이 작품은 버지니아 커먼 웰스 대학의 대통령 연구 인센티브 프로그램 (PRIP) 144602-3 (PX)에 의해, 건강 (PX)의 국립 연구소에서 보조금 R01DE018138 의해 부분적으로 지원되었다. 우리는 Drs 감사드립니다. 레이 첸, 게놈 전체 돌연변이의 건설을 지원에 Yuetan쪽으로 앉아야하고 왕을 Xiaojing. 우리는 또한 DNA 배열을 위해 버지니아 커먼 웰스 대학에서 DNA 핵심 시설 감사드립니다.

1. 프라이머 디자인 <ol><li> 프리 머은 S.에 따라 집 스크립트에서 사용 설계되어 있습니다 sanguinis SK36 게놈 시퀀스. 프리 머, F1/R1, F2/R2, 그리고 F3/R3 세 세트 대상 유전자 aphA-3 유전자 인코딩 kanamycin 저항 (km R) 단백질 (3) 및 (1)의 1 킬로바이트 상류 시퀀스의 증폭을 위해 설계되었습니다 각각 대상 유전자의-KB 하류 순서 (그림 1). 이러한 프리 머 가운데 F1 및 R3는 프로그램의 양각 스위트 룸 (에 ePrimer3를 사용하여 설계되었습니다 <a href="http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html" target="_blank">http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html</a> 대상의 상류 또는 하류 측면을 노릴 지역을 확대하려면) 유전자. 유전자 특정 프리 머, R1 및 F3는 5 &#39;와 3&#39;대상 유전자의 시퀀스에 따라 설계되었습니다. R1과 F3 프리 머의 aphA-3에 보완의 5 &#39;끝에서 25-BP 어댑터 시퀀스를 포함유전자. 각 프라이머의 녹는 온도는 가장 가까운 가능한 60 ° C 96 - 웰 형식의 모든 PCR 반응에 대한 온도를 어닐링 유니폼의 사용을 활성화 할 수 있습니다. 할 수 있도록 설계되었습니다 </li><li> F1, R1, F3 및 R3 프리 머은 유전자 순서에 따라 96 - 웰 플레이트에 합성됩니다. 각 판은 동일한 유전자 순서 프리 머의 한 종류가 포함되어 있습니다. 채널 피펫을 사용하여 PCR 증폭을위한 10 μm의 최종 농도로 96 - 웰 작동 프라이머 판에서 프리 머를 희석. </li></ol> 2. 높은 처리량 PCR 증폭 및 정화 <ol><li> 높은 처리량 증폭하려면 1 킬로바이트 상류 또는 대상 S.의 하류 sanguinis의 유전자는 1640 μl ddH 2 O, 250 μl 10xHigh 성심 PCR 버퍼, 10 MM dNTP 혼합물의 200 μl, 50 MM 100 μl MgSO 4, 100 μl를 포함하는 15 ML 원뿔 튜브에 얼음에 PCR 칵테일 혼합을 조립 10 μl / NG S. sanguinis SK36 게놈의 DNA와 10 μl 플래티넘 DNA 형성 촉매 DNA polyme새기다 고 충실도 및 전송 채널 피펫을 사용하여 96 - 웰 PCR 플레이트의 각도에 혼합물의 23 μl. 채널 피펫을 사용하여 PCR 플레이트에 프라이머 플레이트 작업 10 μM에서 각각 F1과 R1 (또는 F3와 R3) 1 μl를 전송합니다. PCR 플레이트를 밀봉하고 1.5 분 30 초 및 68 ° C에 30 초 1 분, 그리고 94 ° C의 30주기, 54 ° C에 94 ° C에서 증폭을 수행합니다. </li><li> 1퍼센트 아가로 오스 겔 48 우물 피팅 멀티 채널 피펫 로딩과 ethidium 브로마이드를 포함하는 준비. 96 - 웰 플레이트에 5xDNA 로딩 버퍼 1 μl를 갖춘 4 μl PCR 제품을 섞어서 10 μl 다 채널 피펫을 사용하여 아가로 오스 겔에서 샘플을로드합니다. 30 분에 135 V의 전기를 실행합니다. UVP 문서 및 분석 체제에서 젤에 밴드를 검사합니다. </li><li> 제조업체의 지시에 따라 원심 분리를 사용하여 PureLink 96 PCR 정화 키트하여 PCR 제품을 정화. DNA를 용출를 들어, B의 잘 40 μl 멸균 ddH 2 O를 추가 할판을 inding. </li><li> 무작위로 NanoDrop 분광 광도계를 사용하여 DNA 농도를 검사하기 위해 접시에 몇 정화 amplicons을 선택합니다. 접시에 amplicons의 농도를 조정하려면 ~ μl / 10 NG. </li><li> 플라스미드 포함 킬로미터 연구 카세트는 PCR 템플릿으로 EcoR I을 사용하여 소화하고 있습니다. 소화 플라스미드는 QIAquick PCR 정화 키트에 의해 정화되고 선형 플라스미드 DNA는 최종 DNA 농도로 10 NG / μl를 조정됩니다. SO 16.4 μl ddH 2 O, 2.5 μl 10xHigh 성심 PCR 버퍼, 10 MM dNTP 혼합물의 2 μl, 50 밀리미터 MG 1 μl를 포함 킬로미터 연구 카세트 amplicon 25 μl 혼합물을 조립 4, 10 μM F2, 1 μl 1 μl 10 μM의 R2, 1 μl 선형 플라스미드 DNA와 0.1 μl 플래티넘 DNA 형성 촉매의 DNA 중합 효소의 고 충실도. ° C 1 분 30 초 68 30 초 1 분, 그리고 94 ° C의 30주기, 55 ° C에 94 ° C에서 PCR 증폭을 수행합니다. 1퍼센트 아가로 오스의 겔 전기 영동하여 PCR 제품을 검사합니다. 푸QIAquick PCR 정화 키트로 10 개인 PCR 정화의 km R 카세트 amplicon의 라 일괄. 10 NG / μl로 amplicon 농도를 조정합니다. </li><li> 최종 선형 재조합 PCR의 amplicon을 구하려면 세 PCR의 amplicons은 잘 PCR 템플릿과 같은 하나 PCR 플레이트의 각 1 μl (거의 동등한-몰 양에서)과 결합되어 있습니다. 다른 PCR 구성 요소는 SO 14.4 μl ddH 2 O, 2.5 μl 10xHigh 성심 PCR 버퍼, 10 MM dNTP 혼합물의 2 μl, 50 밀리미터 MG 1 μl를 포함한 추가됩니다 4, 10 μM의 F1 1 μl, 10 μM R3의 1 μl, 0.1 μl 플래티넘 DNA 형성 촉매의 DNA 중합 효소의 높은 충실도를. PCR 증폭은 4 분에 3.5 분, 그리고 마지막으로 68 ° C 30 초 및 68 ° C 30 초 55 ° C에서 2 분, 94의 30주기 ° C에 94 ° C에서 수행된다. </li><li> 아가로 오스 겔에서 PCR amplicons를 검사합니다. 정화하고 위에 설명 된대로 PCR의 amplicons을 수량화. -20 ° C.에서 재결합 PCR의 amplicons를 고정 </li></ol> 3. COMpetent 셀 준비 <ol><li> 토드 휴이트 국물이 준비되어 상온으로 냉각 및 0.22 μm의 폴리스티렌 필터 4를 사용 소독 한 후 끓여야하고 가열 10 N NaOH를 사용하여 7.6로 조정 산도. TH + HS 매체를 만회하기 위해 15 ML 원뿔 튜브에 11.7 ML 토드 휴이트 국물에 300 μl 열 inactivated 말 커를 (2.5 %까지 최종 농도)를 추가합니다. 나누어지는의 TH + HS 중간이 ML 튜브 10 ML에. </li><li> 주식 S. 5 μl의 예방 sanguinis SK36 2 ML의 TH + HS 매체에 -80 ° C에서 냉동 37에 단단히 상한과 밤 문화를 길러 10 ML-TH + HS 관을 미리 잠복기와 함께 ° C,.에게 </li><li> 박 한 후, 10 ML TH + HS에 50 μl 문화를 전송하고 3 시간 (0.07-0.08의 OD 660에 해당)를 37 ° C에서 관을 길러 즉시 변환을 위해 사용합니다. </li></ol> 4. 셀 변환과 항생제 선택 <ol><li> 70 NG S. 2 μl를 추가합니다 sanguinis SK36 competence 자극 펩타이드 (CSP)과 37 번 블록 96 - 웰하고 사전에 따뜻한에서 Eppendorf 튜브 2 μl 선형 재조합 PCR amplicon (~ 50 NG) ° C. 각 튜브에 3 시간 - incubated SK36 문화의 330 μl를 전송합니다. 1 시간에 37 ° C에서 알을 품다. 제어 등의 살균 ddH 2 O와 DNA를 교체하십시오. </li><li> 얼음 블록을 놓고, 500 μg / ML의 kanamycin과 뇌 심장 주입 (BHI) 한천 플레이트의 각 변형 100 μl을 알리십시오. microaerobic 조건 하에서 2 D에 37 ° C에서 접시를 품다. </li></ol> 5. 돌연변이 확인 및 저장 <ol><li> 각 교체 돌연변이를 들어, 무작위, 2 개인 식민지을 데리러 오 ML BHI가 500 μg / ML의 kanamycin을 포함하는으로 식민지의 예방 및 37에서 microaerobically 밤 inoculum을 품어 ° C. -80에서 30 % 글리세롤에있는 각 문화를 Cryopreserve ° C </li><li> 예상 유전자 교체를 포함하는 돌연변이가 식민지 각 돌연변이 사용하는 F1에 대한 PCR 및 R3을 수행 여부를 검사하려면96 - 웰 PCR 판에서 프리 머. 개별 식민지에서 약 1 μl 밤 문화는 25 μl PCR-증폭 반응에서 DNA 템플릿으로 사용됩니다. PCR는 ° C 3.5 분, 그리고 마지막으로 68 ° C 4 분에 30 초 및 68에 30 초, 55 ° C에 5 분, 94의 35주기 ° C에 94 ° C에서 수행된다. </li><li> 정확하게 이중 대역 돌연변이 나 오염 물질 PCR의 amplicon을 확인하려면 ethidium의 브로마이드 착색과&gt; 12cm 길이 2% 아가로 오스 겔에서 4 시간에 전기 영동하여 PCR amplicon을 확인합니다. 이 아가로 오스 겔 전기 영동 조건에서 ≥ 100 BP의 차이가있는 모든 amplicons은 분명하게 식별되었습니다. km의 R 카세트의 증폭 및 야생 형 유전자에서 발생하는 밴드는 내부 T1의 프라이머는 야생 형 유전자는 PCR에 의해 검출 될 수 있는지 여부를 결정하는 데 사용됩니다 &lt;100 BP에 의해 차이가 예상하는 경우. </li><li> 추가로 삭제를 확인하려면 amplicons는 PureLink 96 PCR 정화 키트에 의해 정화되고있는 P1의 프라이머를 사용하여 순서가 아르km의 R 카세트에 바인딩합니다. 시퀀싱에 의해 확인 만 정확한 돌연변이세요. </li></ol>

<ol>
	<li>Sassetti, C. M., Boyd, D. H., Rubin, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes+required+for+mycobacterial+growth+defined+by+high+density+mutagenesis.">Genes required for mycobacterial growth defined by high density mutagenesis.</a> Mol. Microbiol. 48, 77-84 (2003).</li><li>Kobayashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+Bacillus+subtilis+genes.">Essential Bacillus subtilis genes.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).</li><li>Trieu-Cuot, P., Courvalin, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+the+Streptococcus+faecalis+plasmid+gene+encoding+the+3'5"-aminoglycoside+phosphotransferase+type+III.">Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3'5"-aminoglycoside phosphotransferase type III.</a> Gene. 23, 331-341 (1983).</li><li>Paik, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+virulence+determinants+for+endocarditis+in+Streptococcus+sanguinis+by+signature-tagged+mutagenesis.">Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis.</a> Infect. Immun. 73, 6064-6074 (2005).</li><li>Lukomski, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonpolar+inactivation+of+the+hypervariable+streptococcal+inhibitor+of+complement+gene+(sic)+in+serotype+M1+Streptococcus+pyogenes+significantly+decreases+mouse+mucosal+colonization.">Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization.</a> Infect. Immun. 68, 535-542 (2000).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, (2006).</li><li>de Berardinis, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complete+collection+of+single-gene+deletion+mutants+of+Acinetobacter+baylyi+ADP1.">A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.</a> Mol. Syst. Biol. 4, 174 (2008).</li><li>Rodriguez, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physiological+and+molecular+characterization+of+genetic+competence+in+Streptococcus+sanguinis.">Physiological and molecular characterization of genetic competence in Streptococcus sanguinis.</a> Mol. Oral. Microbiol. 26, 99-116 (2011).</li><li>Perry, D., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+mutans+Infect.">Genetic transformation of Streptococcus mutans Infect.</a> Immun. 32, 1295-1297 (1981).</li><li>Pakula, R., Walczak, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+nature+of+competence+of+transformable+streptococci.">On the nature of competence of transformable streptococci.</a> J. Gen. Microbiol. 31, 125-133 (1963).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).</li><li>Xu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+essential+gene+identification+in+Streptococcus+sanguinis.">Genome-wide essential gene identification in Streptococcus sanguinis.</a> Sci. Rep. 1, (2011).</li></ol>

관심 없음 충돌이 선언 없습니다.

초기 뇌관이 설계하면서 이웃 유전자에 대한 외인성 항생제 유전자과 하나가 타겟 유전자의 교체 가능한 극성 효과를 최소화하기 위해 두 단계 이동합니다. 삭제 된 유전자의 대부분은 프리 머 R1과 F3는 사전 정지 코돈 30 BP로 시작 코돈에 따라 6 BP에서 코딩 영역을 삭제할 수 있도록 설계되었습니다. 지난 30 기본 쌍은 인접 하류 유전자에 의해 사용 가능성 ribosomal 구속력이 사이트를 보호하기 위?...

<table border="1"&gt;<tbody&gt;<tr&gt;<td<strong&gt; 이름</strong</td&gt;<td<strong&gt; 회사 소개</strong</td&gt;<td<strong&gt; 카탈로그 #</strong</td&gt;<td<strong&gt; 코멘트 (선택 사항)</strong</td&gt;</tr&gt;<tr&gt;<td&gt; 프라이머 F2</td&gt;<td&gt; 통합 DNA 기술</td&gt;<td</td&gt;<td&gt; TGACTAACTAGGAGGAATAAATG<br/&gt; GCTAAAATGAGAATAT</td&gt;</tr&gt;<tr&gt;<td&gt; 프라이머 R2</td&gt;<td&gt; ibid</td&gt;<td</td&gt;<td&gt; CATTATTCCCTCCAGGTACTAAAA<br/&gt; CAATTCATCCAGT</td&gt;</tr&gt;<tr&gt;<td&gt; 프라이머 F2p</td&gt;<td&gt; ibid</td&gt;<td</td&gt;<td&gt; GATAAACCCAGCGAACCATTTGA</td&gt;</tr&gt;<tr&gt;<td&gt; 프라이머 P1</td&gt;<td&gt; ibid</td&gt;<td</td&gt;<td&gt; GCTTATATACCTTAGCAGGAGACA</td&gt;</tr&gt;<tr&gt;<td&gt; 프라이머 P2</td&gt;<td&gt; ibid</td&gt;<td</td&gt;<td&gt; GTATGACATTGCCTTCTGCGTCC</td&gt;</tr&gt;<tr&gt;<td&gt; 프라이머 5 &#39;end_R1_seq</td&gt;<td&gt; ibid</td&gt;<td</td&gt;<td&gt; GCCATTTATTCCTCCTAGTTAGTCA</td&gt;</tr&gt;<tr&gt;<td&gt; 프라이머 5 &#39;end_F3_seq</td&gt;<td&gt; ibid</td&gt;<td</td&gt;<td&gt; GTTTTAGTACCTGGAGGGAATAATG</td&gt;</tr&gt;<tr&gt;<td&gt; 프라이머 5 &#39;end_R1p_seq</td&gt;<td&gt; ibid</td&gt;<td</td&gt;<td&gt; CCTCAAATGGTTCGCTGGGTTTATC</td&gt;</tr&gt;<tr&gt;<td&gt; CSP</td&gt;<td&gt; Synprep</td&gt;<td</td&gt;<td&gt; 순서 : NH2-DLRGVPNPWGWIFGR-COOH</td&gt;</tr&gt;<tr&gt;<td&gt; DNA의 중합 효소</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; 11304-102</td&gt;<td&gt; 플래티넘 DNA 형성 촉매 효소 DNA 고 충실도</td&gt;</tr&gt;<tr&gt;<td&gt; EcoRI</td&gt;<td&gt; 뉴 잉글랜드 Biolabs 주식회사</td&gt;<td&gt; R0101S</td&gt;<td&gt; 제한 효소</td&gt;</tr&gt;<tr&gt;<td&gt; 한천</td&gt;<tdBioanalytical&gt; 미국</td&gt;<td&gt; AB01185</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; 아가로 오스</td&gt;<td&gt; Promega</td&gt;<td&gt; V3125</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; BHI</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 237500</td&gt;<td&gt; 뇌 하트 주입</td&gt;</tr&gt;<tr&gt;<td&gt; 말 혈청</td&gt;<td&gt; 피셔 과학</td&gt;<td&gt; SH3007403</td&gt;<td&gt; 말 혈청</td&gt;</tr&gt;<tr&gt;<td&gt; km</td&gt;<td&gt; 피셔 과학</td&gt;<td&gt; BP906-5</td&gt;<td&gt; Kanamycin</td&gt;</tr&gt;<tr&gt;<td&gt; TH 국물</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 249240</td&gt;<td&gt; 토드 휴이트 국물</td&gt;</tr&gt;<tr&gt;<td&gt; PureLink 96</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; K310096</td&gt;<td&gt; PureLink 96 PCR 정화 키트</td&gt;</tr&gt;<tr&gt;<td&gt; QIAquick</td&gt;<td&gt; Qiagen</td&gt;<td&gt; 28,106</td&gt;<td&gt; QIAquick PCR 정화 키트</td&gt;</tr&gt;<tr&gt;<td&gt; 필터</td&gt;<td&gt; 코닝</td&gt;<td&gt; 431117</td&gt;<td&gt; 0.22 μm의 폴리스티렌 필터</td&gt;</tr&gt;<tr&gt;<td&gt; Anoxomat 시스템</td&gt;<td&gt; 마트 미생물 BV</td&gt;<td&gt; Anoxomat 마크 II</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Benchtop의 원심 분리기</td&gt;<td&gt; 열 과학</td&gt;<td&gt; 75004377</td&gt;<td&gt; Sorvall 전설 RT 플러스 microplate 회</td&gt;</tr&gt;<tr&gt;<td&gt; 젤 문서</td&gt;<td&gt; UVP LLC</td&gt;<td&gt; BioDoc - 이건 210</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; 보육</td&gt;<td&gt; 피셔 과학</td&gt;<td&gt; 11-690 - 625D</td&gt;<td&gt; Isotemp</td&gt;</tr&gt;<tr&gt;<td&gt; Labnet의 젤 XL</td&gt;<td&gt; Labnet</td&gt;<td&gt; E0160</td&gt;<td&gt; Labnet의 젤 XL</td&gt;</tr&gt;<tr&gt;<td&gt; Microcentrifuge</td&gt;<td&gt; Eppendorf</td&gt;<td&gt; 22621408</td&gt;<td&gt; Microcentrifuge 5415 R</td&gt;</tr&gt;<tr&gt;<td&gt; 멀티 채널 피펫</td&gt;<td&gt; 열 Scientfic</td&gt;<td&gt; 4661040, 4661020</td&gt;<td&gt; Finnpipette F1</td&gt;</tr&gt;<tr&gt;<td&gt; 열 자전거 타는 사람</td&gt;<td&gt; 응용 Biosystems 주식회사</td&gt;<td&gt; N805-0200</td&gt;<td&gt; GeneAmp PCR 시스템 9700</td&gt;</tr&gt;</tbody&gt;</table

genome-wide gene deletions in streptococcus sanguinis by high throughput pcr

Transposon mutagenesis 및 단일 유전자 삭제 박테리아 1,2의 게놈 전체 유전자 녹아웃에 적용된 두 가지 방법이 있습니다. transposon의 mutagenesis이 적은 시간이 소요 적은 비용이 많이 드는, 그리고 완성 된 게놈 정보를 요구하지 않습니다하지만,이 방법은 두 약점이 있습니다 : 감소 경쟁과 뮤턴트 카운터 선택하는 혼합 돌연변이 라이브러리의 서로 다른 돌연변이 (1) 가능성, (2) 일부 유전자 불 활성화의 가능성은 상기 유전자가 완전히 transposon의 삽입에 따라 자신의 기능을 잃게하지 않습니다. 단일 유전자 삭제 분석 transposon의 mutagenesis와 관련된 단점을 보완 할 수 있습니다. 게놈 전체의 단일 유전자 삭제의 효율성을 개선하기 위해, 우리는 모델 생물로 연쇄상 구균의 sanguinis를 사용하여 게놈 전체의 단일 유전자 삭제에 대한 높은 처리량 기술을 확립하려고합니다. 각 유전자 삭제 S.에 구축 sanguinis 게놈는 1을 구성하도록 설계되었습니다타겟 유전자 aphA-3 유전자 인코딩 kanamycin 저항 단백질, 그리고 타겟 유전자의 1 이하 하류-KB 상류. 프리 머 F1/R1, F2/R2, 그리고 F3/R3 세 세트를 각각 설계, 각 삭제 그 세 가지 구성 요소 구성의 PCR-amplifications을위한 96 - 웰 플레이트 형식으로 합성됩니다. 프리 머 R1과 F3는 5 &#39;끝 부분에있는 aphA-3 유전자의 지역에 보완 25 BP 시퀀스가 포함되어 있습니다. aphA-3 유전자의 대규모 PCR 증폭은 모든 단일 유전자 삭제 구조를 만드는 한 번 수행됩니다. aphA-3 유전자의 프로모터는 처음 kanamycin 카세트의 잠재력 극성 효과를 최소화하기 위해 제외됩니다. 유전자 삭제 구조를 만들려면, 높은 처리량 PCR의 증폭 및 정화는 96 - 웰 플레이트 형식으로 수행됩니다. 각 유전자 삭제에 대한 선형 재조합 PCR의 amplicon는 고 충실도의 DNA 중합 효소를 사용하여 네 PCR 반응을 통해 구성됩니다. 초기 exponS.의 ential 성장 단계 2.5 % inactivated 말 혈청이 PCR-재조합 구조의 변화에 대한 능력을 향상하는 데 사용됩니다와 토드 휴이트 국물에 배양 sanguinis이 보충. S.의 조건, 최대 20 % sanguinis 세포는 DNA의 ~ 50 NG를 통해 변환 할 수 있습니다. 이 방법에 따라, 단일 유전자 삭제로 2048 뮤턴트은 궁극적으로 S.에있는 2,270 유전자에서 얻은되었습니다 네 유전자 ORFs 제외 sanguinis은 S.의 다른 ORFs 내에 완전히 포함 sanguinis SK36 218 가능성이 필수적인 유전자. 유전자 삭제 구조를 만드는 방법에 대한 기술은 높은 처리량이며, 모든 transformable 박테리아 게놈 전체의 단일 유전자 삭제에 사용하기 쉬운 될 수 있습니다.

후 PCR의 프리 머 F1과 R1을 사용하여 증폭하고, F3 및 R3, 각 S. 약 1 킬로바이트 업스트림 및 다운 스트림 sanguinis 유전자는 96도 형식은 각각 (그림 2A)에서 얻은되었습니다. 우리의 PCR 조건 및 사용하여 설계 프리 머에서 특정 제품 S.에서 증폭 된 각 PCR 반응에 sanguinis 게놈 DNA. 이 결과는 프리 머은 S.의 목표에 매우 구체적인이었다 표시 sanguinis. PCR?...

Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

효율적인 게놈 전체의 단일 유전자 돌연변이 방법은 사용하는 설립되었습니다<em&gt; 연쇄상 구균 sanguinis</em&gt; 모델 생물로. 이 방법은 높은 처리량 재조합 PCRs 및 변환을 통해 달성했다.

게놈 전체 유전자 삭제할에<em&gt; 연쇄상 구균 sanguinis</em&gt; 높은 처리량 PCR에 의한

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

genome-wide-gene-deletions-streptococcus-sanguinis-high-throughput

Research

JoVE Journal

Biology

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

16.4K 조회수.  Virginia Commonwealth University. 효율적인 게놈 전체의 단일 유전자 돌연변이 방법은 사용하는 설립되었습니다 연쇄상 구균 sanguinis 모델 생물로. 이 방법은 높은 처리량 재조합 PCRs 및 변환을 통해 달성했다.

비디오: Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the protein domains that bind to specific histone modifications. One such domain is the plant homeodomain (PHD), found in several chromatin-binding proteins. The epigenetic factor RBP2 has multiple PHD domains, however, they have different functions (Figure 4). In particular, the C-terminal PHD domain, found in a RBP2 oncogenic fusion in human leukemia, binds to trimethylated lysine 4 in histone H3 (H3K4me3)1. The transcript corresponding to the RBP2 isoform containing the C-terminal PHD accumulates during differentiation of promonocytic, lymphoma-derived, U937 cells into monocytes2. Consistent with both sets of data, genome-wide analysis showed that in differentiated U937 cells, the RBP2 protein gets localized to genomic regions highly enriched for H3K4me33. Localization of RBP2 to its targets correlates with a decrease in H3K4me3 due to RBP2 histone demethylase activity and a decrease in transcriptional activity. In contrast, two other PHDs of RBP2 are unable to bind H3K4me3. Notably, the C-terminal domain PHD of RBP2 is absent in the smaller RBP2 isoform4. It is conceivable that the small isoform of RBP2, which lacks interaction with H3K4me3, differs from the larger isoform in genomic location. The difference in genomic location of RBP2 isoforms may account for the observed diversity in RBP2 function. Specifically, RBP2 is a critical player in cellular differentiation mediated by the retinoblastoma protein (pRB). Consistent with these data, previous genome-wide analysis, without distinction between isoforms, identified two distinct groups of RBP2 target genes: 1) genes bound by RBP2 in a manner that is independent of differentiation; 2) genes bound by RBP2 in a differentiation-dependent manner.
To identify differences in localization between the isoforms we performed genome-wide location analysis by ChIP-Seq. Using antibodies that detect both RBP2 isoforms we have located all RBP2 targets. Additionally we have antibodies that only bind large, and not small RBP2 isoform (Figure 4). After identifying the large isoform targets, one can then subtract them from all RBP2 targets to reveal the targets of small isoform. These data show the contribution of chromatin-interacting domain in protein recruitment to its binding sites in the genome.

Here we are presenting a chromatin immunoprecipitation (ChIP) procedure for genome-wide location analysis of protein isoforms that differ in a histone-binding domain. We are applying it to ChIP-Seq analysis to identify the targets of the KDM5A/JARID1A/RBP2 histone demethylase.

이소형 특정 유전자 목표를 식별 칩을 사용하여 게놈 차원의 분석

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

연구

생물학

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

선교 대상 아이디 라이브러리를 사용하여 miRNA 목표를위한 게놈 - 와이드 스크린

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. elegans, gene function can be knocked down simply and efficiently by feeding worms with bacteria expressing a dsRNA corresponding to a specific gene 1. While the creation of libraries of RNAi clones covering most of the C. elegans genome 2,3 opened the way for true functional genomic studies (see for example 4-7), most established methods are laborious. Moy and colleagues have developed semi-automated protocols that facilitate genome-wide screens 8. The approach relies on microscopic imaging and image analysis. 
	Here we describe an alternative protocol for a high-throughput genome-wide screen, based on robotic handling of bacterial RNAi clones, quantitative analysis using the COPAS Biosort (Union Biometrica (UBI)), and an integrated software: the MBioLIMS (Laboratory Information Management System from Modul-Bio) a technology that provides increased throughput for data management and sample tracking. The method allows screens to be conducted on solid medium plates. This is particularly important for some studies, such as those addressing host-pathogen interactions in C. elegans, since certain microbes do not efficiently infect worms in liquid culture.
	We show how the method can be used to quantify the importance of genes in anti-fungal innate immunity in C. elegans. In this case, the approach relies on the use of a transgenic strain carrying an epidermal infection-inducible fluorescent reporter gene, with GFP under the control of the promoter of the antimicrobial peptide gene nlp 29 and a red fluorescent reporter that is expressed constitutively in the epidermis. The latter provides an internal control for the functional integrity of the epidermis and nonspecific transgene silencing9. When control worms are infected by the fungus they fluoresce green. Knocking down by RNAi a gene required for nlp 29 expression results in diminished fluorescence after infection. Currently, this protocol allows more than 3,000 RNAi clones to be tested and analyzed per week, opening the possibility of screening the entire genome in less than 2 months.

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

We describe a protocol using C. elegans and RNAi feeding libraries that allows automated measurement of multiple parameters such as fluorescence, size and opacity of individual worms in a population. We give one example of a screen to identify genes involved in anti-fungal innate immunity in C. elegans.

의 정량 및 자동화된 고속 처리량 게놈 전체의 RNAi 화면 C. elegans</em

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. ...

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative.
In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated.
Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction.
The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci&#x2014;either Green Monster GMToolkit-a or GMToolkit-&alpha; at the can1&Delta; locus (Figure 3). Using strains from the yeast deletion collection12, GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP-URA3 fragment. Each GMToolkit contains: either the a- or &alpha;-mating-type-specific haploid selection marker1 and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids.
The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation.

The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.

여러 유전자 삭제를 운반 효모 종자의 생성에 대한 초록 괴물 프로세스

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

정량적 RT-PCR에 의해 개별 인간 배아 줄기 세포를 프로파일 링

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay (PCA) in Living Cells

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often depend on its interactions with other proteins. Here, we describe a protocol for the yeast protein-fragment complementation assay (PCA), a powerful method to detect direct and proximal associations between proteins in living cells. The interaction between two proteins, each fused to a dihydrofolate reductase (DHFR) protein fragment, translates into growth of yeast strains in presence of the drug methotrexate (MTX). Differential fitness, resulting from different amounts of reconstituted DHFR enzyme, can be quantified on high-density colony arrays, allowing to differentiate interacting from non-interacting bait-prey pairs. The high-throughput protocol presented here is performed using a robotic platform that parallelizes mating of bait and prey strains carrying complementary DHFR-fragment fusion proteins and the survival assay on MTX. This protocol allows to systematically test for thousands of protein-protein interactions (PPIs) involving bait proteins of interest and offers several advantages over other PPI detection assays, including the study of proteins expressed from their endogenous promoters without the need for modifying protein localization and for the assembly of complex reporter constructs.

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay PCA in Living Cells

Proteins interact with each other and these interactions determine in a large part their functions. Protein interaction partners can be identified at high-throughput in vivo using a yeast fitness assay based on the dihydrofolate reductase protein-fragment complementation assay (DHFR-PCA).

살아있는 세포의 단백질 조각 보완 분석 (PCA)에 의해 게놈 전체 단백질 - 단백질 상호 작용 상영

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

후 전사적으로 규제 유전자의 화학 변조기에 대한 높은 처리량 검사

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

qPCRTag Analysis - A High Throughput, Real Time PCR Assay for Sc2.0 Genotyping

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic chromosome, synIII1, and one synthetic chromosome arm, synIXR2, have been constructed and their in vivo function validated in the absence of the corresponding wild type chromosomes. An important design feature of Sc2.0 chromosomes is the introduction of PCRTags, which are short, re-coded sequences within open reading frames (ORFs) that enable differentiation of synthetic chromosomes from their wild type counterparts. PCRTag primers anneal selectively to either synthetic or wild type chromosomes and the presence/absence of each type of DNA can be tested using a simple PCR assay. The standard readout of the PCRTag assay is to assess presence/absence of amplicons by agarose gel electrophoresis. However, with an average PCRTag amplicon density of one per 1.5 kb and a genome size of ~12 Mb, the completed Sc2.0 genome will encode roughly 8,000 PCRTags. To improve throughput, we have developed a real time PCR-based detection assay for PCRTag genotyping that we call qPCRTag analysis. The workflow specifies 500 nl reactions in a 1,536 multiwell plate, allowing us to test up to 768 PCRTags with both synthetic and wild type primer pairs in a single experiment.

Designer chromosomes of the Synthetic Yeast Genome project, Sc2.0, can be distinguished from their native counterparts using a PCR-based genotyping assay called PCRTagging, which has a presence/absence endpoint. Here we describe a high-throughput real time PCR detection method for PCRTag genotyping.

qPCRTag 분석 - 높은 처리량, Sc2.0 유전형에 대한 실시간 PCR 분석

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic ...

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC (Crosslinking of Small Molecules to Isolate Chromatin)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to dose-limiting toxicity and many adverse side effects. Targeting the genome with sequence-specific small molecules may enable molecules with increased therapeutic index and fewer off-target effects. N-methylpyrrole/N-methylimidazole polyamides are molecules that can be rationally designed to target specific DNA sequences with exquisite precision. And unlike most natural transcription factors, polyamides can bind to methylated and chromatinized DNA without a loss in affinity. The sequence specificity of polyamides has been extensively studied in vitro with cognate site identification (CSI) and with traditional biochemical and biophysical approaches, but the study of polyamide binding to genomic targets in cells remains elusive. Here we report a method, the crosslinking of small molecules to isolate chromatin (COSMIC), that identifies polyamide binding sites across the genome. COSMIC is similar to chromatin immunoprecipitation (ChIP), but differs in two important ways: (1) a photocrosslinker is employed to enable selective, temporally-controlled capture of polyamide binding events, and (2) the biotin affinity handle is used to purify polyamide&#8211;DNA conjugates under semi-denaturing conditions to decrease DNA that is non-covalently bound. COSMIC is a general strategy that can be used to reveal the genome-wide binding events of polyamides and other genome-targeting chemotherapeutic agents.

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC Crosslinking of Small Molecules to Isolate Chromatin

Identifying the direct targets of genome-targeting molecules remains a major challenge. To understand how DNA-binding molecules engage the genome, we developed a method that relies on crosslinking of small molecules to isolate chromatin (COSMIC).

COSMIC와 세포의 약물-DNA 상호 작용의 게놈 넓은 매핑 (작은 분자의 가교는 염색질을 분리)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is an alternative approach to chromatin immunoprecipitation (ChIP). An expressed fusion protein consisting of the protein of interest and the E. coli DNA adenine methyltransferase can methylate the adenine base in GATC motifs near the sites of protein-DNA interactions. Adenine-methylated DNA fragments can then be specifically amplified and detected. The original DamID assay detects the genomic locations of methylated DNA fragments by hybridization to DNA microarrays, which is limited by the availability of microarrays and the density of predetermined probes. In this paper, we report the detailed protocol of integrating high throughput DNA sequencing into DamID (DamID-seq). The large number of short reads generated from DamID-seq enables detecting and localizing protein-DNA interactions genome-wide with high precision and sensitivity. We have used the DamID-seq assay to study genome-nuclear lamina (NL) interactions in mammalian cells, and have noticed that DamID-seq provides a high resolution and a wide dynamic range in detecting genome-NL interactions. The DamID-seq approach enables probing NL associations within gene structures and allows comparing genome-NL interaction maps with other functional genomic data, such as ChIP-seq and RNA-seq.

We describe herein an assay by coupling DNA adenine methyltransferase identification (DamID) to high throughput sequencing (DamID-seq). This improved method provides a higher resolution and a wider dynamic range, and allows analyzing DamID-seq data in conjunction with other high throughput sequencing data such as ChIP-seq, RNA-seq, etc.

DamID-SEQ : 아데닌 - 메틸화 된 DNA 단편의 높은 처리량 시퀀싱에 의해 단백질 DNA 상호 작용의 게놈 넓은 매핑

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...