Name: identification of protein complexes in escherichia coli using sequential peptide affinity purification in combination with tandem mass spectrometry
Uploaded: 2012-11-12T13:00:00
Description: Watch this Scientific Journal Video about Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry at JoVE.co

This work was supported by funds from the Canadian Foundation for Innovation, Genome Canada, the Ontario Genomics Institute, the Ontario Ministry of Innovation, and the Canadian Institutes of Health Research grant to J.G. and A.E. The Red-expressing E. coli strain DY330 was a kind gift from Donald L. Court (National Cancer Institute, Frederick, MD).

1. Construction of Gene-specific SPA-tagging in E. coli DY330 Strain
<ol>
 <li>The plasmid pJL148 encompassing the SPA-tag DNA sequence and the kanamycin antibiotic resistance marker cassette (KanR) are used as a template in polymerase chain reaction (PCR) amplification7. A 45 nt gene-specific forward primer, located immediately upstream of the target gene stop codon in frame with a 27 bp (5'- AGCTGGAGGATCCATGGAAAAGAGAAG -3') tag specific forward primer, and a 45 nt gene-specific reverse ...

<ol>
	<li>Butland, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interaction+network+containing+conserved+and+essential+protein+complexes+in+Escherichia+coli.">Interaction network containing conserved and essential protein complexes in Escherichia coli.</a> Nature. 433, 531-537 (2005).</li><li>Hu, P., Janga, S. C., Babu, M., Diaz-Mejia, J. J., Butland, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+functional+atlas+of+Escherichia+coli+encompassing+previously+uncharacterized+proteins.">Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins.</a> PLoS Biol. 7, e1000096 (2009).</li><li>Krogan, N. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+landscape+of+protein+complexes+in+the+yeast+Saccharomyces+cerevisiae.">Global landscape of protein complexes in the yeast Saccharomyces cerevisiae.</a> Nature. 440, 637-643 (2006).</li><li>Mak, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+lentiviral+functional+proteomics+approach+identifies+chromatin+remodeling+complexes+important+for+the+induction+of+pluripotency.">A lentiviral functional proteomics approach identifies chromatin remodeling complexes important for the induction of pluripotency.</a> Mol. Cell Proteomics. 9, 811-823 (2010).</li><li>Polanowska, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tandem+immunoaffinity+purification+of+protein+complexes+from+Caenorhabditis+elegans.">Tandem immunoaffinity purification of protein complexes from Caenorhabditis elegans.</a> Biotechniques. 36, 778-782 (2004).</li><li>Veraksa, A., Bauer, A., Artavanis-Tsakonas, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analyzing+protein+complexes+in+Drosophila+with+tandem+affinity+purification-mass+spectrometry.">Analyzing protein complexes in Drosophila with tandem affinity purification-mass spectrometry.</a> Dev. Dyn. 232, 827-834 (2005).</li><li>Zeghouf, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+Peptide+Affinity+(SPA)+system+for+the+identification+of+mammalian+and+bacterial+protein+complexes.">Sequential Peptide Affinity (SPA) system for the identification of mammalian and bacterial protein complexes.</a> J. Proteome Res. 3, 463-468 (2004).</li><li>Puig, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+tandem+affinity+purification+(TAP)+method:+a+general+procedure+of+protein+complex+purification.">The tandem affinity purification (TAP) method: a general procedure of protein complex purification.</a> Methods. 24, 218-229 (2001).</li><li>Rigaut, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+generic+protein+purification+method+for+protein+complex+characterization+and+proteome+exploration.">A generic protein purification method for protein complex characterization and proteome exploration.</a> Nat. Biotechnol. 17, 1030-1032 (1999).</li><li>Yu, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+recombination+system+for+chromosome+engineering+in+Escherichia+coli.">An efficient recombination system for chromosome engineering in Escherichia coli.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 5978-5983 (2000).</li><li>Kislinger, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PRISM,+a+generic+large+scale+proteomic+investigation+strategy+for+mammals.">PRISM, a generic large scale proteomic investigation strategy for mammals.</a> Mol. Cell Proteomics. 2, 96-106 (2003).</li><li>Vlasblom, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GenePro:+a+Cytoscape+plug-in+for+advanced+visualization+and+analysis+of+interaction+networks.">GenePro: a Cytoscape plug-in for advanced visualization and analysis of interaction networks.</a> Bioinformatics. 22, 2178-219 (2006).</li><li>de Berardinis, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complete+collection+of+single-gene+deletion+mutants+of+Acinetobacter+baylyi+ADP1.">A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.</a> Mol. Syst. Biol. 4, 174 (2008).</li><li>Babu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+peptide+affinity+purification+system+for+the+systematic+isolation+and+identification+of+protein+complexes+from+Escherichia+coli.">Sequential peptide affinity purification system for the systematic isolation and identification of protein complexes from Escherichia coli.</a> Methods Mol. Biol. 564, 373-400 (2009).</li></ol>

A key aspect of the SPA-based APMS approach described here is that tagging is performed within the natural chromosomal context, thereby ensuring normal gene regulation is maintained (i.e. native bait promoter preserved, hence expression levels is not perturbed) and native stably-associated protein complexes are recovered at near-endogenous levels. Operon polarity issues are also avoided by including an outwardly oriented promoter in the selectable marker. This SPA-tagging approach is effective enough to purify t...

<table border="1">
	<tbody>
		<tr>
			<td>Materials</td>
			<td>Vendor</td>
			<td>and Catalog Numbers</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>I. Antibiotics</td>
		</tr>
		<tr>
			<td>Kanamycin</td>
			<td>Bioshop</td>
			<td>#KAN201</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Bioshop</td>
			<td>#AMP201</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>2. Terrific-Broth medium</td>
		</tr>
		<tr>
			<td>Bio-Tryptone</td>
			<td>Bioshop</td>
			<td>#TRP 402</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Yeast extract</td>
			<td>Bioshop</td>
			<td>#YEX 555</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Bioshop</td>
			<td>#GLY 002</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>K2HPO4</td>
			<td>Bioshop</td>
			<td>#PPM 302</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>KH2PO4</td>
			<td>Bioshop</td>
			<td>#PPM 303</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>3. Bacterial Strain and Plasmid</td>
		</tr>
		<tr>
			<td>DY330</td>
			<td>&nbsp;</td>
			<td>Yu et al. (2000)10</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>pJL148</td>
			<td>&nbsp;</td>
			<td>Zeghouf et al. (2004)7</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>4. PCR and Electrophoresis Reagents</td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>10 X PCR buffer</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>10 mM dNTPs</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>25 mM MgCl2</td>
			<td>Fermentas</td>
			<td># EP0281</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Bioshop</td>
			<td># AGA002</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Loading dye</td>
			<td>NEB</td>
			<td>#B7021S</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Bioshop</td>
			<td># ETB444</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>10X TBE buffer</td>
			<td>Thermo Scientific</td>
			<td>#28355</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Tris Base</td>
			<td>Bioshop</td>
			<td>#TRS001</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Boric acid</td>
			<td>Bioshop</td>
			<td>#BOR001</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>0.5 M EDTA (pH 8.0)</td>
			<td>Sigma</td>
			<td># E6768</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>DNA ladder</td>
			<td>NEB</td>
			<td>#N3232L</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>5. Plasmid isolation and Clean-up Kits</td>
		</tr>
		<tr>
			<td>Plasmid Midi kit</td>
			<td>Qiagen</td>
			<td>#12143</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>QIAquick PCR purification kit</td>
			<td>Qiagen</td>
			<td>#28104</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>6. PCR and Transformation Equipments</td>
		</tr>
		<tr>
			<td>Thermal cycler</td>
			<td>BioRad</td>
			<td>iCycler</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Agarose gel electrophoresis</td>
			<td>BioRad</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Electroporator</td>
			<td>Bio-Rad</td>
			<td>GenePulser II</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>0.2 cm electroporation cuvette</td>
			<td>Bio-Rad</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>42 &deg;C water bath shaker</td>
			<td>&nbsp;</td>
			<td>Innova 3100</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Beckman Coulter TJ-25 centrifuge</td>
			<td>Beckman Coulter</td>
			<td>TS-5.1-500</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>32 &deg;C Shaker</td>
			<td>New Brunswick Scientific, USA</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>32 &deg;C large Shaker</td>
			<td>New Brunswick Scientific, USA</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>32 &deg;C plate incubator</td>
			<td>Fisher Scientific</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>7. Electrophoresis and Western blotting</td>
		</tr>
		<tr>
			<td>Acrylamide monomer, N,N'- methylenebis-acrylamide</td>
			<td>Bio-Rad</td>
			<td>#161-0125</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Ammonium persulfate</td>
			<td>Bioshop</td>
			<td># AMP001</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>n-butanol</td>
			<td>Sigma</td>
			<td># B7906</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>TEMED</td>
			<td>Bioshop</td>
			<td>#TEM001</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Whatman No. 1 filter paper</td>
			<td>Fischer Scientific</td>
			<td>#09-806A</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Mini protean 3 cell</td>
			<td>Bio-Rad</td>
			<td>#165-3301</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>iBlot gel transfer device</td>
			<td>Invitrogen</td>
			<td>#IB1001</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Nitrocellulose membranes</td>
			<td>Bio-Rad</td>
			<td>#162-0115</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Monoclonal Anti-Flag M2 antibody</td>
			<td>Sigma</td>
			<td>#F3165</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Horseradish peroxidase</td>
			<td>Amersham</td>
			<td>#NA931V</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Pre-stained protein molecular weight standards</td>
			<td>Bio-Rad</td>
			<td>#161-0363</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Chemiluminescence reagent</td>
			<td>PIERCE</td>
			<td>#1856136</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Autoradiography film</td>
			<td>Clonex Corp</td>
			<td>#CLEC810</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Quick Draw blotting paper</td>
			<td>Sigma</td>
			<td>#P7796</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>C2 platform rocking shaker</td>
			<td>New Brunswick Scientific, USA</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>8. Sonication Equipment and Reagents</td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Branson Ultrasonic</td>
			<td>#23395</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Bioshop</td>
			<td>#SOD001</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Protease inhibitors</td>
			<td>Roche</td>
			<td>#800-363-5887</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>0.5 mM TCEP-HCl</td>
			<td>Thermo Scientific</td>
			<td>#20490</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>9. Affinity Purification Reagents and Equipment</td>
		</tr>
		<tr>
			<td>0.8 x 4 cm Bio-Rad polypropylene column</td>
			<td>Bio-Rad</td>
			<td>#732-6008</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Benzonase nuclease</td>
			<td>Novagen</td>
			<td>#70746</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Anti-FLAG M2 agarose beads</td>
			<td>Sigma</td>
			<td>#A2220</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Calmodulin-sepharose beads</td>
			<td>GE Healthcare</td>
			<td>#17-0529-01</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>TEV protease</td>
			<td>Invitrogen</td>
			<td>#12575-015</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma</td>
			<td>#T9284</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>CaCl2</td>
			<td>Sigma</td>
			<td>#C2661</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>EGTA</td>
			<td>Sigma</td>
			<td>#E3889</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>LabQuake Shaker</td>
			<td>Thermolyne</td>
			<td>#59558</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>10. Silver Staining Reagents</td>
		</tr>
		<tr>
			<td>Methanol</td>
			<td>Bioshop</td>
			<td>#MET302</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Acetic acid</td>
			<td>Bioshop</td>
			<td>t#ACE222</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Sodium-thiosulfate</td>
			<td>Sigma</td>
			<td>#S-7143</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Silver nitrate</td>
			<td>Fischer Scientific</td>
			<td>#S181-100</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Formaldehyde</td>
			<td>Bioshop</td>
			<td>#FOR201</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Sodium carbonate</td>
			<td>Bioshop</td>
			<td>#SOC512</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>11. Reagents and Equipment for Protein Identification </td>
		</tr>
		<tr>
			<td>Trypsin Gold, Mass Spectrometry Grade</td>
			<td>Promega</td>
			<td># V5280</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>50 mM NH4HCO3</td>
			<td>Bioshop</td>
			<td>#AMC555</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>1 mM CaCl2</td>
			<td>Bioshop</td>
			<td>#CCL302</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Acetonitrile</td>
			<td>Sigma</td>
			<td>#A998-4</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Formic acid</td>
			<td>Sigma</td>
			<td>#F0507</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>HPLC grade water</td>
			<td>Sigma</td>
			<td>#95304</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Iodoacetamide</td>
			<td>Sigma</td>
			<td>#16125</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Millipore Zip-Tip</td>
			<td>Millipore</td>
			<td># ZTC18M960</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>~10 cm of 3 &mu;m Luna-C18 resin</td>
			<td>Phenomenex</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Proxeon nano HPLC pump</td>
			<td>Thermo Fisher Scientific</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>LTQ Orbitrap Velos mass spectrometer</td>
			<td>&nbsp;</td>
			<td>Thermo Fisher Scientific</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>12. Labware</td>
		</tr>
		<tr>
			<td>4 liter conical flasks</td>
			<td>VWR</td>
			<td>#89000-372</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>50 ml polypropylene falcon tubes</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>1.5 ml micro-centrifuge tubes</td>
			<td>Any Vendor</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>250 ml conical flaks</td>
			<td>VWR</td>
			<td>#29140-045</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>15 ml sterile culture tubes</td>
			<td>Thermo Scientific</td>
			<td>#366052</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Cryogenic vials</td>
			<td>VWR</td>
			<td>#479-3221</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>-80 &deg;C freezer</td>
			<td>Fisher Scientific</td>
			<td>#13-990-14</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>Speed vacuum system</td>
			<td>Thermo Scientific</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
		</tr>
		<tr>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>&nbsp;</td>
			<td>
			Buffers and Solutions
			1. 1 liter Terrific Broth (TB) media
			11 g Bio-Tryptone 
			22 g Yeast Extract 
			2% Glycerol 
			50 ml potassium salt stock solution
			2. Potassium Salt Stock Solution
			1.5 M K2HPO4 
			0.35 M KH2PO4
			3. Sonication Buffer
			20 mM Tris-HCl (pH 7.9) 
			150 mM NaCl 
			0.2 mM EDTA 
			10% Glycerol 
			Before use add protease inhibitor (PI) and 0.1-0.5 mM TCEP
			4. AFC buffer
			30 mM Tris-HCl (pH 7.9) 
			150 mM NaCl 
			0.1% detergent 
			Before use add PI and 0.1-0.5 mM TCEP
			5. TEV cleavage buffer
			30 mM Tris-HCl (pH 7.9) 
			150 mM NaCl 
			0.2 mM EDTA 
			0.1% detergent 
			Before use add PI and 0.1-0.5 mM TCEP
			6. Calmodulin binding buffer
			30 mM Tris-HCl (pH 7.9) 
			150 mM NaCl 
			2 mM CaCl2 
			0.1% detergent 
			Before use add PI and 0.1-0.5 mM TCEP
			7. Calmodulin wash buffer
			30 mM Tris-HCl pH 7.9 
			150 mM NaCl 
			2 mM CaCl2 
			0.1-0.5 mM TCEP
			8. Calmodulin elution buffer
			30 mM Tris-HCl (pH 7.9) 
			100 mM NaCl 
			10 mM EGTA 
			0.1-0.5 mM TCEP
			9. Developing solution (1L)
			37% Formaldehyde 
			30 g sodium carbonate 
			1000 ml distilled water
			10. Digestion buffer
			50 mM NH4HCO3 
			1 mM CaCl2
			11. Wetting and Equilibration solution
			70% acetonitrile (ACN) in 0.1% formic acid
			12. Washing solution
			100% H2O in 0.1% formic acid</td>
		</tr>
	</tbody>
</table>

identification of protein complexes in escherichia coli using sequential peptide affinity purification in combination with tandem mass spectrometry

Since most cellular processes are mediated by macromolecular assemblies, the systematic identification of protein-protein interactions (PPI) and the identification of the subunit composition of multi-protein complexes can provide insight into gene function and enhance understanding of biological systems1, 2. Physical interactions can be mapped with high confidence vialarge-scale isolation and characterization of endogenous protein complexes under near-physiological conditions based on affinity purification of chromosomally-tagged proteins in combination with mass spectrometry (APMS). This approach has been successfully applied in evolutionarily diverse organisms, including yeast, flies, worms, mammalian cells, and bacteria1-6. In particular, we have generated a carboxy-terminal Sequential Peptide Affinity (SPA) dual tagging system for affinity-purifying native protein complexes from cultured gram-negative Escherichia coli, using genetically-tractable host laboratory strains that are well-suited for genome-wide investigations of the fundamental biology and conserved processes of prokaryotes1, 2, 7. Our SPA-tagging system is analogous to the tandem affinity purification method developed originally for yeast8, 9, and consists of a calmodulin binding peptide (CBP) followed by the cleavage site for the highly specific tobacco etch virus (TEV) protease and three copies of the FLAG epitope (3X FLAG), allowing for two consecutive rounds of affinity enrichment. After cassette amplification, sequence-specific linear PCR products encoding the SPA-tag and a selectable marker are integrated and expressed in frame as carboxy-terminal fusions in a DY330 background that is induced to transiently express a highly efficient heterologous bacteriophage lambda recombination system10. Subsequent dual-step purification using calmodulin and anti-FLAG affinity beads enables the highly selective and efficient recovery of even low abundance protein complexes from large-scale cultures. Tandem mass spectrometry is then used to identify the stably co-purifying proteins with high sensitivity (low nanogram detection limits).
Here, we describe detailed step-by-step procedures we commonly use for systematic protein tagging, purification and mass spectrometry-based analysis of soluble protein complexes from E. coli, which can be scaled up and potentially tailored to other bacterial species, including certain opportunistic pathogens that are amenable to recombineering. The resulting physical interactions can often reveal interesting unexpected components and connections suggesting novel mechanistic links. Integration of the PPI data with alternate molecular association data such as genetic (gene-gene) interactions and genomic-context (GC) predictions can facilitate elucidation of the global molecular organization of multi-protein complexes within biological pathways. The networks generated for E. coli can be used to gain insight into the functional architecture of orthologous gene products in other microbes for which functional annotations are currently lacking.

Once tagged bait proteins, which are expressed at endogenous levels are affinity-purified from logarithmic phase cultures the samples were run on a silver-stain gel to visualize the individual polypeptide components of the isolated stable complexes. We also subjected a second portion of the affinity-purified protein samples to gel-free tandem mass spectrometry (LCMS) to identify the corresponding polypeptide sequences. The effectiveness of this APMS procedure is shown with a representative SDS-PAGE analysis of the compon...

Watch this Scientific Journal Video about Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry at JoVE.co

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

Affinity purification of tagged proteins in combination with mass spectrometry (APMS) is a powerful method for the systematic mapping of protein interaction networks and for investigating the mechanistic basis of biological processes. Here, we describe an optimized sequential peptide affinity (SPA) APMS procedure developed for the bacterium Escherichia coli that can be used to isolate and characterize stable multi-protein complexes to near homogeneity even starting from low copy numbers per cell.

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

Since most cellular processes are mediated by macromolecular assemblies, the systematic identification of protein-protein interactions (PPI) and the ...

identification-protein-complexes-escherichia-coli-using-sequential

Research

JoVE Journal

Biology

Identification of protein complexes with quantitative proteomics in S. cerevisiae

Lipids are the building blocks of cellular membranes that function as barriers and in compartmentalization of cellular processes, and recently, as important intracellular signalling molecules. However, unlike proteins, lipids are small hydrophobic molecules that traffic primarily by poorly described nonvesicular routes, which are hypothesized to occur at membrane contact sites (MCSs). MCSs are regions where the endoplasmic reticulum (ER) makes direct physical contact with a partnering organelle, e.g., plasma membrane (PM). The ER portion of ER-PM MCSs is enriched in lipid-synthesizing enzymes, suggesting that lipid synthesis is directed to these sites and implying that MCSs are important for lipid traffic. Yeast is an ideal model to study ER-PM MCSs because of their abundance, with over 1000 contacts per cell, and their conserved nature in all eukaryotes. Uncovering the proteins that constitute MCSs is critical to understanding how lipids traffic is accomplished in cells, and how they act as signaling molecules. We have found that an ER called Scs2p localize to ER-PM MCSs and is important for their formation. We are focused on uncovering the molecular partners of Scs2p. Identification of protein complexes traditionally relies on first resolving purified protein samples by gel electrophoresis, followed by in-gel digestion of protein bands and analysis of peptides by mass spectrometry. This often limits the study to a small subset of proteins. Also, protein complexes are exposed to denaturing or non-physiological conditions during the procedure. To circumvent these problems, we have implemented a large-scale quantitative proteomics technique to extract unbiased and quantified data. We use stable isotope labeling with amino acids in cell culture (SILAC) to incorporate staple isotope nuclei in proteins in an untagged control strain. Equal volumes of tagged culture and untagged, SILAC-labeled culture are mixed together and lysed by grinding in liquid nitrogen. We then carry out an affinity purification procedure to pull down protein complexes. Finally, we precipitate the protein sample, which is ready for analysis by high-performance liquid chromatography/ tandem mass spectrometry. Most importantly, proteins in the control strain are labeled by the heavy isotope and will produce a mass/ charge shift that can be quantified against the unlabeled proteins in the bait strain. Therefore, contaminants, or unspecific binding can be easily eliminated. By using this approach, we have identified several novel proteins that localize to ER-PM MCSs. Here we present a detailed description of our approach. 

Here we describe a new quantitative proteomics technique for identifying protein complexes in Saccharomyces cerevisiae. In this study, we have used the SILAC method together with affinity purification followed by tandem mass spectrometry to identify with high specificity the binding partners of an ER protein, Scs2p.

Lipids are the building blocks of cellular membranes that function as barriers and in compartmentalization of cellular processes, and recently, as ...

Staining of Proteins in Gels with Coomassie G-250 without Organic Solvent and Acetic Acid

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents (Methanol, Ethanol or 2-Propanol) and acetic acid are used for fixation, staining and destaining of proteins in a gel after SDS-PAGE. To speed up the procedure, heating the staining solution in the microwave oven for a short time is frequently used. This usually results in evaporation of toxic or hazardous Methanol, Ethanol or 2-Propanol and a strong smell of acetic acid in the lab which should be avoided due to safety considerations. In a protocol originally published in two patent applications by E.M. Wondrak (US2001046709 (A1), US6319720 (B1)), an alternative composition of the staining solution is described in which no organic solvent or acid is used. The CBB is dissolved in bidistilled water (60-80mg of CBB G-250 per liter) and 35 mM HCl is added as the only other compound in the staining solution. The CBB staning of the gel is done after SDS-PAGE and thorough washing of the gel in bidistilled water. By heating the gel during the washing and staining steps, the process can be finished faster and no toxic or hazardous compunds are evaporating. The staining of proteins occurs already within 1 minute after heating the gel in staining solution and is fully developed after 15-30 min with a slightly blue background that is destained completely by prolonged washing of the stained gel in bidistilled water, without affecting the stained protein bands.

A short protocol for protein staining with Coomassie Brilliant Blue (CBB) G-250 in polyacrylamide gels is described without using organic solvents or acetic acid as in the classical staining procedures with CBB.

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents ...

Analyzing Large Protein Complexes by Structural Mass Spectrometry

Living cells control and regulate their biological processes through the coordinated action of a large number of proteins that assemble themselves into an array of dynamic, multi-protein complexes1. To gain a mechanistic understanding of the various cellular processes, it is crucial to determine the structure of such protein complexes, and reveal how their structural organization dictates their function. Many aspects of multi-protein complexes are, however, difficult to characterize, due to their heterogeneous nature, asymmetric structure, and dynamics. Therefore, new approaches are required for the study of the tertiary levels of protein organization.
One of the emerging structural biology tools for analyzing macromolecular complexes is mass spectrometry (MS)2-5. This method yields information on the complex protein composition, subunit stoichiometry, and structural topology. The power of MS derives from its high sensitivity and, as a consequence, low sample requirement, which enables examination of protein complexes expressed at endogenous levels. Another advantage is the speed of analysis, which allows monitoring of reactions in real time. Moreover, the technique can simultaneously measure the characteristics of separate populations co-existing in a mixture. 
Here, we describe a detailed protocol for the application of structural MS to the analysis of large protein assemblies. The procedure begins with the preparation of gold-coated capillaries for nanoflow electrospray ionization (nESI). It then continues with sample preparation, emphasizing the buffer conditions which should be compatible with nESI on the one hand, and enable to maintain complexes intact on the other. We then explain, step-by-step, how to optimize the experimental conditions for high mass measurements and acquire MS and tandem MS spectra. Finally, we chart the data processing and analyses that follow. Rather than attempting to characterize every aspect of protein assemblies, this protocol introduces basic MS procedures, enabling the performance of MS and MS/MS experiments on non-covalent complexes. Overall, our goal is to provide researchers unacquainted with the field of structural MS, with knowledge of the principal experimental tools.

Mass spectrometry has proven to be a valuable tool for analyzing large protein complexes. This method enables insights into the composition, stoichiometry and overall architecture of multi-subunit assemblies. Here, we describe, step-by-step, how to perform a structural mass spectrometry analysis, and characterize macromolecular structures.

Living cells control and regulate their biological processes through the coordinated action of a large number of proteins that assemble themselves into an ...

Quantification of Proteins Using Peptide Immunoaffinity Enrichment Coupled with Mass Spectrometry

There is a great need for quantitative assays in measuring proteins. Traditional sandwich immunoassays, largely considered the gold standard in quantitation, are associated with a high cost, long lead time, and are fraught with drawbacks (e.g. heterophilic antibodies, autoantibody interference, 'hook-effect').1 An alternative technique is affinity enrichment of peptides coupled with quantitative mass spectrometry, commonly referred to as SISCAPA (Stable Isotope Standards and Capture by Anti-Peptide Antibodies).2 In this technique, affinity enrichment of peptides with stable isotope dilution and detection by selected/multiple reaction monitoring mass spectrometry (SRM/MRM-MS) provides quantitative measurement of peptides as surrogates for their respective proteins. SRM/MRM-MS is well established for accurate quantitation of small molecules 3, 4 and more recently has been adapted to measure the concentrations of proteins in plasma and cell lysates.5-7 To achieve quantitation of proteins, these larger molecules are digested to component peptides using an enzyme such as trypsin. One or more selected peptides whose sequence is unique to the target protein in that species (i.e. "proteotypic" peptides) are then enriched from the sample using anti-peptide antibodies and measured as quantitative stoichiometric surrogates for protein concentration in the sample. Hence, coupled to stable isotope dilution (SID) methods (i.e. a spiked-in stable isotope labeled peptide standard), SRM/MRM can be used to measure concentrations of proteotypic peptides as surrogates for quantification of proteins in complex biological matrices. The assays have several advantages compared to traditional immunoassays. The reagents are relatively less expensive to generate, the specificity for the analyte is excellent, the assays can be highly multiplexed, enrichment can be performed from neat plasma (no depletion required), and the technique is amenable to a wide array of proteins or modifications of interest.8-13 In this video we demonstrate the basic protocol as adapted to a magnetic bead platform.

Stable Isotope Standards and Capture by Anti-Peptide Antibodies (SISCAPA) couples affinity enrichment of peptides with stable isotope dilution mass spectrometry (MRM-MS) to provide quantitative measurement of peptides as surrogates for their respective proteins. Here we describe the protocol using magnetic particles in a partially automated format.

There is a great need for quantitative assays in measuring proteins. Traditional sandwich immunoassays, largely considered the gold standard in ...

Identification of Protein Interacting Partners Using Tandem Affinity Purification

A critical and often limiting step in understanding the function of host and viral proteins is the identification of interacting cellular or viral protein partners. There are many approaches that allow the identification of interacting partners, including the yeast two hybrid system, as well as pull down assays using recombinant proteins and immunoprecipitation of endogenous proteins followed by mass spectrometry identification1. Recent studies have highlighted the utility of double-affinity tag mediated purification, coupled with two specific elution steps in the identification of interacting proteins. This approach, termed Tandem Affinity Purification (TAP), was initially used in yeast2,3 but more recently has been adapted to use in mammalian cells4-8.
As proof-of-concept we have established a tandem affinity purification (TAP) method using the well-characterized eukaryotic translation initiation factor eIF4E9,10.The cellular translation factor eIF4E is a critical component of the cellular eIF4F complex involved in cap-dependent translation initiation10. The TAP tag used in the current study is composed of two Protein G units and a streptavidin binding peptide separated by a Tobacco Etch Virus (TEV) protease cleavage sequence. The TAP tag used in the current study is composed of two Protein G units and a streptavidin binding peptide separated by a Tobacco Etch Virus (TEV) protease cleavage sequence8. To forgo the need for the generation of clonal cell lines, we developed a rapid system that relies on the expression of the TAP-tagged bait protein from an episomally maintained plasmid based on pMEP4 (Invitrogen). Expression of tagged murine eIF4E from this plasmid was controlled using the cadmium chloride inducible metallothionein promoter.
Lysis of the expressing cells and subsequent affinity purification via binding to rabbit IgG agarose, TEV protease cleavage, binding to streptavidin linked agarose and subsequent biotin elution identified numerous proteins apparently specific to the eIF4E pull-down (when compared to control cell lines expressing the TAP tag alone). The identities of the proteins were obtained by excision of the bands from 1D SDS-PAGE and subsequent tandem mass spectrometry. The identified components included the known eIF4E binding proteins eIF4G and 4EBP-1. In addition, other components of the eIF4F complex, of which eIF4E is a component were identified, namely eIF4A and Poly-A binding protein. The ability to identify not only known direct binding partners as well as secondary interacting proteins, further highlights the utility of this approach in the characterization of proteins of unknown function.

Tandem affinity purification is a robust approach for the identification of protein binding partners. As proof of concept, this methodology was applied to the well-characterized translation initiation factor eIF4E to co-precipitate the host cell factors involved in translation initiation. This method is easily adapted to any cellular or viral protein.

A critical and often limiting step in understanding the function of host and viral proteins is the identification of interacting cellular or viral protein ...

A Protocol for the Identification of Protein-protein Interactions Based on 15N Metabolic Labeling, Immunoprecipitation, Quantitative Mass Spectrometry and Affinity Modulation

Protein-protein interactions are fundamental for many biological processes in the cell. Therefore, their characterization plays an important role in current research and a plethora of methods for their investigation is available1. Protein-protein interactions often are highly dynamic and may depend on subcellular localization, post-translational modifications and the local protein environment2. Therefore, they should be investigated in their natural environment, for which co-immunoprecipitation approaches are the method of choice3. Co-precipitated interaction partners are identified either by immunoblotting in a targeted approach, or by mass spectrometry (LC-MS/MS) in an untargeted way. The latter strategy often is adversely affected by a large number of false positive discoveries, mainly derived from the high sensitivity of modern mass spectrometers that confidently detect traces of unspecifically precipitating proteins. A recent approach to overcome this problem is based on the idea that reduced amounts of specific interaction partners will co-precipitate with a given target protein whose cellular concentration is reduced by RNAi, while the amounts of unspecifically precipitating proteins should be unaffected. This approach, termed QUICK for QUantitative Immunoprecipitation Combined with Knockdown4, employs Stable Isotope Labeling of Amino acids in Cell culture (SILAC)5 and MS to quantify the amounts of proteins immunoprecipitated from wild-type and knock-down strains. Proteins found in a 1:1 ratio can be considered as contaminants, those enriched in precipitates from the wild type as specific interaction partners of the target protein. Although innovative, QUICK bears some limitations: first, SILAC is cost-intensive and limited to organisms that ideally are auxotrophic for arginine and/or lysine. Moreover, when heavy arginine is fed, arginine-to-proline interconversion results in additional mass shifts for each proline in a peptide and slightly dilutes heavy with light arginine, which makes quantification more tedious and less accurate5,6. Second, QUICK requires that antibodies are titrated such that they do not become saturated with target protein in extracts from knock-down mutants.
Here we introduce a modified QUICK protocol which overcomes the abovementioned limitations of QUICK by replacing SILAC for 15N metabolic labeling and by replacing RNAi-mediated knock-down for affinity modulation of protein-protein interactions. We demonstrate the applicability of this protocol using the unicellular green alga Chlamydomonas reinhardtii as model organism and the chloroplast HSP70B chaperone as target protein7 (Figure 1). HSP70s are known to interact with specific co-chaperones and substrates only in the ADP state8. We exploit this property as a means to verify the specific interaction of HSP70B with its nucleotide exchange factor CGE19.

A Protocol for the Identification of Protein-protein Interactions Based on 15N Metabolic Labeling, Immunoprecipitation, Quantitative Mass Spectrometry and Affinity Modulation

We present a variation of the QUICK (QUantitative Immunoprecipitation Combined with Knockdown) approach that was introduced previously to distinguish between true and false protein-protein interactions. Our approach is based on 15N metabolic labeling, the modulation of affinities of protein-protein interactions by the presence/absence of ATP, immunoprecipitation, and quantitative mass spectrometry.

Protein-protein interactions are fundamental for many biological processes in the cell. Therefore, their characterization plays an important role in ...

Identifying Protein-protein Interaction in Drosophila Adult Heads by Tandem Affinity Purification (TAP)

Genetic screens conducted using Drosophila melanogaster (fruit fly) have made numerous milestone discoveries in the advance of biological sciences. However, the use of biochemical screens aimed at extending the knowledge gained from genetic analysis was explored only recently. Here we describe a method to purify the protein complex that associates with any protein of interest from adult fly heads. This method takes advantage of the Drosophila GAL4/UAS system to express a bait protein fused with a Tandem Affinity Purification (TAP) tag in fly neurons in vivo, and then implements two rounds of purification using a TAP procedure similar to the one originally established in yeast1 to purify the interacting protein complex. At the end of this procedure, a mixture of multiple protein complexes is obtained whose molecular identities can be determined by mass spectrometry. Validation of the candidate proteins will benefit from the resource and ease of performing loss-of-function studies in flies. Similar approaches can be applied to other fly tissues. We believe that the combination of genetic manipulations and this proteomic approach in the fly model system holds tremendous potential for tackling fundamental problems in the field of neurobiology and beyond.

Identifying Protein-protein Interaction in Drosophila Adult Heads by Tandem Affinity Purification TAP

Drosophila is famous for its powerful genetic manipulation, but not for its suitability of in-depth biochemical analysis. Here we present a TAP-based procedure to identify interacting partners of any protein of interest from the fly brain. This procedure can potentially lead to new avenues of research.

Genetic screens conducted using Drosophila melanogaster (fruit fly) have made numerous milestone discoveries in the advance of biological sciences. ...

Identification of Post-translational Modifications of Plant Protein Complexes

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to infection via the recruitment and activation of immune complexes. Activation of immune complexes is associated with post-translational modifications (PTMs) of proteins, such as phosphorylation, glycosylation, or ubiquitination. Understanding how these PTMs are choreographed will lead to a better understanding of how resistance is achieved.
Here we describe a protein purification method for nucleotide-binding leucine-rich repeat (NB-LRR)-interacting proteins and the subsequent identification of their post-translational modifications (PTMs). With small modifications, the protocol can be applied for the purification of other plant protein complexes. The method is based on the expression of an epitope-tagged version of the protein of interest, which is subsequently partially purified by immunoprecipitation and subjected to mass spectrometry for identification of interacting proteins and PTMs.
This protocol demonstrates that: i). Dynamic changes in PTMs such as phosphorylation can be detected by mass spectrometry; ii). It is important to have sufficient quantities of the protein of interest, and this can compensate for the lack of purity of the immunoprecipitate; iii). In order to detect PTMs of a protein of interest, this protein has to be immunoprecipitated to get a sufficient quantity of protein.

We describe here a protocol for the purification and characterization of plant protein complexes. We demonstrate that by immunoprecipitating a single protein within a complex, so we can identify its post-translational modifications and its interacting partners.

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to ...

Non-chromatographic Purification of Recombinant Elastin-like Polypeptides and their Fusions with Peptides and Proteins from Escherichia coli

Elastin-like polypeptides are repetitive biopolymers that exhibit a lower critical solution temperature phase transition behavior, existing as soluble unimers below a characteristic transition temperature and aggregating into micron-scale coacervates above their transition temperature. The design of elastin-like polypeptides at the genetic level permits precise control of their sequence and length, which dictates their thermal properties. Elastin-like polypeptides are used in a variety of applications including biosensing, tissue engineering, and drug delivery, where the transition temperature and biopolymer architecture of the ELP can be tuned for the specific application of interest. Furthermore, the lower critical solution temperature phase transition behavior of elastin-like polypeptides allows their purification by their thermal response, such that their selective coacervation and resolubilization allows the removal of both soluble and insoluble contaminants following expression in Escherichia coli. This approach can be used for the purification of elastin-like polypeptides alone or as a purification tool for peptide or protein fusions where recombinant peptides or proteins genetically appended to elastin-like polypeptide tags can be purified without chromatography. This protocol describes the purification of elastin-like polypeptides and their peptide or protein fusions and discusses basic characterization techniques to assess the thermal behavior of pure elastin-like polypeptide products.

Non-chromatographic Purification of Recombinant Elastin-like Polypeptides and their Fusions with Peptides and Proteins from Escherichia coli

Elastin-like polypeptides are stimulus-responsive biopolymers with applications ranging from recombinant protein purification to drug delivery. This protocol describes the purification and characterization of elastin-like polypeptides and their peptide or protein fusions from Escherichia coli using their lower critical solution temperature phase transition behavior as a simple alternative to chromatography.

Elastin-like polypeptides are repetitive biopolymers that exhibit a lower critical solution temperature phase transition behavior, existing as soluble ...

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and the inherent instability of many membrane proteins once solubilized in detergents. A protocol is described that combines ligation independent cloning of membrane proteins as GFP fusions with expression in Escherichia coli detected by GFP fluorescence. This enables the construction and expression screening of multiple membrane protein/variants to identify candidates suitable for further investment of time and effort. The GFP reporter is used in a primary screen of expression by visualizing GFP fluorescence following SDS polyacrylamide gel electrophoresis (SDS-PAGE). Membrane proteins that show both a high expression level with minimum degradation as indicated by the absence of free GFP, are selected for a secondary screen. These constructs are scaled and a total membrane fraction prepared and solubilized in four different detergents. Following ultracentrifugation to remove detergent-insoluble material, lysates are analyzed by fluorescence detection size exclusion chromatography (FSEC). Monitoring the size exclusion profile by GFP fluorescence provides information about the mono-dispersity and integrity of the membrane proteins in different detergents. Protein: detergent combinations that elute with a symmetrical peak with little or no free GFP and minimum aggregation are candidates for subsequent purification. Using the above methodology, the heterologous expression in E. coli of SED (shape, elongation, division, and sporulation) proteins from 47 different species of bacteria was analyzed. These proteins typically have ten transmembrane domains and are essential for cell division. The results show that the production of the SEDs orthologues in E. coli was highly variable with respect to the expression levels and integrity of the GFP fusion proteins. The experiment identified a subset for further investigation.

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

A streamlined approach to screening for the expression of recombinant membrane proteins in Escherichia coli based on fusion to green fluorescent protein is presented.

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and ...