The OPPF-UK is funded by the Medical Research Council, UK (grant MR/K018779/1) and the Membrane Protein Laboratory by the Wellcome Trust (grant 099165/Z/12/Z).

발현 벡터의 1. 건설 <ol><li> 사용하여 PCR 주입 서열 13 각각에 절단 가능한 C 말단 또는 N 말단 GFP-을 His6 융합체를 추가 벡터 pOPINE-3C-GFP 및 POPIN-N-GFP를 이용하여 병렬로 96 발현 플라스미드까지 구축 클로닝. 주 : GFP가 세포질에서 발현 될 필요가 보낸 벡터의 선택은 이와 세포질 N 말단 세포 외 C 말단 우리 POPIN-N-GFP 및 대한을 사용 가진 단백질, 단백질의 토폴로지에 의해 결정되고 세포 외 N 말단과 세포질 C 말단은 우리가 pOPINE-3C-GFP를 사용합니다. 두 말단이 세포질 어디 C- 말단에 태그를하지 기능 이유가없는 한 우리는 pOPINE-3C-GFP를 사용합니다. </li><li> 도시 확장명 혼입 프라이머 막 단백질을 코딩하는 DNA 서열을 증폭 : pOPINE-3C-GFP (정방향 프라이머 - AGGAGATATACCATG는 프라이머 역 - CAGAACTTCC을AGTTT)과 POPIN-N-GFP (정방향 프라이머 - AAGTTCTGTTTCAGGGCCCG은 - ATGGTCTAGAAAGCTTTA) 프라이머 역. </li><li> 아가로 오스 겔 전기 영동에 의해 PCR 반응을 분석한다. 일단 깨끗한 PCR 제품이 얻어졌다 (1 배 DpnI 반응 버퍼의 5 μL 메이크업) 각 웰에 5 U DpnI를 추가합니다. 96- 웰 포맷으로 자성 비드를 이용하여 PCR 생성물을 정제 하였다. 참고 : DpnI 템플릿 벡터를 제거하기 위해 추가됩니다 게놈 DNA를 주형으로 사용하는 경우이 단계가 필요하지 않습니다. </li><li> PCR 플레이트의 각 웰에 적절한 선형화 된 벡터의 1 μL (100 NG)를 추가한다. </li><li> 정제 된 PCR ㎕의 멀티 채널 피펫 추가 X를 사용하여 PCR 플레이트의 적절한 우물에 삽입합니다. 모든 제품은 10-250 NG의 범위에 있는지 확인하십시오. </li><li> 우물의 물 (9-X) μl를 추가하고 건조 다운에서 융합 시약을 포함하는 튜브에 전체의 10 μl를 전송합니다. 30 초 동안 그대로 둡니다. </li><li> 피펫 팅 아래로 간단히 내용을 섞는다. 이전원래 PCR 플레이트와 실에 반응. </li><li> 열 순환기에 42 ° C에서 30 분 동안 품어. </li><li> 즉시 TE 40 μl를 반응이 완료되는 즉시 얼음에 반응을 전송하고 추가 (10 mM 트리스, pH가 8.0, 1 mM의 EDTA). </li><li> 한 번에 동결 또는 관할 세포로 변환. 변환의 높은 역량의 50 μL 나누어지는 (&gt; 5 × 10 9 형질 전환 / μg의) 능력 E. 당 희석 된 반응의 3 μl를 사용 대장균 세포. </li><li> LB 한천 배지 1 ㎖를 50 ㎍ / ml의 카르 베니 실린 당 웰의 24 웰 조직 배양 플레이트로 보충 추가 (클로닝, 구조의 2 × 번호 웰을 준비). </li><li> 생장 플레이트 후, 생장을 따라 밖으로 25㎕를 24 웰 조직 배양 플레이트를 함유하는 아가 상에 배양 한 5 희석액 25 μL. </li><li> 부드럽게 판을 기울여 세포를 확산. </li><li> 37 ° C 또는 플로에 10 ~ 15 분 동안 뚜껑 접시를 건조실온에서 w 후드. </li><li> 뚜껑을 교체하고 거꾸로 판을 켜고 밤새 37 ° C를 품어. </li><li> 두 식민지와 미니 준비 벡터를 선택합니다. </li><li> PCR은 구조 특정 역방향 프라이머 및 벡터 특정 정방향 프라이머 (예 pOPIN_FOR GAC CGA AAT TAA TAC GAC TCA CTA 태그 GG)를 사용하여 구조를 확인합니다. </li></ol> E. 2. 변환 대장균 E의 XPRESSION 변종 참고 : 이전에이 프로토콜, E.을 수행하기 대장균 유능한 세포를 만든 분주 이전 13 설명 ​​된대로 -80 ° C에서 냉동 저장됩니다. 막 단백질 발현이 정기적으로 두 균주에서 상영되어, Lemo21 (DE3)과 C41 (DE3) pLysS를. 결과의 해석을 돕기 위해 그것을 예 양성 대조군, GFP 발현 플라스미드 또는 발현하는 것으로 알려져 GFP 융합 세포막 단백질과 빈 벡터 대조군을 포함하는 것이 도움이 될 수있다. <ol><li> 알리 해동quotted E. 얼음에 대장균. 유능한 세포의 각 나누어지는에 미니 수험 공부를 발현 플라스미드의 3 μl를 추가합니다. </li><li> 30 분 동안 얼음에 믹스를 품어. </li><li> 42 ° C에서 30 초 동안 세포를 열 쇼크. </li><li> 세포가 2 분 동안 얼음에 복구하고 각 튜브에 전원 국물의 300 μl를 추가 할 수 있도록 허용. </li><li> 37 ° C 정적 배양기에서 1 시간 동안 품어. </li><li> 50 ㎍ / ml의 카르 베니 실린과 35 ㎍ / ㎖의 클로람페니콜 보충, 24 웰 조직 배양 플레이트에서 LB 한천을 준비합니다. Lemo21 (DE3)를 함유하는 웰에 0.25 ㎜의 최종 농도 람노 추가. 참고 제품 C41을 함유하는 웰에 독성이있을 가능성이있는 경우 (DE3) pLysS를 1 % (w / v) 글루코오스로 보충 될 수있다. </li><li> 전송 LB 아가 플레이트 상에 형질 전환 혼합물로부터 세포의 30 μL. 확산 및 1.13-1.15에 설명 된대로 판을 건조. </li></ol> 박 스타터 문화 3. 준비 참고 : 항상 오래된 변환 판에서 결코 변환 후 하룻밤 문화에게 일을 준비합니다. <ol><li> 50 ㎍ / ㎖의 카르 베니 실린과 35 ㎍ / ㎖의 클로람페니콜 보충 96 웰 깊은 웰 플레이트의 각 웰에 0.7 ml의 전원 국물을 추가합니다. 0.25 mM의 최종 농도 Lemo21 (DE3)를 함유하는 웰에 추가 람노. 선택적으로, 1 % (w / v)의 글루코스 C41 (DE3) pLysS를 보충; 위 (2.6 주)를 참조하십시오. </li><li> 물론 각에 하룻밤 변환 판에서 하나의 식민지를 선택합니다. 가스 투과성 씰 블록을 밀봉합니다. </li><li> 하룻밤 37 ° C에서 작은 던져 (예 : 4.3 mm 궤도)와 인큐베이터에 큰 던져 (예를 들어 25mm 궤도) 또는 600 rpm에서와 배양기에서 250 rpm에서 블록을 흔들어. </li></ol> 4. 성장과 문화의 유도 <ol><li> 전원 국물의 3 ㎖를 각각 50 ㎍ / ml의 카르 베니 실린과 35 ㎍ / ㎖의 클로람페니콜 w 보충 추가24 잘 깊은 웰 플레이트의 엘. 3.1 절에 설명 된대로 L-람 노스 (포도당)를 추가합니다. 중복에 수확을 할 수 있도록 문화의 3 ㎖를 사용하여 가스 투과 실을 통해 물이 일부 증발을 허용 할 수 있습니다. </li><li> 24 잘 깊은 잘 블록의 각 웰에 Lemo21 (DE3) 또는 C41 (DE3) pLysS를 하룻밤 문화의 150 μl를 추가하여 식 문화를 설정합니다. </li><li> 595 nm에서의 평균 OD 때까지 37 ° C에서 블록을 흔들어는 ~ 판을 통해 0.5입니다. </li><li> 1.0 mM의 IPTG의 최종 농도로 배양 물에 IPTG를 첨가하여 발현을 유도한다. </li><li> 20 ℃에서 진탕 배양 하룻밤 (18 ~ 20 시간)을 성장. </li></ol> 에 - 겔 형광에 의한 표현의 5. 분석 <ol><li> 중복에 수확. 광장 아니라, 원뿔 바닥, 96 웰 깊은 잘 블록에 각 웰에서 문화의 양도 1 ml의. 주 : 추수 중복 블록 또는 파손시의 교류 직류 시험을 허용원하는 경우 세제를했습니다. </li><li> 블록을 밀봉하고 10 분 동안 6,000 XG에서 원심 분리하여 세포를 수확. </li><li> 블록 전환과 미디어를 가만히 따르다. 남은 용지를 배출 종이 타월 위에 가볍게 블록을 누릅니다. </li><li> 20 분 이상 동안 -80 ℃에서 저장 판 봉쇄. 선택적으로,이 시점에서 실험 때 편리 처리 블록을 떠난다. </li><li> 실온에서 20 분 동안 펠릿 드 로스트. </li><li> 용해 완충액 (50 mM의에 NaH 2 PO 4, 300 mM의 NaCl을 10 mM의 이미 다졸, 1 % (V)의 200 μL 완전히 세포를 재현 탁 4 ° C에서 멀티 채널 피펫 또는 진탕 기 (10 분 동안 1,000 RPM)를 사용하여 / V 트윈 20) NaOH를 사용하여 8.0으로 산도를 조정합니다. </li><li> (물 2 ㎖의 최종 부피 20 μL DNaseI (4000 단위 / ㎖), 20 mg의 라이소자임, 2​​0 μL 프로테아제 억제제 칵테일) DLPI 20 μL의 용액을 추가한다. 4 ℃에서 (~ 1,000 RPM)을 진탕 10 분 동안 품어. </li><li&gt; 10 % N -Dodecyl의 β-D-말토 (DDM)의 25 μl를 추가합니다. </li><li> 4 ℃에서 (~ 1,000 RPM)을 진탕 60 분 동안 품어. </li><li> 원심 분리기 4 ° C에서 30 분 동안 6,000 XG에 깊은 웰 블록. </li><li> 마이크로 타이 플레이트에 분해물의 10 μl를 전송 및 SDS PAGE 겔 로딩 버퍼 (100 mM 트리스, 산도 6.8, w 4 %의 10 μl를 추가 / SDS V, 0.2 % w 브로 모 페놀 블루, 10 % V / V의 β V / 머 캅토 에탄올, 20 % v / V를 글리세롤).주의! 샘플을 끓여하지 마십시오. </li><li> 로드 단계 5.11에서 시료 10 μL / 웰 SDS 페이지 젤 (들) 상 및 염료 전면 하단 (2-2.5 시간)에 도달 할 때까지 차가운 방에서 100 ~ 120 V (정전압)에서 실행합니다. </li><li> (GFP 융합 단백질을 검출하는 푸른 빛 필터 예 :) 이미 저에 젤을 놓습니다. 노출 시간은 밝은 밴드가 포화되지 않도록 선택된다. </li></ol> 세포 배양 6. 스케일 업 <ol><li> 관할의 나누어지는 변환 <em&gt; E. 대장균은 2 절에서 설명. </li><li> (3 절에 설명 된대로 보충) 전원 국물 10 ㎖에 식민지를 선택하고 37 ° C에서 하룻밤 성장. </li><li> 500 ml의 전원 국물에 하룻밤 문화의 5 mL를 희석. </li><li> 595 nm에서 OD 때까지 37 ° C에서 250 rpm으로 진탕 성장은 ~ 0.5입니다. </li><li> 1.0 mM의 최종 농도로 IPTG를 첨가하여 발현을 유도한다. </li><li> 20 ° C에서 250 rpm으로 진탕 하룻밤 성장. </li><li> 원심 분리하여 수확 세포를 15 분 동안 5,000 XG에. </li><li> 취소 상층 액. 세포 펠렛을 -80 ℃에서 보관 될 수있다. </li></ol> 막 7. 준비 <ol><li> 세포 펠렛의 g 당 5 ㎖의 부피로 1X PBS pH가 7.5을 실온에서 해동하고 재현 탁 세포 (필요한 경우); 점도가 콧물 일관성에 감소 할 때까지 필요에 따라 볼륨을 높입니다. 10 ㎍ / ㎖의 하나의 최종 농도 1 mM의,의 DNase I의 최종 농도의 MgCl 2를 추가세포 펠릿 20g 당 프로테아제 억제제 타블렛 사전 패키지. 30 KPSI의 압력에서 냉장 세포 장애 물질을 사용하여 열려있는 세포를 휴식. </li><li> 4 ℃에서 15 분 동안 30,000g에서 끊어지지 세포와 파편 펠렛. 초 원심 분리 튜브에 뜨는을 전송합니다. </li><li> 4 ° C에서 1 시간 동안 20 만 XG에서 초 원심 분리기에서 상층 액을 회전시켜 총 막 분획을 수집합니다. </li><li> 상층 액을 제거한다. </li><li> 세포 균질기를 사용하여 빙냉 PBS 10 ㎖의 pH 7.5에서의 막 펠렛을 다시 일시. 막 재현 탁 1 ml를 각각의 세제가 필요합니다. 선택적으로,이 단계에서, 플래시는 -80 ℃에서 액체 질소에 저장 막 현탁액을 동결. </li></ol> 막 분획 8. 가용화 및 분석 <ol><li> 해동 막 분획 (필요한 경우), 각각의 세제가 용해에 사용하는, 1.5 ml의 막으로 현탁액의 분취 량 900 ㎕를 마이크로 polyallomer centrifuGE의 튜브. </li><li> 지정된 1.5 ㎖의 튜브에 1 %의 최종 농도로 각각의 새로 제조 된 세제를 100 μL (10 % w / DDM, DM의 V 솔루션 Cymal LD​​AO-6)을 추가한다. 진핵 세포 막 단백질 콜레스테롤 헤 미숙시 네이트 (0.2 % 최종 농도)의 가용화 세정제에 첨가 할 수있다. </li><li> 가벼운 교반과 함께 1 시간 동안 4 ° C에서 혼합물을 품어. </li><li> 45 분 동안 4 ° C에서 150,000g에서 보장 튜브가 적어도 절반 가득, 벤치 탑 초 원심 분리기와 세제 불용성 부분을 펠렛과 상층 액을 유지합니다. 주 : 세제 가용화 효과는 PBS의 동일 용적에 재현 탁 세제 불용성 분획으로 가용화 막 GFP 형광을 측정하여 형광 플레이트 판독기를 사용하여 추정 될 수있다. </li><li> 다른 세제 모노 - 분산 분석 : 막 단백질 복합체 형광 감지 된 크기 배제 크로마토 그래피를 이용하여 (FSEC). </li><li> FSEC 분석을 위해 / 분 0.3 ml의 유속으로 완충액 (20 mM 트리스 pH가 7.5, 150 mM의 염화나트륨, 0.03 %의 DDM)를 실행하여, 분자량 5,000,000 넓은 분별 범위 크기 배제 칼럼, 예를 들어 5000 평형화 . 모든 샘플이 버퍼를 사용하여, 그것은 각 시험 세제 변경되지 않습니다 즉. </li><li> / 분 0.3 ml의 유속으로 컬럼 상 가용화 된 막 100 ㎕를 주입한다. 형광 광학계 (488 nm에서 여기 및 512 nm에서 방출)을 이용하여 용출 프로파일을 모니터한다. 인라인 형광 모니터를 사용할 수없는 경우, 분획을 수집하고 플레이트 판독기에서 형광을 판독. </li><li> 그래픽 디스플레이에 대한 스프레드 시트 프로그램으로 가져 용리 부피와 형광 강도 데이터. </li><li> 섹션 5에 기술 된 바와 같이 겔의 형광에 의해 가용화 된 막 물질을 분석한다 잔존. </li></ol>

<ol>
	<li>Wallin, E., von Heijne, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+integral+membrane+proteins+from+eubacterial,+archaean,+and+eukaryotic+organisms.">Genome-wide analysis of integral membrane proteins from eubacterial, archaean, and eukaryotic organisms.</a> Protein Sci. 7 (4), 1029-1038 (1998).</li><li>Fagerberg, L., Jonasson, K., von Heijne, G., Uhlen, M., Berglund, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prediction+of+the+human+membrane+proteome.">Prediction of the human membrane proteome.</a> Proteomics. 10 (6), 1141-1149 (2010).</li><li>Okada, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-Ray+diffraction+analysis+of+three-dimensional+crystals+of+bovine+rhodopsin+obtained+from+mixed+micelles.">X-Ray diffraction analysis of three-dimensional crystals of bovine rhodopsin obtained from mixed micelles.</a> J Struct Biol. 130 (1), 73-80 (2000).</li><li>Palczewski, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+rhodopsin:+A+G+protein-coupled+receptor.">Crystal structure of rhodopsin: A G protein-coupled receptor.</a> Science. 289 (5480), 739-745 (2000).</li><li>Miroux, B., Walker, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Over-production+of+proteins+in+Escherichia+coli:+mutant+hosts+that+allow+synthesis+of+some+membrane+proteins+and+globular+proteins+at+high+levels.">Over-production of proteins in Escherichia coli: mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels.</a> J Mol Biol. 260 (3), 289-298 (1996).</li><li>Wagner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tuning+Escherichia+coli+for+membrane+protein+overexpression.">Tuning Escherichia coli for membrane protein overexpression.</a> Proc Natl Acad Sci U S A. 105 (38), 14371-14376 (2008).</li><li>Schlegel, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimizing+membrane+protein+overexpression+in+the+Escherichia+coli+strain+Lemo21(DE3).">Optimizing membrane protein overexpression in the Escherichia coli strain Lemo21(DE3).</a> J Mol Biol. 423 (4), 648-659 (2012).</li><li>Chun, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+partner+toolchest+for+the+stabilization+and+crystallization+of+G+protein-coupled+receptors.">Fusion partner toolchest for the stabilization and crystallization of G protein-coupled receptors.</a> Structure. 20 (6), 967-976 (2012).</li><li>Drew, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GFP-based+optimization+scheme+for+the+overexpression+and+purification+of+eukaryotic+membrane+proteins+in+Saccharomyces+cerevisiae.">GFP-based optimization scheme for the overexpression and purification of eukaryotic membrane proteins in Saccharomyces cerevisiae.</a> Nat Protoc. 3 (5), 784-798 (2008).</li><li>Drew, D. E., von Heijne, G., Nordlund, P., de Gier, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Green+fluorescent+protein+as+an+indicator+to+monitor+membrane+protein+overexpression+in+Escherichia+coli.">Green fluorescent protein as an indicator to monitor membrane protein overexpression in Escherichia coli.</a> FEBS Lett. 507 (2), 220-224 (2001).</li><li>Kawate, T., Gouaux, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence-detection+size-exclusion+chromatography+for+precrystallization+screening+of+integral+membrane+proteins.">Fluorescence-detection size-exclusion chromatography for precrystallization screening of integral membrane proteins.</a> Structure. 14 (4), 673-681 (2006).</li><li>Newstead, S., Kim, H., von Heijne, G., Iwata, S., Drew, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+fluorescent-based+optimization+of+eukaryotic+membrane+protein+overexpression+and+purification+in+Saccharomyces+cerevisiae.">High-throughput fluorescent-based optimization of eukaryotic membrane protein overexpression and purification in Saccharomyces cerevisiae.</a> Proc Natl Acad Sci U S A. 104 (35), 13936-13941 (2007).</li><li>Busso, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+protein+complexes+using+multiple+Escherichia+coli+protein+co-expression+systems:+a+benchmarking+study.">Expression of protein complexes using multiple Escherichia coli protein co-expression systems: a benchmarking study.</a> J Struct Biol. 175 (2), 159-170 (2011).</li><li>Sonoda, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Benchmarking+membrane+protein+detergent+stability+for+improving+throughput+of+high-resolution+X-ray+structures.">Benchmarking membrane protein detergent stability for improving throughput of high-resolution X-ray structures.</a> Structure. 19 (1), 17-25 (2011).</li><li>Low, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+analytical+gel+filtration+screening+of+integral+membrane+proteins+for+structural+studies.">High-throughput analytical gel filtration screening of integral membrane proteins for structural studies.</a> Biochim Biophys Acta. 1830 (6), 3497-3508 (2013).</li></ol>

The authors have nothing to disclose.

이 문서에서 설명하는 프로토콜에서 GFP 기자 벡터에 결찰 독립적 인 복제는 빠르게 E. 여러 막 단백질의 상대적 표현을 화면에 형광 검출과 결합 대장균. 벡터는 일차 식의 검사가 추가 주 복용 네 일에 할 수있다. 에 - 겔 전체 세포의 세제 용 해물의 형광 발현이 보조 화면에 추가 분석을 위해 히트 순위하는 데 사용됩니다. 제시된 주요 표현 화면이 떨어져 깊은 우물 블록 세포 성장에 적합한 진탕 배양기에서 어떤 전문 장비를 필요로하지 않습니다. SBS 96 웰 플레이트를 포함하는 모든 다른 액체 취급 멀티 채널 피펫을 이용하여 수행 될 수있다. 프로토콜은 용이하게 다른 표정 조건 (예, 저온) 하에서 성장 다른 E. 콜라이 균주를 포함하도록 수정 될 수있다. 람 노스의 수준을 적정 LEMO21 (DE3)의 경우 (0 내지 2.0 mM의)몇몇 막 단백질 (7)의 발현 수준을 증가시킬 수 전사 속도를 조절하기 위해 추가. 가혹한 세제 봉입체에서 단백질을 용해하기 때문에 오탐 (false positive)을 줄 수 있지만 DDM 이외의 세제는 기본 화면에 추출에 사용될 수 있습니다. 분명히, 더 초기 화면이 정교하게, 더 많은 시간이 소요되는 실험. 보조 화면은 기본 화면에서 식별 식 히트로부터 총 막 분획을 제조하는 것을 포함한다. 이는 E.의 막 융합 단백질의 위치 파악을 확인하므로 중요한 단계 대장균 세포. 다른 세제에서 GFP 융합 단백질의 후속 추출 세제 - 단백질 복합체의 모노 - 분산도를 평가하기 위해 가용화 된 물질의 형광 검출 된 크기 배제 크로마토 그래피에 의해 모니터링된다. 그것을위한 가장 적합한 세제를 식별 때문에 다른 중요한 단계후속 처리를 위해 하류 세포막 단백질의 가용화. 그러나 경험은 세제 (들)의 선택의 더 최적화가 아직 정제 및 결정화하는 동안 필요한 될 수 있음을 보여줍니다. 상대적으로 작은 미셀 크기 (예 : LDAO)를 포함 해 다른 세제의 균일 한 행동의 증거는 적어도 원핵 생물의 막 단백질 (14)에 대한 결정을 회절 잘 형성하는 성향의 좋은 지표가 될 것으로 보인다. 이러한 점에서도 2B에 세포막 단백질 위해 도시 프로파일 매우 유리한 나타난다. GFP 리포터를 사용하는 중요한 장점은 정제되지 않은 샘플에서의 발현의 빠른 판독을 제공한다는 것이다. 단점은 GFP 융합 단백질은 결정화를위한 단백질의 정제 동안 제거되어야한다는 것이다. 여기에 사용 된 벡터의 경우 리노 바이러스 3C 프로테아제 사이트 GFP의 절단을 가능하게한다. 대안으로, 간단만 이후 정제 폴리 히스티딘 또는 다른 친 화성 태그를 추가 벡터에 화면에서 확인 된 후보 단백질, 클론을 다시합니다. 이 GFP에 융합 발현에 필요하지 않다고 가정합니다. 막 단백질 발현 및 가용화 검색에 GFP를 융합에 사용하는 주요 대안은 히스티딘 태그를 추가하는 것이다. 그러나 이러한 접근법은 전형적으로 다수의 변형 평가를 위해 매우 시간이 소모 될 것이다 막 분획 (15)으로 시작 요구한다. 요약하면,이 문서에서 설명하는 프로토콜의 주요 목적은 세포막 단백질 서열의 다수 신속 발현 및 세제 용해의 측면에서 평가 깊은 분석을 위해 우선 순위가되도록 변형 가능하게하는 것이다.

이는 멤브레인 단백질이 인간 게놈을 비롯한 모든 게놈 서열 1에서 코딩하는 유전자의 약 20 ~ 30 %를 차지하고있는 것으로 추정되었다. 약물 표적 대사, 에너지 생성의 예를 수송하고 많은 생물학적 과정에서의 중요한 역할을 감안할 때, 자신의 세 차원 구조를 결정하는 데 큰 관심이있다. 그러나 수용성 단백질과 비교하여, 막 단백질은 고도로 언더 나타내는 단백질 데이터 뱅크에있다. 사실, PDB (에서 99,624 출시 구조의 <a href="http://www.rcsb.org/pdb/">http://www.rcsb.org/pdb/</a> ) 만 471 ( <a href="http://blanco.biomol.uci.edu/mpstruc/">http://blanco.biomol.uci.edu/mpstruc/</a> ) 막 단백질로 분류됩니다. 이것은 자연적으로 상대적으로 낮은 수준으로 발현되는 막 단백질 작업의 기술적 어려움을 반영; 로돕신은 몇 가지 예외를 제외하고 3,4 중 하나입니다. 재조합 버전의 과발현이종 세포에서의 생산은 종종 전체 레벨을 제한 막 미스 폴딩 타겟팅 불량을 초래한다. 한 번 표현 막 단백질의 추출 및 가용화에 가장 적합한 세제를 선택하면 이후의 정화가 어렵고 조심 최적화가 필요합니다. 대장균은 72 % (차지 막 단백질에 대한 가장 일반적으로 사용되는 발현 숙주 남아 <a href="http://blanco.biomol.uci.edu/mpstruc/">http://blanco.biomol.uci.edu/mpstruc/</a> 세균 출처 거의 독점적 최신인지 해결 구조). 특정 E. 콜라이 균주 C41 (DE3) 및 C43 (DE3)은, 막 단백질의 과발현을 유도하고, 따라서 다른 BL21 관찰 독성 5,6 균주 효과를 피하기 있지 않은 고립되었다. 재조합 막 단백질 발현 수준을 조정하는 것은 생산 6,7의 레벨을 최적화하는 중요한 것으로 보인다. 6-8을 악용하기 위해 여러 orthologues을 포함하여 여러 버전의 평가를 요구하고있다. 따라서, 병렬로 복수의 막 단백질의 발현을 스크리닝하는 방법이 필수적이다. 한가지 일반적으로 사용되는 방법은 단백질을 정제 할 필요없이 추적 할 녹색 형광 단백질 (GFP)을 발현 가능 단백질을 융합한다. 이러한 방식으로, 다른 세제에서의 발현 수준의 안정성 및 행동에 관한 정보는 비 - 정제 된 물질 9-12 소량으로 평가 될 수있다. 이 문서에서 우리는 E.에서 막 단백질의 클로닝 및 발현 검사에 대한 간소화 된 프로토콜을 설명 대장균은 생산 및 세제의 후속 특성의 기자로 GFP 융합을 사용하여 : 단백질 빌려lexes (그림 1).

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Name of Material</td>
			<td>Company</td>
			<td>Catalog Number</td>
		</tr>
		<tr>
			<td>pOPIN-N-GFP</td>
			<td>addgene (www.addgene.org)</td>
			<td></td>
		</tr>
		<tr>
			<td>pOPINE-3C-GFP</td>
			<td>addgene (www.addgene.org)</td>
			<td></td>
		</tr>
		<tr>
			<td>C41(DE3)pLysS</td>
			<td>Lucigen (http://lucigen.com/</td>
			<td>60444-1</td>
		</tr>
		<tr>
			<td>LEMO21(DE3)</td>
			<td>New England Biolabs</td>
			<td>C2528H</td>
		</tr>
		<tr>
			<td>In-Fusion HD EcoDry Cloning System, 96 Rxns</td>
			<td>Clontech/Takara</td>
			<td>639688</td>
		</tr>
		<tr>
			<td>Power broth</td>
			<td>Molecular Dimensions (http://www.moleculardimensions.com/)</td>
			<td>MD12-106-1</td>
		</tr>
		<tr>
			<td>Protease Inhibitor tablets</td>
			<td>Roche</td>
			<td>11697498001</td>
		</tr>
		<tr>
			<td>cOmplete, Mini, EDTA-Free; Protease Inhibitor Cocktail&#160;</td>
			<td>Roche</td>
			<td>11836170001</td>
		</tr>
		<tr>
			<td>L-Rhamnose monohydrate</td>
			<td>Sigma-Aldrich</td>
			<td>83650</td>
		</tr>
		<tr>
			<td>Protease Inhibitor Cocktail&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>P8849</td>
		</tr>
		<tr>
			<td>DNAse 1</td>
			<td>Sigma-Aldrich</td>
			<td>DN25</td>
		</tr>
		<tr>
			<td>Lysozyme</td>
			<td>Sigma-Aldrich</td>
			<td>L7651</td>
		</tr>
		<tr>
			<td>Cholesterol hemisuccinate</td>
			<td>Sigma-Aldrich</td>
			<td>C6512</td>
		</tr>
		<tr>
			<td>CYMAL-6 ( 6-Cyclohexyl-1-Hexyl-&#946;-D-Maltoside)</td>
			<td>Anatrace</td>
			<td>C326</td>
		</tr>
		<tr>
			<td>DDM ( n-Dodecyl &#223;-maltoside )</td>
			<td>Generon</td>
			<td>D97002</td>
		</tr>
		<tr>
			<td>DM (n-Decyl &#223;-maltoside)</td>
			<td>Generon</td>
			<td>D99003</td>
		</tr>
		<tr>
			<td>LDAO ( N,N-Dimethyl-n-dodecylamine N-oxide)</td>
			<td>Generon</td>
			<td>D71111</td>
		</tr>
		<tr>
			<td>E1 ClipTip Eq384 8 channel 1-30 ul&#160;</td>
			<td>Thermo Scientific&#160;</td>
			<td>4672030</td>
		</tr>
		<tr>
			<td>Rainin Pipette Pipet-Lite XLS 6ch 100-1200&#181;L LTS Spacer</td>
			<td>Anachem</td>
			<td>LA6-300XLS</td>
		</tr>
		<tr>
			<td>Rainin Pipette Light XLS+ 8ch 2-20&#181;L LTS</td>
			<td>Anachem</td>
			<td>L8-20XLSPLUS</td>
		</tr>
		<tr>
			<td>Pipette Pipet-Lite XLS 8ch 100-1200&#181;L LTS Tip</td>
			<td>Anachem</td>
			<td>L8-1200XLS</td>
		</tr>
		<tr>
			<td>24 well V bottom deep well blocks</td>
			<td>Porvair sciences</td>
			<td>360115</td>
		</tr>
		<tr>
			<td>BenchMark Fluorescent Protein Standard</td>
			<td>Life Technologies</td>
			<td>LC5928</td>
		</tr>
		<tr>
			<td>NuPAGE Novex 10% Bis-Tris Midi Protein Gels, 26 well</td>
			<td>Life Technologies</td>
			<td>WG1203BOX</td>
		</tr>
		<tr>
			<td>XCell4 SureLock Midi-Cell</td>
			<td>Life Technologies</td>
			<td>WR0100</td>
		</tr>
		<tr>
			<td>Vibramax 100</td>
			<td>Heidolph</td>
			<td>544-21200-00</td>
		</tr>
		<tr>
			<td>Tension rollers attachment</td>
			<td>Heidolph</td>
			<td>549-81000-00</td>
		</tr>
		<tr>
			<td>ptima L-100 Ultracentrifuge running 45-Ti rotor</td>
			<td>Beckman Coulter</td>
			<td>393253</td>
		</tr>
		<tr>
			<td>Optima Max-XP ultracentrifuge running TLA-55 rotor</td>
			<td>Beckman Coulter</td>
			<td>393315</td>
		</tr>
		<tr>
			<td>Floor standing centrifuge, Avanti J-26S XPI running JA-17 and JS-5.3 rotors&#160;</td>
			<td>Beckman Coulter</td>
			<td>B14535</td>
		</tr>
		<tr>
			<td>Prominence UFLC with RF-20A Fluorescence detector</td>
			<td>Shimadzu</td>
			<td></td>
		</tr>
		<tr>
			<td>Sepharose 6 10/300 GL size exclusion column</td>
			<td>GE Healthcare</td>
			<td>17-5172-01&#160;</td>
		</tr>
		<tr>
			<td>SSI5R-HS SHEL LAB Floor Model Shaking Incubator, 5 Cu.Ft. (144 L), 30-850 RPMs</td>
			<td>Shel Lab&#160;</td>
			<td>SSI5R-HS</td>
		</tr>
		<tr>
			<td>Innova44R incubator</td>
			<td>New Brunswick /Eppendorf</td>
			<td>Innova44R</td>
		</tr>
		<tr>
			<td>TS SERIES 0.75KW DISRUPTER 230V 50HZ 1PH (40KPSI)</td>
			<td>Constant systems</td>
			<td>PL083016</td>
		</tr>
		<tr>
			<td>L-Rhamnose monohydrate</td>
			<td>Sigma</td>
			<td>83650</td>
		</tr>
	</tbody>
</table>

green fluorescent protein-based expression screening of membrane proteins in escherichia coli

구조적 및 기능적 연구를위한 재조합 막 단백질의 생산으로 인해 낮은 수준의 발현과 한번 세제 가용화 많은 막 단백질의 고유 한 불안정성 기술적 도전 남아있다. 프로토콜은 GFP의 형광에 의해 검출 된 대장균에서 발현와 GFP 융합으로 막 단백질의 결찰 독립적 인 복제를 결합한 기술되어있다. 이것은 다수의 세포막 단백질의 구조와 식 스크리닝 / 시간과 노력을 투자를 더욱 적합한 후보를 식별 할 수 있도록 변형. GFP 리포터는 SDS 폴리 아크릴 아미드 겔 전기 영동 (SDS-PAGE) 다음 GFP 형광을 시각화하여 표현의 기본 화면에서 사용된다. 자유 GFP의 부재에 의해 지시 된 바와 같이 최소한의 손실로 높은 발현 수준을 모두 보여 막 단백질은, 보조 스크린으로 선정된다. 이러한 구조는 스케일링 총 막 분획을 제조하고, 가용화되고네 가지 세제의 D. 세제 불용성 물질을 제거하는 초 원심 이어 해물 형광 검출 크기 배제 크로마토 그래피 (FSEC)에 의해 분석된다. GFP 형광에 의해 크기 배제 프로파일 모니터링 다른 세제의 막 단백질의 모노 - 분산도 및 무결성에 대한 정보를 제공한다. 단백질 : 거의 또는 전혀없는 GFP 및 최소 집계와 대칭 피크 용출 세제 조합은 이후 정제를위한 후보입니다. 위의 방법, E.의 이종 표현을 사용하여 SED (모양, 신장, 분할 및 포자 형성) 박테리아의 47 종에서 단백질의 대장균을 분석 하였다. 이들 단백질은 일반적으로 열 경막 도메인을 가지며 세포 분열에 필수적인. 결과는 보여 그 E.에서 SED는의 orthologues의 생산 대장균은 GFP 융합 단백질의 발현 수준에 대하여 정직하게 매우 가변적이다. 실험 전추가 조사를 위해 일부를 dentified.

단백질 (모양, 신장, 분할 및 포자 형성)의 SED는 제품군은 박테리아 세포 분열에 필수적이다. 이 필수적인 단백질은 일반적으로 세포 내부 모두 아미노산과 카르복시 말단에 열 횡단 도메인을 가지고있다. 전술 한 프로토콜을 예시하기 위해 47의 SED는 orthologues는 벡터 pOPINE-3C-eGFP는 내로 클로닝 하였다. 구조의 소규모 발현 화면 개의 E .coli 균주 행했다, 0.25 mM의 존재하에 성장 Lemo21 (DE3)는 일상적 막의 발현에 사용되는 누설 발현 및 C41 (DE3) pLysS 균주를 차단할 람노 단백질 5-8. 유도 배양 세제의 가용화 용 해물은 SDS 폴리 아크릴 아미드 전기 영동으로 분석 하였다. 겔의 형광을 사용하여 표현 GFP 융합 단백질은 47 SED는 구조체 중 38 개의 균주 사이 제작했다 시각화하는 것으로 나타났다. 흥미롭게도 두 발현 균주의 차이가 있었다. (38) 구조를 표현 중 단지 18 두 균주 만 만 C41 (DE3) pLysS를에 Lemo21 (DE3)와 (6)으로 표현 (14)에서 생산되었다. 전반적으로, C41 (DE3) pLysS를 (24 대 38)에 비해 Lemo21 (DE3)에 대한 높은 성공률이 있었다. 그러나 일부 단백질이 변형 구체적으로 나타난 관찰은 모두 선별하는 것이 유용하다는 것을 의미한다. (47) 또한 SED 24 대표적인 데이터 구조는도 1에 도시되어있다. 밴드의 강도는, 상기 두 균주에서 잘 추가적인 표현 예도 1a 및도 1b에 잘 C4의 융합 단백질 발현 수준의 지표를 제공한다 저 분자량의 밴드는 부분적으로 분해 된 단백질임을 시사한다. 많은 차선에서 혼자 GFP에 크기에 해당하는 밴드가있다. 단백질의 무결성의 질적 평가를 무료로 GFP 융합 단백질의 상대적 강도를보고에 의해 수행 될 수있다;예 G4 및 H4 완전히 일부 손상 단백질 (그림 1A)이있다 Lemo21 (DE3)에있는 반면, C41 (DE3) pLysS를 (그림 1B)에서 무료로 GFP로 분류됩니다. (38) 발현 단백질 중 14 무료 GFP의 밴드의 강도는 (자유 GFP 대역의 세기는 융합 단백질과 융합 단백질의 소수의보다 큰 (21), (3) 융합 단백질의 것과 유사 / 38) 표현 예 F6 그림 1A에서 G6는 융합 단백질에 비해 상대적으로 작은 무료 GFP가있다. 과 G6 (작은 무료 GFP) 표현되었다 500 ml의 세포 배양에서 제조 된 총 막 분획 (무료 GFP와 융합 단백질에 대한 강도 높은 대역) 기본 화면 B5에서 잘 표현 된 구조의 두 가지. 재현 탁 멤브레인 분액으로 나누어 형광 감지 된 크기 배제 크로마토 그래피 (FSEC)로 분석 하였다. FSEC 프로파일은 Figur에 제시되어있다E 2a 및도 2b는 각각 및 SED는 두 단백질 테스트 사 세제에 다르게 행동을 보여준다. 한 경우 (그림 2 A : 샘플 B5)은 단백질은 따라서 이후의 정화에 대한 선택의 세제 것 DDM에 약간의 집계와 대칭 피크를했다. 반면 다른 융합 단백질에 의해 (그림 2B : 샘플 G6)는 테스트 한 모든 세제에 유사한 프로필을했다. <img alt="그림 1" src="/files/ftp_upload/52357/52357fig1highres.jpg" width="700px" /> 그림 1 : E.에서 막 단백질 발현을 선별 워크 플로 다이어그램 대장균은 GFP 기자를 사용하여. <img alt="그림 2" src="/files/ftp_upload/52357/52357fig2highres.jpg" /> 그림 2 :에 - 겔 형광을 이용하여 막 단백질 발현의 기본 화면. </strongE.의&gt; 세제 해물 콜라이 SDS-PAGE로 분석 하였다 세포 및 겔 블루 에피 조명 및 28분의 530 필터를 사용하여 몇 군데. 결과는 (96 웰 플레이트에서의 위치에 따라 A4-H6 표시) (24) 구조에 대한 표시됩니다. 자유 GFP 및 GFP 융합 단백질 밴드의 위치가 표시된다. Lemo21 (DE3). (B) C41 (DE3) pLysS 균주에서 발현 된 단백질에서 발현 (A)을 단백질. <img alt="그림 3" src="/files/ftp_upload/52357/52357fig3highres.jpg" /> 도 3 :. 세포막 단백질 발현의 보조 화면 형광 감지 된 크기 배제 크로마토 그래피 (FSEC)를 사용하여 총 막 분획 4 개의 다른 세제 추출하고, 가용화 된 막 단백질은 형광 검출기에 결합 FPLC 시스템을 사용하여 크기 배제 크로마토 그래피로 분석 하였다. FSEC 대한 프로파일 (A) 막 단백질 및 B5 (B) </strong&gt; 막 단백질 G6. 응집 된 단백질 가용화 GFP 융합 단백질 및 무료 GFP에 대응 피크의 위치가 표시되어있다. 테스트 세제는 프로필 아래에 표시됩니다.

Watch this Scientific Journal Video about Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli at JoVE.com

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

녹색 형광 단백질에 융합을 기반으로 대장균에서 재조합 막 단백질의 발현에 대한 심사에 대한 효율적인 접근 방법이 제시된다.

막 단백질의 녹색 형광 단백질 기반의 표현 상영에<em&gt; 대장균</em

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and ...

green-fluorescent-protein-based-expression-screening-membrane

Research

JoVE Journal

Biology

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

32.4K 조회수.  Research Complex at Harwell.  녹색 형광 단백질에 융합을 기반으로 대장균에서 재조합 막 단백질의 발현에 대한 심사에 대한 효율적인 접근 방법이 제시된다. 

비디오: Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Staining of Proteins in Gels with Coomassie G-250 without Organic Solvent and Acetic Acid

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents (Methanol, Ethanol or 2-Propanol) and acetic acid are used for fixation, staining and destaining of proteins in a gel after SDS-PAGE. To speed up the procedure, heating the staining solution in the microwave oven for a short time is frequently used. This usually results in evaporation of toxic or hazardous Methanol, Ethanol or 2-Propanol and a strong smell of acetic acid in the lab which should be avoided due to safety considerations. In a protocol originally published in two patent applications by E.M. Wondrak (US2001046709 (A1), US6319720 (B1)), an alternative composition of the staining solution is described in which no organic solvent or acid is used. The CBB is dissolved in bidistilled water (60-80mg of CBB G-250 per liter) and 35 mM HCl is added as the only other compound in the staining solution. The CBB staning of the gel is done after SDS-PAGE and thorough washing of the gel in bidistilled water. By heating the gel during the washing and staining steps, the process can be finished faster and no toxic or hazardous compunds are evaporating. The staining of proteins occurs already within 1 minute after heating the gel in staining solution and is fully developed after 15-30 min with a slightly blue background that is destained completely by prolonged washing of the stained gel in bidistilled water, without affecting the stained protein bands.

A short protocol for protein staining with Coomassie Brilliant Blue (CBB) G-250 in polyacrylamide gels is described without using organic solvents or acetic acid as in the classical staining procedures with CBB.

유기 용매 및 초산없이 쿠매시 G - 250로 젤의 단백질 염색법

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents ...

연구

생물학

An Assay for Measuring the Activity of Escherichia coli Inducible Lysine Decarboxyase

Escherichia coli is an enteric bacterium that is capable of growing over a wide range of pH values (pH 5 - 9)1 and, incredibly, is able to survive extreme acid stresses including passage through the mammalian stomach where the pH can fall to as low as pH 1 - 22. To enable such a broad range of acidic pH survival, E. coli possesses four different inducible amino acid decarboxylases that decarboxylate their substrate amino acids in a proton-dependent manner thus raising the internal pH. The decarboxylases include the glutamic acid decarboxylases GadA and GadB3, the arginine decarboxylase AdiA4, the lysine decarboxylase LdcI5, 6 and the ornithine decarboxylase SpeF7. All of these enzymes utilize pyridoxal-5'-phospate as a co-factor8 and function together with inner-membrane substrate-product antiporters that remove decarboxylation products to the external medium in exchange for fresh substrate2. In the case of LdcI, the lysine-cadaverine antiporter is called CadB. Recently, we determined the X-ray crystal structure of LdcI to 2.0 &#197;, and we discovered a novel small-molecule bound to LdcI the stringent response regulator guanosine 5'-diphosphate,3'-diphosphate (ppGpp) 14. The stringent response occurs when exponentially growing cells experience nutrient deprivation or one of a number of other stresses9. As a result, cells produce ppGpp which leads to a signaling cascade culminating in the shift from exponential growth to stationary phase growth10. We have demonstrated that ppGpp is a specific inhibitor of LdcI 14. Here we describe the lysine decarboxylase assay, modified from the assay developed by Phan et al.11, that we have used to determine the activity of LdcI and the effect of pppGpp/ppGpp on that activity. The LdcI decarboxylation reaction removes the &alpha;-carboxy group of L-lysine and produces carbon dioxide and the polyamine cadaverine (1,5-diaminopentane)5. L-lysine and cadaverine can be reacted with 2,4,6-trinitrobenzensulfonic acid (TNBS) at high pH to generate N,N'-bistrinitrophenylcadaverine (TNP-cadaverine) and N,N&#8242;-bistrinitrophenyllysine (TNP-lysine), respectively11. The TNP-cadaverine can be separated from the TNP-lysine as the former is soluble in organic solvents such as toluene while the latter is not (See Figure 1). The linear range of the assay was determined empirically using purified cadaverine.

An Assay for Measuring the Activity of Escherichia coli Inducible Lysine Decarboxyase

The activity of the inducible lysine decarboxylase is monitored by reacting the substrate L-lysine and the product cadaverine with 2,4,6-trinitrobenzensulfonic acid to form adducts that have differential solubility in toluene.

의 활동을 측정하는 어세이 대장균은 라이신 Decarboxyase을 Inducible

Escherichia coli is an enteric bacterium that is capable of growing over a wide range of pH values (pH 5 - 9)1 and, incredibly, is able to survive extreme ...

Crystallization of Membrane Proteins in Lipidic Mesophases

Membrane proteins perform critical functions in living cells related to signal transduction, transport and energy transformations, and, as such, are implicated in a multitude of malfunctions and diseases. However, a structural and functional understanding of membrane proteins is strongly lagging behind that of their soluble partners, mainly, due to difficulties associated with their solubilization and generation of diffraction quality crystals. Crystallization in lipidic mesophases (also known as in meso or LCP crystallization) is a promising technique which was successfully applied to obtain high resolution structures of microbial rhodopsins, photosynthetic proteins, outer membrane beta barrels and G protein-coupled receptors. In meso crystallization takes advantage of a native-like membrane environment and typically produces crystals with lower solvent content and better ordering as compared to traditional crystallization from detergent solutions. The method is not difficult, but requires an understanding of lipid phase behavior and practice in handling viscous mesophase materials. Here we demonstrate a simple and efficient way of making LCP and reconstituting a membrane protein in the lipid bilayer of LCP using a syringe mixer, followed by dispensing nanoliter portions of LCP into an assay or crystallization plate, conducting pre-crystallization assays and harvesting crystals from the LCP matrix. These protocols provide a basic guide for approaching in meso crystallization trials; however, as with any crystallization experiment, extensive screening and optimization are required, and a successful outcome is not necessarily guaranteed.

The protocols describe the essential steps for obtaining diffraction quality crystals of a membrane protein starting from reconstitution of the protein in a lipidic cubic phase (LCP), finding initial conditions with LCP-FRAP pre-crystallization assays, setting up LCP crystallization trials and harvesting crystals.

Lipidic Mesophases의 막 단백질의 결정화

Membrane proteins perform critical functions in living cells related to signal transduction, transport and energy transformations, and, as such, are ...

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

Cellulase enzymes (endoglucanases, cellobiohydrolases, and &beta;-glucosidases) hydrolyze cellulose into component sugars, which in turn can be converted into fuel alcohols1. The potential for enzymatic hydrolysis of cellulosic biomass to provide renewable energy has intensified efforts to engineer cellulases for economical fuel production2. Of particular interest are fungal cellulases3-8, which are already being used industrially for foods and textiles processing.
Identifying active variants among a library of mutant cellulases is critical to the engineering process; active mutants can be further tested for improved properties and/or subjected to additional mutagenesis. Efficient engineering of fungal cellulases has been hampered by a lack of genetic tools for native organisms and by difficulties in expressing the enzymes in heterologous hosts. Recently, Morikawa and coworkers developed a method for expressing in E. coli the catalytic domains of endoglucanases from H. jecorina3,9, an important industrial fungus with the capacity to secrete cellulases in large quantities. Functional E. coli expression has also been reported for cellulases from other fungi, including Macrophomina phaseolina10 and Phanerochaete chrysosporium11-12. 
We present a method for high throughput screening of fungal endoglucanase activity in E. coli. (Fig 1) This method uses the common microbial dye Congo Red (CR) to visualize enzymatic degradation of carboxymethyl cellulose (CMC) by cells growing on solid medium. The activity assay requires inexpensive reagents, minimal manipulation, and gives unambiguous results as zones of degradation (&#x201C;halos&#x201D;) at the colony site. Although a quantitative measure of enzymatic activity cannot be determined by this method, we have found that halo size correlates with total enzymatic activity in the cell. Further characterization of individual positive clones will determine , relative protein fitness. 
Traditional bacterial whole cell CMC/CR activity assays13 involve pouring agar containing CMC onto colonies, which is subject to cross-contamination, or incubating cultures in CMC agar wells, which is less amenable to large-scale experimentation. Here we report an improved protocol that modifies existing wash methods14 for cellulase activity: cells grown on CMC agar plates are removed prior to CR staining. Our protocol significantly reduces cross-contamination and is highly scalable, allowing the rapid screening of thousands of clones. In addition to H. jecorina enzymes, we have expressed and screened endoglucanase variants from the Thermoascus aurantiacus and Penicillium decumbens (shown in Figure 2), suggesting that this protocol is applicable to enzymes from a range of organisms.

High Throughput Screening of Fungal Endoglucanase Activity in Escherichia coli

We describe a low cost, high throughput method to screen for fungal endoglucanase activity in E. coli. The method relies on a simple visual readout of substrate degradation, does not require enzyme purification, and is highly scalable. This allows for the rapid screening of large libraries of enzyme variants.

에서 곰팡이 Endoglucanase 활동의 높은 처리량 검사 대장균</em

Cellulase enzymes (endoglucanases, cellobiohydrolases, and &beta;-glucosidases) hydrolyze cellulose into component sugars, which in turn can be converted ...

Use of a Robot for High-throughput Crystallization of Membrane Proteins in Lipidic Mesophases

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through macromolecular X-ray crystallography (MX). An essential ingredient of MX is a steady supply of ideally diffraction-quality crystals. The in meso or lipidic cubic phase (LCP) method for crystallizing membrane proteins is one of several methods available for crystallizing membrane proteins. It makes use of a bicontinuous mesophase in which to grow crystals. As a method, it has had some spectacular successes of late and has attracted much attention with many research groups now interested in using it. One of the challenges associated with the method is that the hosting mesophase is extremely viscous and sticky, reminiscent of a thick toothpaste. Thus, dispensing it manually in a reproducible manner in small volumes into crystallization wells requires skill, patience and a steady hand. A protocol for doing just that was developed in the Membrane Structural &amp; Functional Biology (MS&amp;FB) Group1-3. JoVE video articles describing the method are available1,4. 
The manual approach for setting up in meso trials has distinct advantages with specialty applications, such as crystal optimization and derivatization. It does however suffer from being a low throughput method. Here, we demonstrate a protocol for performing in meso crystallization trials robotically. A robot offers the advantages of speed, accuracy, precision, miniaturization and being able to work continuously for extended periods under what could be regarded as hostile conditions such as in the dark, in a reducing atmosphere or at low or high temperatures. An in meso robot, when used properly, can greatly improve the productivity of membrane protein structure and function research by facilitating crystallization which is one of the slow steps in the overall structure determination pipeline. 
In this video article, we demonstrate the use of three commercially available robots that can dispense the viscous and sticky mesophase integral to in meso crystallogenesis. The first robot was developed in the MS&amp;FB Group5,6. The other two have recently become available and are included here for completeness.	
An overview of the protocol covered in this article is presented in Figure 1. All manipulations were performed at room temperature (~20 &deg;C) under ambient conditions.

Herein is described a robotic approach to high-throughput crystallization of membrane proteins in lipidic mesophases for use in structure determination using macromolecular X-ray crystallography. Three robots capable of handling the viscous and sticky protein-laden mesophase integral to the method are introduced.

Lipidic Mesophases의 막 단백질의 높은 처리량을 결정하기위한 로봇의 사용

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through ...

Intravital Microscopy for Imaging Subcellular Structures in Live Mice Expressing Fluorescent Proteins

Here we describe a procedure to image subcellular structures in live rodents that is based on the use of confocal intravital microscopy. As a model organ, we use the salivary glands of live mice since they provide several advantages. First, they can be easily exposed to enable access to the optics, and stabilized to facilitate the reduction of the motion artifacts due to heartbeat and respiration. This significantly facilitates imaging and tracking small subcellular structures. Second, most of the cell populations of the salivary glands are accessible from the surface of the organ. This permits the use of confocal microscopy that has a higher spatial resolution than other techniques that have been used for in vivo imaging, such as two-photon microscopy. Finally, salivary glands can be easily manipulated pharmacologically and genetically, thus providing a robust system to investigate biological processes at a molecular level.
In this study we focus on a protocol designed to follow the kinetics of the exocytosis of secretory granules in acinar cells and the dynamics of the apical plasma membrane where the secretory granules fuse upon stimulation of the beta-adrenergic receptors. Specifically, we used a transgenic mouse that co-expresses cytosolic GFP and a membrane-targeted peptide fused with the fluorescent protein tandem-Tomato. However, the procedures that we used to stabilize and image the salivary glands can be extended to other mouse models and coupled to other approaches to label in vivo cellular components, enabling the visualization of various subcellular structures, such as endosomes, lysosomes, mitochondria, and the actin cytoskeleton.

Intravital microscopy is a powerful tool that enables imaging various biological processes in live animals. In this article, we present a detailed method for imaging the dynamics of subcellular structures, such as the secretory granules, in the salivary glands of live mice.

형광 단백질을 표현 라이브 마우스의 이미징 세포 이하의 구조물의 intravital 현미경

Here we describe a procedure to image subcellular structures in live rodents that is based on the use of confocal intravital microscopy. As a model organ, ...

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for expressing proteins and genetic circuits in a controlled manner as well as for providing a prototyping environment for synthetic biology.2,3 To achieve the latter goal, cell-free expression systems that preserve endogenous Escherichia coli transcription-translation mechanisms are able to more accurately reflect in vivo cellular dynamics than those based on T7 RNA polymerase transcription. We describe the preparation and execution of an efficient endogenous E. coli based transcription-translation (TX-TL) cell-free expression system that can produce equivalent amounts of protein as T7-based systems at a 98% cost reduction to similar commercial systems.4,5 The preparation of buffers and crude cell extract are described, as well as the execution of a three tube TX-TL reaction. The entire protocol takes five days to prepare and yields enough material for up to 3000 single reactions in one preparation. Once prepared, each reaction takes under 8 hr from setup to data collection and analysis. Mechanisms of regulation and transcription exogenous to E. coli, such as lac/tet repressors and T7 RNA polymerase, can be supplemented.6 Endogenous properties, such as mRNA and DNA degradation rates, can also be adjusted.7 The TX-TL cell-free expression system has been demonstrated for large-scale circuit assembly, exploring biological phenomena, and expression of proteins under both T7- and endogenous promoters.6,8 Accompanying mathematical models are available.9,10 The resulting system has unique applications in synthetic biology as a prototyping environment, or "TX-TL biomolecular breadboard."

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

This five-day protocol outlines all steps, equipment, and supplemental software necessary for creating and running an efficient endogenous Escherichia coli based TX-TL cell-free expression system from scratch. With reagents, the protocol takes 8 hours or less to setup a reaction, collect, and process data.

구현을위한 프로토콜<em&gt; 대장균</em합성 생물학&gt;을 바탕으로 TX-TL의 무 세포 발현 시스템

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for ...

High Throughput Quantitative Expression Screening and Purification Applied to Recombinant Disulfide-rich Venom Proteins Produced in E. coli

Escherichia coli (E. coli) is the most widely used expression system for the production of recombinant proteins for structural and functional studies. However, purifying proteins is sometimes challenging since many proteins are expressed in an insoluble form. When working with difficult or multiple targets it is therefore recommended to use high throughput (HTP) protein expression screening on a small scale (1-4&#160;ml cultures) to quickly identify conditions for soluble expression. To cope with the various structural genomics programs of the lab, a quantitative (within a range of 0.1-100 mg/L culture of recombinant protein) and HTP protein expression screening protocol was implemented and validated on thousands of proteins. The protocols were automated with the use of a liquid handling robot but can also be performed manually without specialized equipment.
Disulfide-rich venom proteins are gaining increasing recognition for their potential as therapeutic drug leads. They can be highly potent and selective, but their complex disulfide bond networks make them challenging to produce. As a member of the FP7 European Venomics project (<a href="http://www.venomics.eu">www.venomics.eu</a>), our challenge is to develop successful production strategies with the aim of producing thousands of novel venom proteins for functional characterization. Aided by the redox properties of disulfide bond isomerase DsbC, we adapted our HTP production pipeline for the expression of oxidized, functional venom peptides in the E. coli cytoplasm. The protocols are also applicable to the production of diverse disulfide-rich proteins. Here we demonstrate our pipeline applied to the production of animal venom proteins. With the protocols described herein it is likely that soluble disulfide-rich proteins will be obtained in as little as a week. Even from a small scale, there is the potential to use the purified proteins for validating the oxidation state by mass spectrometry, for characterization in pilot studies, or for sensitive micro-assays.

High Throughput Quantitative Expression Screening and Purification Applied to Recombinant Disulfide-rich Venom Proteins Produced in E. coli

A protocol for the quantitative, high throughput expression screening and analytical purification of fusion proteins from small-scale Escherichia coli cultures is described and applied to the expression of disulfide-rich animal venom protein targets.

에서 생산 재조합 이황화 풍부한 독 단백질에 적용되는 높은 처리량 정량 식 검사 및 정화<em&gt; E. 대장균</em

Escherichia coli (E. coli) is the most widely used expression system for the production of recombinant proteins for structural and functional studies. ...

Non-chromatographic Purification of Recombinant Elastin-like Polypeptides and their Fusions with Peptides and Proteins from Escherichia coli

Elastin-like polypeptides are repetitive biopolymers that exhibit a lower critical solution temperature phase transition behavior, existing as soluble unimers below a characteristic transition temperature and aggregating into micron-scale coacervates above their transition temperature. The design of elastin-like polypeptides at the genetic level permits precise control of their sequence and length, which dictates their thermal properties. Elastin-like polypeptides are used in a variety of applications including biosensing, tissue engineering, and drug delivery, where the transition temperature and biopolymer architecture of the ELP can be tuned for the specific application of interest. Furthermore, the lower critical solution temperature phase transition behavior of elastin-like polypeptides allows their purification by their thermal response, such that their selective coacervation and resolubilization allows the removal of both soluble and insoluble contaminants following expression in Escherichia coli. This approach can be used for the purification of elastin-like polypeptides alone or as a purification tool for peptide or protein fusions where recombinant peptides or proteins genetically appended to elastin-like polypeptide tags can be purified without chromatography. This protocol describes the purification of elastin-like polypeptides and their peptide or protein fusions and discusses basic characterization techniques to assess the thermal behavior of pure elastin-like polypeptide products.

Non-chromatographic Purification of Recombinant Elastin-like Polypeptides and their Fusions with Peptides and Proteins from Escherichia coli

Elastin-like polypeptides are stimulus-responsive biopolymers with applications ranging from recombinant protein purification to drug delivery. This protocol describes the purification and characterization of elastin-like polypeptides and their peptide or protein fusions from Escherichia coli using their lower critical solution temperature phase transition behavior as a simple alternative to chromatography.

에서 펩타이드 및 단백질과 재조합 엘라스틴 같은 폴리 펩타이드 및 그 융해의 비 크로마토 그래피 정제<em&gt; 대장균</em

Elastin-like polypeptides are repetitive biopolymers that exhibit a lower critical solution temperature phase transition behavior, existing as soluble ...

The Multifaceted Benefits of Protein Co-expression in Escherichia coli

We report here that the expression of protein complexes in vivo in Escherichia coli can be more convenient than traditional reconstitution experiments in vitro. In particular, we show that the poor solubility of Escherichia coli DNA polymerase III &#949; subunit (featuring 3&#8217;-5&#8217; exonuclease activity) is highly improved when the same protein is co-expressed with the &#945; and &#952; subunits (featuring DNA polymerase activity and stabilizing &#949;, respectively). We also show that protein co-expression in E. coli can be used to efficiently test the competence of subunits from different bacterial species to associate in a functional protein complex. We indeed show that the &#945; subunit of Deinococcus radiodurans DNA polymerase III can be co-expressed in vivo with the &#949; subunit of E. coli. In addition, we report on the use of protein co-expression to modulate mutation frequency in E. coli. By expressing the wild-type &#949; subunit under the control of the araBAD promoter (arabinose-inducible), and co-expressing the mutagenic D12A variant of the same protein, under the control of the lac promoter (inducible by isopropyl-thio-&#946;-D-galactopyranoside, IPTG), we were able to alter the E. coli mutation frequency using appropriate concentrations of the inducers arabinose and IPTG. Finally, we discuss recent advances and future challenges of protein co-expression in E. coli.

The Multifaceted Benefits of Protein Co-expression in Escherichia coli

Protein co-expression is a powerful alternative to the reconstitution in vitro of protein complexes, and is of help in performing biochemical and genetic tests in vivo. Here we report on the use of protein co-expression in Escherichia coli to obtain protein complexes, and to tune the mutation frequency of cells.

단백질 공동 식의 다각적 인 장점에<em&gt; 대장균</em

We report here that the expression of protein complexes in vivo in Escherichia coli can be more convenient than traditional reconstitution experiments in ...