paused at specific time intervals, and fractions are collected using a pipette. This process is repeated until all desired fractions have been collected. If fewer than 8 samples are run on a cartridge, any unused chambers can be used in subsequent separations.
This novel technology facilitates the quick and simple separation of up to 8 complex protein mixtures simultaneously, and offers several advantages when compared to previously available fractionation methods. This system is capable of fractionating up to 1mg of total protein per channel, for a total of 8mg per cartridge. Intact proteins over a broad mass range are separated on the basis of molecular weight, retaining important physiochemical properties of the analyte. The liquid phase entrapment provides for high recovery while eliminating the need for band or spot cutting, making the fractionation process highly reproducible1.

The accompanying video describes the use of the GELFREE 8100 Fractionation System, which partitions complex protein samples on the basis of molecular weight and recovers the fractions in liquid phase. The video describes how the technology works, how it is used, and provides resultant data, with polyacrylamide gel electrophoresis analysis of fractionated bovine liver homogenate.

액상 복구와 분자량 기반 분류에 대한 GELFREE 8100 분획화 시스템을 사용하여

The GELFREE 8100 Fractionation System is a novel protein fractionation system designed to maximize protein recovery during molecular weight based ...

Expression, Detergent Solubilization, and Purification of a Membrane Transporter, the MexB Multidrug Resistance Protein

Multidrug resistance (MDR), the ability of a cancer cell or pathogen to be resistant to a wide range of structurally and functionally unrelated anti-cancer drugs or antibiotics, is a current serious problem in public health. This multidrug resistance is largely due to energy-dependent drug efflux pumps. The pumps expel anti-cancer drugs or antibiotics into the external medium, lowering their intracellular concentration below a toxic threshold. We are studying multidrug resistance in Pseudomonas aeruginosa, an opportunistic bacterial pathogen that causes infections in patients with many types of injuries or illness, for example, burns or cystic fibrosis, and also in immuno-compromised cancer, dialysis, and transplantation patients. The major MDR efflux pumps in P. aeruginosa are tripartite complexes comprised of an inner membrane proton-drug antiporter (RND), an outer membrane channel (OMF), and a periplasmic linker protein (MFP) 1-8. The RND and OMF proteins are transmembrane proteins. Transmembrane proteins make up more than 30% of all proteins and are 65% of current drug targets. The hydrophobic transmembrane domains make the proteins insoluble in aqueous buffer. Before a transmembrane protein can be purified, it is necessary to find buffer conditions containing a mild detergent that enable the protein to be solubilized as a protein detergent complex (PDC) 9-11. In this example, we use an RND protein, the P. aeruginosa MexB transmembrane transporter, to demonstrate how to express a recombinant form of a transmembrane protein, solubilize it using detergents, and then purify the protein detergent complexes. This general method can be applied to the expression, purification, and solubilization of many other recombinantly expressed membrane proteins. The protein detergent complexes can later be used for biochemical or biophysical characterization including X-ray crystal structure determination or crosslinking studies.

In this protocol we demonstrate the expression, solubilization, and purification of a recombinantly expressed membrane protein, MexB, as a soluble protein detergent complex. MexB is a multidrug resistance membrane transporter from the opportunistic bacterial pathogen Pseudomonas aeruginosa.

표현, 세제 Solubilization 및 멤브레인 전송, MexB의 Multidrug 저항 단백질의 정제

Multidrug resistance (MDR), the ability of a cancer cell or pathogen to be resistant to a wide range of structurally and functionally unrelated ...

Automated Hydrophobic Interaction Chromatography Column Selection for Use in Protein Purification

In contrast to other chromatographic methods for purifying proteins (e.g. gel filtration, affinity, and ion exchange), hydrophobic interaction chromatography (HIC) commonly requires experimental determination (referred to as screening or "scouting") in order to select the most suitable chromatographic medium for purifying a given protein 1. The method presented here describes an automated approach to scouting for an optimal HIC media to be used in protein purification.
HIC separates proteins and other biomolecules from a crude lysate based on differences in hydrophobicity. Similar to affinity chromatography (AC) and ion exchange chromatography (IEX), HIC is capable of concentrating the protein of interest as it progresses through the chromatographic process. Proteins best suited for purification by HIC include those with hydrophobic surface regions and able to withstand exposure to salt concentrations in excess of 2 M ammonium sulfate ((NH4)2SO4). HIC is often chosen as a purification method for proteins lacking an affinity tag, and thus unsuitable for AC, and when IEX fails to provide adequate purification. Hydrophobic moieties on the protein surface temporarily bind to a nonpolar ligand coupled to an inert, immobile matrix. The interaction between protein and ligand are highly dependent on the salt concentration of the buffer flowing through the chromatography column, with high ionic concentrations strengthening the protein-ligand interaction and making the protein immobile (i.e. bound inside the column) 2. As salt concentrations decrease, the protein-ligand interaction dissipates, the protein again becomes mobile and elutes from the column. Several HIC media are commercially available in pre-packed columns, each containing one of several hydrophobic ligands (e.g. S-butyl, butyl, octyl, and phenyl) cross-linked at varying densities to agarose beads of a specific diameter 3. Automated column scouting allows for an efficient approach for determining which HIC media should be employed for future, more exhaustive optimization experiments and protein purification runs 4.
The specific protein being purified here is recombinant green fluorescent protein (GFP); however, the approach may be adapted for purifying other proteins with one or more hydrophobic surface regions. GFP serves as a useful model protein, due to its stability, unique light absorbance peak at 397 nm, and fluorescence when exposed to UV light 5. Bacterial lysate containing wild type GFP was prepared in a high-salt buffer, loaded into a Bio-Rad DuoFlow medium pressure liquid chromatography system, and adsorbed to HiTrap HIC columns containing different HIC media. The protein was eluted from the columns and analyzed by in-line and post-run detection methods. Buffer blending, dynamic sample loop injection, sequential column selection, multi-wavelength analysis, and split fraction eluate collection increased the functionality of the system and reproducibility of the experimental approach.

An automated method for identifying suitable hydrophobic interaction chromatography (HIC) media to be used in the process of protein purification is presented. The method utilizes a medium-pressure liquid chromatography system including automated buffer blending, dynamic sample loop injection, sequential column selection, multi-wavelength analysis, and split fraction eluate collection.

단백질 정제에서 사용하기 위해 자동화된 소수성 상호 작용 크로마 토그래피 칼럼 선정

In contrast to other chromatographic methods for purifying proteins (e.g. gel filtration, affinity, and ion exchange), hydrophobic interaction ...

Purification of Hsp104, a Protein Disaggregase

Hsp104 is a hexameric AAA+ protein1 from yeast, which couples ATP hydrolysis to protein disaggregation2-10 (Fig. 1). This activity imparts two key selective advantages. First, renaturation of disordered aggregates by Hsp104 empowers yeast survival after various protein-misfolding stresses, including heat shock3,5,11,12. Second, remodeling of cross-beta amyloid fibrils by Hsp104 enables yeast to exploit myriad prions (infectious amyloids) as a reservoir of beneficial and heritable phenotypic variation13-22. Remarkably, Hsp104 directly remodels preamyloid oligomers and amyloid fibrils, including those comprised of the yeast prion proteins Sup35 and Ure223-30. This amyloid-remodeling functionality is a specialized facet of yeast Hsp104. The E. coli orthologue, ClpB, fails to remodel preamyloid oligomers or amyloid fibrils26,31,32.
Hsp104 orthologues are found in all kingdoms of life except, perplexingly, animals. Indeed, whether animal cells possess any enzymatic system that couples protein disaggregation to renaturation (rather than degradation) remains unknown33-35. Thus, we and others have proposed that Hsp104 might be developed as a therapeutic agent for various neurodegenerative diseases connected with the misfolding of specific proteins into toxic preamyloid oligomers and amyloid fibrils4,7,23,36-38. There are no treatments that directly target the aggregated species associated with these diseases. Yet, Hsp104 dissolves toxic oligomers and amyloid fibrils composed of alpha-synuclein, which are connected with Parkinson's Disease23 as well as amyloid forms of PrP39. Importantly, Hsp104 reduces protein aggregation and ameliorates neurodegeneration in rodent models of Parkinson's Disease23 and Huntington's disease38. Ideally, to optimize therapy and minimize side effects, Hsp104 would be engineered and potentiated to selectively remodel specific aggregates central to the disease in question4,7. However, the limited structural and mechanistic understanding of how Hsp104 disaggregates such a diverse repertoire of aggregated structures and unrelated proteins frustrates these endeavors30,40-42.
To understand the structure and mechanism of Hsp104, it is essential to study the pure protein and reconstitute its disaggregase activity with minimal components. Hsp104 is a 102kDa protein with a pI of ~5.3, which hexamerizes in the presence of ADP or ATP, or at high protein concentrations in the absence of nucleotide43-46. Here, we describe an optimized protocol for the purification of highly active, stable Hsp104 from E. coli. The use of E. coli allows simplified large-scale production and our method can be performed quickly and reliably for numerous Hsp104 variants. Our protocol increases Hsp104 purity and simplifies His6-tag removal compared to a previous purification method from E. coli47. Moreover, our protocol is more facile and convenient than two more recent protocols26,48.

Here, we describe a protocol for the purification of highly active Hsp104, a hexameric AAA+ protein from yeast, which couples ATP hydrolysis to protein disaggregation. This scheme exploits a His6-tagged construct for affinity purification from E. coli followed by anion-exchange chromatography, His6-tag removal with TEV protease, and size-exclusion chromatography.

Hsp104의 정화, 단백질 Disaggregase

Hsp104 is a hexameric AAA+ protein1 from yeast, which couples ATP hydrolysis to protein disaggregation2-10 (Fig. 1). This activity imparts two key ...

Identification of Protein Interacting Partners Using Tandem Affinity Purification

A critical and often limiting step in understanding the function of host and viral proteins is the identification of interacting cellular or viral protein partners. There are many approaches that allow the identification of interacting partners, including the yeast two hybrid system, as well as pull down assays using recombinant proteins and immunoprecipitation of endogenous proteins followed by mass spectrometry identification1. Recent studies have highlighted the utility of double-affinity tag mediated purification, coupled with two specific elution steps in the identification of interacting proteins. This approach, termed Tandem Affinity Purification (TAP), was initially used in yeast2,3 but more recently has been adapted to use in mammalian cells4-8.
As proof-of-concept we have established a tandem affinity purification (TAP) method using the well-characterized eukaryotic translation initiation factor eIF4E9,10.The cellular translation factor eIF4E is a critical component of the cellular eIF4F complex involved in cap-dependent translation initiation10. The TAP tag used in the current study is composed of two Protein G units and a streptavidin binding peptide separated by a Tobacco Etch Virus (TEV) protease cleavage sequence. The TAP tag used in the current study is composed of two Protein G units and a streptavidin binding peptide separated by a Tobacco Etch Virus (TEV) protease cleavage sequence8. To forgo the need for the generation of clonal cell lines, we developed a rapid system that relies on the expression of the TAP-tagged bait protein from an episomally maintained plasmid based on pMEP4 (Invitrogen). Expression of tagged murine eIF4E from this plasmid was controlled using the cadmium chloride inducible metallothionein promoter.
Lysis of the expressing cells and subsequent affinity purification via binding to rabbit IgG agarose, TEV protease cleavage, binding to streptavidin linked agarose and subsequent biotin elution identified numerous proteins apparently specific to the eIF4E pull-down (when compared to control cell lines expressing the TAP tag alone). The identities of the proteins were obtained by excision of the bands from 1D SDS-PAGE and subsequent tandem mass spectrometry. The identified components included the known eIF4E binding proteins eIF4G and 4EBP-1. In addition, other components of the eIF4F complex, of which eIF4E is a component were identified, namely eIF4A and Poly-A binding protein. The ability to identify not only known direct binding partners as well as secondary interacting proteins, further highlights the utility of this approach in the characterization of proteins of unknown function.

Tandem affinity purification is a robust approach for the identification of protein binding partners. As proof of concept, this methodology was applied to the well-characterized translation initiation factor eIF4E to co-precipitate the host cell factors involved in translation initiation. This method is easily adapted to any cellular or viral protein.

탠덤 동질 정제를 사용하여 단백질 나누기 파트너의 식별

A critical and often limiting step in understanding the function of host and viral proteins is the identification of interacting cellular or viral protein ...

Expression and Purification of the Cystic Fibrosis Transmembrane Conductance Regulator Protein in Saccharomyces cerevisiae

The cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel, that when mutated, can give rise to cystic fibrosis in humans.There is therefore considerable interest in this protein, but efforts to study its structure and activity have been hampered by the difficulty of expressing and purifying sufficient amounts of the protein1-3. Like many 'difficult' eukaryotic membrane proteins, expression in a fast-growing organism is desirable, but challenging, and in the yeast S. cerevisiae, so far low amounts were obtained and rapid degradation of the recombinant protein was observed 4-9. Proteins involved in the processing of recombinant CFTR in yeast have been described6-9 .In this report we describe a methodology for expression of CFTR in yeast and its purification in significant amounts. The protocol describes how the earlier proteolysis problems can be overcome and how expression levels of CFTR can be greatly improved by modifying the cell growth conditions and by controlling the induction conditions, in particular the time period prior to cell harvesting. The reagants associated with this protocol (murine CFTR-expressing yeast cells or yeast plasmids) will be distributed via the US Cystic Fibrosis Foundation, which has sponsored the research. An article describing the design and synthesis of the CFTR construct employed in this report will be published separately (Urbatsch, I.; Thibodeau, P. et al., unpublished). In this article we will explain our method beginning with the transformation of the yeast cells with the CFTR construct - containing yeast plasmid (Fig. 1). The construct has a green fluorescent protein (GFP) sequence fused to CFTR at its C-terminus and follows the system developed by Drew et al. (2008)10. The GFP allows the expression and purification of CFTR to be followed relatively easily. The JoVE visualized protocol finishes after the preparation of microsomes from the yeast cells, although we include some suggestions for purification of the protein from the microsomes. Readers may wish to add their own modifications to the microsome purification procedure, dependent on the final experiments to be carried out with the protein and the local equipment available to them. The yeast-expressed CFTR protein can be partially purified using metal ion affinity chromatography, using an intrinsic polyhistidine purification tag. Subsequent size-exclusion chromatography yields a protein that appears to be &gt;90% pure, as judged by SDS-PAGE and Coomassie-staining of the gel.

Expression and Purification of the Cystic Fibrosis Transmembrane Conductance Regulator Protein in Saccharomyces cerevisiae

Attempts to express the cystic fibrosis transmembrane conductance regulator (CFTR) in Saccharomyces cerevisiae have, until now, yielded relatively low amounts of protein. This protocol and the associated reagents distributed via the Cystic Fibrosis Foundation should allow the preparation of milligram amounts of this 'difficult' eukaryotic membrane protein.

의 낭성 섬유증의 Transmembrane의 전도성 조절 단백질의 표현과 정제 Saccharomyces cerevisiae

The  cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride  channel, that when mutated, can give rise to cystic fibrosis in  ...

Budding Yeast Protein Extraction and Purification for the Study of Function, Interactions, and Post-translational Modifications

Homogenization by bead beating is a fast and efficient way to release DNA, RNA, proteins, and metabolites from budding yeast cells, which are notoriously hard to disrupt. Here we describe the use of a bead mill homogenizer for the extraction of proteins into buffers optimized to maintain the functions, interactions and post-translational modifications of proteins. Logarithmically growing cells expressing the protein of interest are grown in a liquid growth media of choice. The growth media may be supplemented with reagents to induce protein expression from inducible promoters (e.g. galactose), synchronize cell cycle stage (e.g. nocodazole), or inhibit proteasome function (e.g. MG132). Cells are then pelleted and resuspended in a suitable buffer containing protease and/or phosphatase inhibitors and are either processed immediately or frozen in liquid nitrogen for later use. Homogenization is accomplished by six cycles of 20 sec&#160;bead-beating (5.5 m/sec), each followed by one minute incubation on ice. The resulting homogenate is cleared by centrifugation and small particulates can be removed by filtration. The resulting cleared whole cell extract (WCE) is precipitated using 20% TCA for direct analysis of total proteins by SDS-PAGE followed by Western blotting. Extracts are also suitable for affinity purification of specific proteins, the detection of post-translational modifications, or the analysis of co-purifying proteins. As is the case for most protein purification protocols, some enzymes and proteins may require unique conditions or buffer compositions for their purification and others may be unstable or insoluble under the conditions stated. In the latter case, the protocol presented may provide a useful starting point to empirically determine the best bead-beating strategy for protein extraction and purification. We show the extraction and purification of an epitope-tagged SUMO E3 ligase, Siz1, a cell cycle regulated protein that becomes both sumoylated and phosphorylated, as well as a SUMO-targeted ubiquitin ligase subunit, Slx5.

The preparation of high quality yeast cell extracts is a necessary first step in the analysis of individual proteins or entire proteomes. Here we describe a fast, efficient, and reliable homogenization protocol for budding yeast cells that has been optimized to preserve protein functions, interactions, and post-translational modifications.

함수의 연구, 상호 작용, 그리고 번역 후 수정을위한 신진 효모 단백질 추출 및 정제

Homogenization by bead beating is a fast and efficient way to release DNA, RNA, proteins, and metabolites from budding yeast cells, which are notoriously ...

Identification of Post-translational Modifications of Plant Protein Complexes

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to infection via the recruitment and activation of immune complexes. Activation of immune complexes is associated with post-translational modifications (PTMs) of proteins, such as phosphorylation, glycosylation, or ubiquitination. Understanding how these PTMs are choreographed will lead to a better understanding of how resistance is achieved.
Here we describe a protein purification method for nucleotide-binding leucine-rich repeat (NB-LRR)-interacting proteins and the subsequent identification of their post-translational modifications (PTMs). With small modifications, the protocol can be applied for the purification of other plant protein complexes. The method is based on the expression of an epitope-tagged version of the protein of interest, which is subsequently partially purified by immunoprecipitation and subjected to mass spectrometry for identification of interacting proteins and PTMs.
This protocol demonstrates that: i). Dynamic changes in PTMs such as phosphorylation can be detected by mass spectrometry; ii). It is important to have sufficient quantities of the protein of interest, and this can compensate for the lack of purity of the immunoprecipitate; iii). In order to detect PTMs of a protein of interest, this protein has to be immunoprecipitated to get a sufficient quantity of protein.

We describe here a protocol for the purification and characterization of plant protein complexes. We demonstrate that by immunoprecipitating a single protein within a complex, so we can identify its post-translational modifications and its interacting partners.

식물 단백질 복합체의 번역 후 변형의 확인

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to ...

Purification of the Cystic Fibrosis Transmembrane Conductance Regulator Protein Expressed in Saccharomyces cerevisiae

Defects in the cystic fibrosis transmembrane conductance regulator (CFTR) protein cause cystic fibrosis (CF), an autosomal recessive disease that currently limits the average life expectancy of sufferers to &#60;40 years of age. The development of novel drug molecules to restore the activity of CFTR is an important goal in the treatment CF, and the isolation of functionally active CFTR is a useful step towards achieving this goal.
We describe two methods for the purification of CFTR from a eukaryotic heterologous expression system, S. cerevisiae. Like prokaryotic systems, S. cerevisiae can be rapidly grown in the lab at low cost, but can also traffic and posttranslationally modify large membrane proteins. The selection of detergents for solubilization and purification is a critical step in the purification of any membrane protein. Having screened for the solubility of CFTR in several detergents, we have chosen two contrasting detergents for use in the purification that allow the final CFTR preparation to be tailored to the subsequently planned experiments.
In this method, we provide comparison of the purification of CFTR in dodecyl-&#946;-D-maltoside (DDM) and 1-tetradecanoyl-sn-glycero-3-phospho-(1&#39;-rac-glycerol) (LPG-14). Protein purified in DDM by this method shows ATPase activity in functional assays. Protein purified in LPG-14 shows high purity and yield, can be employed to study post-translational modifications, and can be used for structural methods such as small-angle X-ray scattering and electron microscopy. However it displays significantly lower ATPase activity.

Purification of the Cystic Fibrosis Transmembrane Conductance Regulator Protein Expressed in Saccharomyces cerevisiae

Heterologous expression and purification of the cystic fibrosis transmembrane conductance regulator (CFTR) are significant challenges and limiting factors in the development of drug therapies for cystic fibrosis. This protocol describes two methods for the isolation of milligram quantities of CFTR suitable for functional and structural studies.&#160;