The work carried out in this study was supported in part by the Royal Veterinary College through the student research projects fund, as well as the Biotechnology and Biological Sciences Research Council and the Department for International Development (grant number BB/H009337/2). This manuscript has been assigned the reference PPB_00795 by the RVC.

1. 템플릿 준비 주 : 닭 감염 일곱 에이 메리아 종 중 하나로부터 유도 된 DNA를 포함하는 것으로 의심 상관 게놈 DNA 템플릿 LAMP 기반 에이 메리아 종 식별을위한 주형으로 사용될 수있다. 여기에 설명 된대로 필드 진단 분석을위한 장 조직 샘플 일상 사후 동안 수집해야합니다. <ol><li> 소장의 부분 (또는 섹션)을 선택 테스트 할 수 있습니다. 샘플 사이트 선택에 대한 안내 및 샘플링 사이트의 분포와 위치의 종 - 특정 범위의 18 현재와 그림 1이 될 가능성이 가장 높은 에이 메리아 종은 표 1을 참조하십시오. 참고 : 에이 메리아는 특히 호스트 사이트 특정 때문에이 키 중요하다. 닭을 감염 각각의 종은 (19)을 대상으로 장 지역에 따라 정의된다. 결정은 하나 미주리 이전 농장의 경험, 관심에 의해 영향을받을 수있다특정 에이 메리아 종 또는 다른 진단 지표 (6) 재. </li><li> 소비세 5cm 또는 메리아 멸균 가위 또는 메스를 사용하여 테스트하기 위해 선택한 장 섹션 (들)의 긴 길이. 선택적으로, 이러한 RNAlater 18 또는 95 % 에탄올 예를 들어 같은 고정액 후속 분석을 위해 샘플을 저장합니다. 참고 : 에탄올에 샘플을 저장하는 것은 멸균 트리스 에틸렌 디아민 테트라 아세트산 철저하게 세척 할 필요가있는 경우 (TE)를 사용하기 전에 버퍼. </li><li> , 길이 방향으로 열려있는 샘플을 잘라 무료 멸균 유리 현미경 슬라이드의 가장자리 또는 에탄올 / 화염 멸균 가위 블레이드를 사용하여 점막층에서 세포를 가장 장 내용을 제거 (있는 경우) 및 긁어. 선택적으로 풀링 된 샘플에 대한 단일 관에서 종 특이 장 사이트의 네에서 세포를 포함한다. </li><li> (1) 100 ㎕를 포함한 무균 TE 완충액을 함유하는 멸균 1.5 ㎖의 스크류 - 탑 마이크로 원심 분리 튜브로 긁어 담을0 % (W / V) 100 Chelex 수지. </li><li> 1 분 동안 격렬하게 각각의 샘플을 흔들어. 상부 덮개가 단단히 닫혀 있는지 확인하고 10 분간 끓는 물에 목욕에 품어. </li><li> 끓는 후 각각의 샘플 1 ~ 2 분 동안 상온에서 냉각 할 수 있습니다. </li><li> 원심 분리기 1 분 최고 속도 (예를 들어, ~ 10,000 XG)에서 마이크로 원심을 사용하여 각 샘플. </li><li> 각 LAMP 분석에서 템플릿을 수행 할 수 상층 액 2 μl를 수집합니다. 선택적으로, 다중 사이트 분석을 제공하기 위해 하나의 튜브에 두 개 이상의 사이트를 장내 수영장. </li></ol> 2. 에이 메리아 LAMP 프라이머 준비 (사전 분석) <ol><li> (100) 분석에 적합한 에이 메리아 LAMP 프라이머 주식을 준비합니다 <ol><li> (제조자에 의해 지정) 100 μM의 농도로 분자 수준의 물을 첨가하여 각 동결 건조 에이 메리아 LAMP 프라이머를 복원합니다. 지정되지 않은 경우, 분자 수준의 물 날기 필요한 부피를 계산g 각 프라이머의 물리적 및 분자량. </li><li> 각 에이 메리아 종에 대해 별도의 0.5 ml의 플립 - 탑 마이크로 원심 튜브에 피펫 60 μL 분자 수준의 물을 분석한다. </li><li> 추가 FIP 프라이머, BIP, F3, B3, 일곱 종 특이 프라이머 믹스를 만드는 일련의 표 2에 나타내는 양을 사용하여 물에 대한 목표 에이 메리아 종 특정 LF 및 LB. </li><li> 간단히 와동 후, 프라이머 용액을 혼합하고 미세 원심 펄스 필요까지 동결. </li></ol></li><li> 각 에이 메리아 종을 분석 할 수 있도록 LAMP 반응 mastermix를 준비합니다. 샘플의 개수에 의해 표 3에 나타낸 양을 곱하고 양성 대조군과 음성 대조군 피펫 스페어 세 추가. 0.5 또는 1.5 ml의 피펫 플립 탑 microcentrifuge 관을. </li></ol> 3. 에이 메리아 LAMP 분석 <ol><li> 피펫 23 μL 에이 메리아 종 별 BST DNA 중합 효소 / LAMP는 0으로 mastermix.5 ml의 microcentrifuge 관. </li><li> 25 μL의 최종 반응 볼륨을 만들고, (섹션 1에서 제조) 2 μL의 DNA 템플릿을 추가합니다. </li><li> 하나의 반응 (양성 대조군)에 2 μL 에이 메리아 종 고유의 게놈 DNA를 추가합니다. 반응 (대조군)에 2 μL를 분자 수준의 물을 추가합니다. 주 : 종 특이 게놈 DNA를 사용할 수없는 경우 또는 이전의 긍정적 LAMP 표준 PCR 산물 대신 사용될 수있다. </li><li> 30 분 동안 62 O C 수조 또는 열차 단 부화. 반응이 즉시 판독하지 않을 경우에 선택적으로 10 분 동안 80 O C로 가온하여 BST DNA 중합 효소를 탈 활성화. </li></ol> 4. LAMP 분석 판독 <ol><li> 배양의 결론에 실내 조명 아래 눈에 의해 각 반응의 색상을 평가합니다. 부정적인 결과, 긍정적 인 결과는 하늘 (20) 청색으로 색에 보라색 분홍색으로 나타납니다. </li><li> 선택적으로, LABORAT의 LAMP 분석 결과를 확인1 X 트리스 / 붕산염 / EDTA (TBE) 버퍼에 2 % 아가 로스 겔을 이용하여 아가 로스 겔 전기 영동 한 μL DNA 겔 로딩 완충액으로 5 μL LAMP 반응 생성물을 혼합하여 모리 (5 μL 당 핵산 염색을 이용 중고 묻은 50 ㎖ 아가로 오스). 단편 크기 계산을 할 수 있도록 겔의 1 차선 1KB 분자 크기의 DNA 사다리의 5 μl를 추가합니다. </li></ol>

<ol>
	<li>Chapman, H. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+selective+review+of+advances+in+coccidiosis+research.">A selective review of advances in coccidiosis research.</a> Adv Parasitol. 83, 93-171 (2013).</li><li>Shirley, M. W., Smith, A. L., Tomley, F. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biology+of+avian+Eimeria+with+an+emphasis+on+their+control+by+vaccination.">The biology of avian Eimeria with an emphasis on their control by vaccination.</a> Adv Parasitol. 60, 285-330 (2005).</li><li>Fornace, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Occurrence+of+Eimeria+species+parasites+on+small-scale+commercial+chicken+farms+in+Africa+and+indication+of+economic+profitability.">Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability.</a> PLoS ONE. 8 (12), e84254 (2013).</li><li>Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+analysis+of+Eimeria+spp.+populations+in+relation+to+performance+levels+of+broiler+chicken+farms+in+Arkansas+and+North+Carolina.">Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina.</a> J Parasitol. 95 (4), 871-880 (2009).</li><li>Peek, H. W., Landman, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coccidiosis+in+poultry:+anticoccidial+products,+vaccines+and+other+prevention+strategies.">Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies.</a> Vet Q. 31 (3), 143-161 (2011).</li><li>Johnson, J., Reid, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anticoccidial+drugs:+lesion+scoring+techniques+in+battery+and+floor-pen+experiments+with+chickens.">Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens.</a> Exp Parasitol. 28 (1), 30-36 (1970).</li><li>Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+survey+of+the+economic+impact+of+subclinical+Eimeria+infections+in+broiler+chickens+in+Norway.">A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway.</a> Avian Pathol. 37 (3), 333-341 (2008).</li><li>Procunier, J., Fernando, M., Barta, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+and+strain+differentiation+of+Eimeria+spp.+of+the+domestic+fowl+using+DNA+polymorphisms+amplified+by+arbitrary+primers.">Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers.</a> Parasitology Research. 79 (2), 98-102 (1993).</li><li>Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+diagnostic+PCR+assay+for+the+detection+and+discrimination+of+four+pathogenic+Eimeria+species+of+the+chicken.">Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken.</a> Avian Pathol. 27 (5), 490-497 (1998).</li><li>Vrba, V., Blake, D. P., Poplstein, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+real-time+PCR+assays+for+detection+and+quantification+of+all+seven+Eimeria+species+that+infect+the+chicken.">Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken.</a> Vet Parasitol. 174 (3-4), 183-190 (2010).</li><li>Morris, G. M., Gasser, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotechnological+advances+in+the+diagnosis+of+avian+coccidiosis+and+the+analysis+of+genetic+variation+in+Eimeria.">Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria.</a> Biotechnol Adv. 24 (6), 590-603 (2006).</li><li>Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Investing in animal health research to alleviate poverty. , (2002).</li><li>Nagamine, K., Hase, T., Notomi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accelerated+reaction+by+loop-mediated+isothermal+amplification+using+loop+primers).">Accelerated reaction by loop-mediated isothermal amplification using loop primers).</a> Mol Cell Probes. 16 (3), 223-229 (2002).</li><li>Notomi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loop-mediated+isothermal+amplification+of+DNA.">Loop-mediated isothermal amplification of DNA.</a> Nucleic Acids Res. 28 (12), E63 (2000).</li><li>Kaneko, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+enterotoxigenic+Clostridium+perfringens+in+meat+samples+by+using+molecular+methods.">Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods.</a> Appl Environ Microbiol. 77 (21), 7526-7532 (2011).</li><li>Karanis, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+preliminary+evaluation+of+a+loop-mediated+isothermal+amplification+procedure+for+sensitive+detection+of+cryptosporidium+oocysts+in+fecal+and+water+samples.">Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples.</a> Appl Environ Microbiol. 73 (17), 5660-5662 (2007).</li><li>Xue, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+Infectious+bursal+disease+virus+by+reverse+transcription+loop-mediated+isothermal+amplification+assay.">Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay.</a> J Vet Diagn Invest. 21 (6), 841-843 (2009).</li><li>Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loop-mediated+isothermal+amplification+(LAMP)+assays+for+the+species-specific+detection+of+Eimeria+that+infect+chickens.">Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens.</a> BMC Vet Res. 7 (1), 67 (2011).</li><li>Long, P., Joyner, L., Millard, B., Norton, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+guide+to+laboratory+techniques+used+in+the+study+and+diagnosis+of+avian+coccidiosis.">A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis.</a> Folia Veterinaria Latina. 6 (3), 201-217 (1976).</li><li>Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colorimetric+detection+of+loop-mediated+isothermal+amplification+reaction+by+using+hydroxy+naphthol+blue.">Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue.</a> BioTechniques. 46 (3), 167-172 (2009).</li><li>Arakawa, A., Baba, E., Fukata, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eimeria+tenella+infection+enhances+Salmonella+typhimurium+infection+in+chickens.">Eimeria tenella infection enhances Salmonella typhimurium infection in chickens.</a> Poult Sci. 60 (10), 2203-2209 (1981).</li><li>Blake, D. P., Smith, A. L., Shirley, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amplified+fragment+length+polymorphism+analyses+of+Eimeria+spp.:+an+improved+process+for+genetic+studies+of+recombinant+parasites.">Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites.</a> Parasitol Res. 90 (6), 473-475 (2003).</li><li>Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+Campylobacter+spp.+in+chicken+fecal+samples+by+real-time+PCR.">Detection of Campylobacter spp. in chicken fecal samples by real-time PCR.</a> J Clin Microbiol. 42 (11), 5125-5132 (2004).</li><li>Raj, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR-based+quantification+of+Eimeria+genomes:+a+method+to+outweigh+underestimation+of+genome+numbers+due+to+PCR+inhibition.">Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition.</a> Avian Pathol. 42 (4), 304-308 (2013).</li><li>Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eimeria+maxima:+the+influence+of+host+genotype+on+parasite+reproduction+as+revealed+by+quantitative+real-time+PCR.">Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR.</a> Int J Parasitol. 36 (1), 97-105 (2006).</li><li>Beck, H. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+approaches+to+diversity+of+populations+of+apicomplexan+parasites.">Molecular approaches to diversity of populations of apicomplexan parasites.</a> Int J Parasitol. 39 (2), 175-189 (2009).</li></ol>

The authors declare that they have no competing financial interests.

The Eimeria species-specific LAMP assays described in this paper offer a new diagnostic tool kit in support of effective control of coccidia and the disease coccidiosis. The outcomes of eimerian infection can include severe economic loss as well as seriously compromised bird welfare and increased susceptibility to colonisation by zoonotic pathogens21. Opportunities to monitor flocks for the occurrence of some, or all Eimeria species can provide early warning of a breakdown in anticoccidial control efficacy. Key advantages of LAMP include robust target specificity, resulting from the requirement for six different DNA sequence targets, as well as high sensitivity, boosted by the inclusion of loop primers13, although the qualitative, not quantitative nature of LAMP may be considered a limitation. It is not currently possible to discriminate low level parasite escape from routine chemoprophylaxis or live vaccine replication from unchecked eimerian replication. Nonetheless, the technical ease of the protocol and definitive readout offers considerable improvement over the existing specialist and frequently subjective pathology- and morphology-led approaches6,7. Each assay may be completed at a cost of ~&#163;0.75 per sample, independent of labour and equipment set up expenses. Thus, LAMP assays are also more cost effective than other molecular diagnostics such as PCR, since they require an isothermal incubation with no need for specialist equipment. 
For many years access to Eimeria genomic DNA as template has limited the development and application of molecular field diagnostics. The oocyst is the most readily accessible phase of the eimerian lifecycle, but routine DNA extraction requires laboratory facilities22. Other, more labile intestinal lifecycle stages require purification prior to DNA preparation to prevent PCR inhibition and a consequent loss of sensitivity23,24. The ability to extract eimerian DNA of a quality suitable for LAMP using equipment no more specialised than a microcentrifuge and a water bath, supplemented by inhibitor adsorption using chelex resin, now promotes the wider use of molecular biology in eimerian diagnostics. Intriguingly, the reported detection of quantitative PCR-measurable Eimeria DNA in intestinal tissue 20 days after the initiation of parasite infection, 11 days after the last detectable oocyst output, raises the suggestion that LAMP may be used to detect resolved parasite exposure as well as ongoing infection, even after any visible lesions may have been resolved25. 
The relatively low cost and low technical requirements of LAMP Eimeria diagnostics can promote their application in the developing world where other more established approaches may not be available or appropriate. For this to be applicable each assay must be capable of detecting all strains which may be circulating within each region. While understanding of the genetic diversity prevailing among Eimeria species is limited26, the use of target sequences previously validated for use in quantitative PCR with strains from Africa, Asia, Europe and South America provides some evidence of conservation, supporting the utility of these LAMP assays around the world10.

글로벌 닭고기 생산은 개발 도상국이 선진국에서 목격 거의 4 배 확장 호스팅으로 10 배 이상 지난 50 년간 증가했다 <a href="http://www.faostat.org">(www.faostat.org을)</a> . 세계 식량 안보에 닭 생산의 관련성이 성장함에 따라 너무 너무 닭에 심각한 질병을 일으킬 수있는 병원체의 프로필을 가지고있다. 하나의 좋은 예는 장 질환 콕시듐증 일이 발생할 수 있습니다 에이 메리아 종, 유비쿼터스 원생 동물 기생충이다. 닭이 사육되는 곳마다 하나 이상의 에이 메리아 종은 2-4 일반적인 될 가능성이 있습니다. 선진국 에이 메리아 주로 저항 (5)의 영향을 최소화하기 위해 셔틀을 회전하거나 프로그램을 이용, 화학 요법에 의해 제어된다. 라이브 백신은 또한 새 값 비용을 정당화하기에 충분한 시스템에 사용된다 (예를 들면, 사진, 층 및 일부 육계 사육 5). resu으로임상 콕시듐증은 종종 잘 제어 이러한 조치의 LT, 준 임상 적 감염이 5 일반적인 않는다. 개발 도상국의 예방 접종에 드문 약물 응용 프로그램은 자주 덜 알렸다. 결과적으로 서브 임상 및 임상 콕시듐증은 더 일반적이고 중요한 경제적 영향 (3)을 발휘한다. 가장 널리 사용되는 채점 시스템의 경우에도 저자가 어떤 종은 &quot;이 같은 절차는 어떤하지만 중등도 감염을 시도할지 여부를 의심 보인다&quot;고 댓글을 달았하지만 eimerian 감염의 진단은 전통적으로 사후 득점 병변에 의존하고있다 (6). 형태 겹치는 전문가 6,7 제외한 모든 혼동 할 수 있지만 보충 증거, 배설물이나 쓰레기 샘플 환경에 강한 oocyst 수명주기 단계의 미세한 감지를 통해 수집 할 수 있습니다. 중합 효소 연쇄 반응을 이용하여 분자 대안 (PCR), 랜덤 amplificatio다형성 DNA PCR (RAPD-PCR) 및 정량 PCR 기술의 n은 최대 20 년 8 ~ 10 사용할 수 있었지만, 지금까지 그들은 인기를 끌고 못했다. 상대 비용과 전문 실험실 장비 또는 처리에 대한 요구 사항은 종종 주관적이고 기술적으로 까다로운 이전 pathology-의 자연과 현미경 기반이 10,11 접근에도 불구하고, 자신의 흡수를 제한했다. 이러한 제한은 빈곤에 콕시듐증의 영향 (12) 비례 적으로 더 클 수있다 등 동남 아시아 등 세계의 가난한 지역의 많은 과장 될 수있다. 응답하여, 에이 메리아 종 특이 진단법 및 신규 간단 민감하지만, 비용 효과에 대한 명백한 요구되고있다. 루프 - 매개 등온 증폭 (LAMP)는 다량의 DNA를 증폭 할 수있는 DNA 폴리머 라 구동 기술을 조제 쉽다. 가장 중요한 것은, LAMP는 BST의 DNA 폴리머 a를 사용SE 대신 13,14 열 사이클에 대한 요구없이 단일의 일정한 온도에서 DNA 증폭을 용이하게 통상적으로 사용 된 PCR의 Taq DNA 중합 효소. LAMP는 가장 기본적인 실험실에서 또는 현장에서 적용 할 의무가있다. 많은 PCR 억제제, 높은 감도 및 특이성에 대하여 저항 특징 인, LAMP 세이 감염성 점액낭 질환 바이러스, 및 클로스 트리 디움 퍼프 린 젠스 15-17 포자충 등 병원균의 광범위한 개발되었다. 응답에서 닭을 감염 일곱 에이 메리아 종의 각 특정 LAMP 분석의 패널 (18)을 개발 한 새로운 비용 효율적인 에이 메리아 종 별 진단 요구하는. 새로운 분석을위한 응용 프로그램은 가난한 경제 PE와 에이 메리아의 최대 또는 메리아의 necatrix으로 종의 관계를 주어진 특정 값의 모니터링 기생충 발생을 포함3,4 rformance. 다른 응용 프로그램은 농장의 항 콕시듐 전략, 준 임상 적 감염이나 임상 적 질환과 농장에 메리아로 인한 위험의 평가 진단의 효능을 평가하는 것을 포함한다.

<table><tbody><tr><td>RNAlater</td><td>Ambion</td><td>AM7024</td><td></td></tr><tr><td>Ethanol</td><td>VWR Chemicals</td><td>20821.321</td><td>Caution, highly flammable</td></tr><tr><td>100 x Tris-EDTA (TE) buffer concentrate</td><td>Sigma-Aldrich</td><td>T9285</td><td></td></tr><tr><td>Chelex 100 resin</td><td>Bio-Rad</td><td>142-1253</td><td></td></tr><tr><td>Molecular grade water</td><td>Invitrogen</td><td>10977035</td><td></td></tr><tr><td>E. acervulina F3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CCTAACATTTCGCTTCACGGAC</td></tr><tr><td>E. acervulina B3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*ATGAGCAAGTGGAACACCTTG</td></tr><tr><td>E. acervulina FIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT</td></tr><tr><td>E. acervulina BIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG</td></tr><tr><td>E. acervulina LB</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*TAAGGTTACACCCGTGGAGG</td></tr><tr><td>E. acervulina LF</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GCCATGCACAAAGCGACTT</td></tr><tr><td>E. brunetti F3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GGCCATCAAGTTCCATGAGC</td></tr><tr><td>E. brunetti B3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*TCAACCTCCTGAGTGTGGTT</td></tr><tr><td>E. brunetti FIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT</td></tr><tr><td>E. brunetti BIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC</td></tr><tr><td>E. brunetti LB</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GAAACGCTCGAACATGGC</td></tr><tr><td>E. brunetti LF</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CTTCTCCACAGACCCAGAGGT</td></tr><tr><td>E. maxima F3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*ACTACGGAAAAGTGCGTAGCT</td></tr><tr><td>E. maxima B3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CCTTCCTCCCTTCTGAAAACTG</td></tr><tr><td>E. maxima FIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GAGTCACTGCTGATGTACCAAA&lt;br/&gt; AG-GAACTATGCCGCTTTCCCCTG</td></tr><tr><td>E. maxima BIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA</td></tr><tr><td>E. maxima LB</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CAAGCCTACGCGGACATC</td></tr><tr><td>E. maxima LF</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*TTATGCAGCTGGGTCAACG</td></tr><tr><td>E. mitis F3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*ACGATAGCCAAGACACGTAAGG</td></tr><tr><td>E. mitis B3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CCCCGTGATAAGAGTAGGAACA</td></tr><tr><td>E. mitis FIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CGCGGGTCGTGAGATTTAAATT&lt;br/&gt; AT-GGAAGATCAGGACGGGCACT</td></tr><tr><td>E. mitis BIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GTTTCAGTTGATGAACAAGCGA&lt;br/&gt; GA-TGCGCCTCTAGAATCAAGACG</td></tr><tr><td>E. mitis LB</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*TCCATGCATCCCCTTGTT</td></tr><tr><td>E. mitis LF</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CGTGGGCACAGATTGATTC</td></tr><tr><td>E. necatrix F3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*TGGCTTTCCCGCGTACC</td></tr><tr><td>E. necatrix B3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CGGCCCAACACAAAGACTG</td></tr><tr><td>E. necatrix FIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CGCTTGAGTTTTAAGCTATGCA&lt;br/&gt; CA-GACCCAAGCAGCTCACCAA</td></tr><tr><td>E. necatrix BIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC</td></tr><tr><td>E. necatrix LB</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GTCTGTAACTTGGGACGTTGT</td></tr><tr><td>E. necatrix LF</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GAACAGCCGGAGCCTCTC</td></tr><tr><td>E. praecox F3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GCCCTTGTATGTTGCTGTTTCT</td></tr><tr><td>E. praecox B3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GCGCACGAATCTGAATCACAC</td></tr><tr><td>E. praecox FIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*ATCTCCTCAAAGACTTTCGCGT&lt;br/&gt; A-GCGCTTGGCTATATCCATAGG</td></tr><tr><td>E. praecox BIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT</td></tr><tr><td>E. praecox LB</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GAATAGCATTGCCAGGTGG</td></tr><tr><td>E. praecox LF</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GTCCACTGTCATTAATATTGC&lt;br/&gt; TGC</td></tr><tr><td>E. tenella F3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GCTTGTGAAGGTCAGCGTG</td></tr><tr><td>E. tenella B3</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GCTGAGTCCATACGTACTTCCT</td></tr><tr><td>E. tenella FIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GCCACTGCTATGGAAAGTCAC&lt;br/&gt; AC-CATAACTGGCATGCAGGGGT</td></tr><tr><td>E. tenella BIP</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*GTTTGGCCCGAAAGTTGTGAA&lt;br/&gt; GA-CGTCAGAAATTGCTGCCCAAT</td></tr><tr><td>E. tenella LB</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CGCATGTGCAGTTGAAGACA</td></tr><tr><td>E. tenella LF</td><td>Sigma-Aldrich</td><td>VC00021</td><td>*CCAAATGTATCTGCTAGTTATA&lt;br/&gt; TTAACAAG</td></tr><tr><td>10 x ThermoPol reaction buffer</td><td>New England Biolabs</td><td>B9004S</td><td></td></tr><tr><td>MgSO&lt;sub&gt;4&lt;/sub&gt;</td><td>Sigma-Aldrich</td><td>M7506</td><td></td></tr><tr><td>dNTPs</td><td>Promega</td><td>U1330</td><td></td></tr><tr><td>Betaine solution (5 M)</td><td>Sigma-Aldrich</td><td>B0300</td><td></td></tr><tr><td>Bst polymerase</td><td>New England Biolabs</td><td>M0275S</td><td></td></tr><tr><td>Hydroxynaphthol blue</td><td>Sigma-Aldrich</td><td>33936</td><td>Dissolved in molecular grade water.</td></tr><tr><td>UltraPure agarose</td><td>Invitrogen</td><td>16500-500</td><td></td></tr><tr><td>10 x Tris/Borate/EDTA (TBE) buffer</td><td>Invitrogen</td><td>AM9863</td><td></td></tr><tr><td>Blue/Orange DNA loading dye (x6)</td><td>Promega</td><td>G1881</td><td></td></tr><tr><td>GeneRuler 1Kb DNA ladder</td><td>Thermo Scientific</td><td>SM0313</td><td></td></tr><tr><td>SafeView nucleic acid stain</td><td>NBS Biologicals</td><td>NBS-SV</td><td></td></tr></tbody></table>

loop-mediated isothermal amplification (lamp) assays for the species-specific detection of eimeria that infect chickens

Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the absence of effective control clinical coccidiosis can be devastating. Resistance to the chemoprophylactics frequently used to control Eimeria is common and sub-clinical infection is widespread, influencing feed conversion ratios and susceptibility to other pathogens such as Clostridium perfringens. Despite the availability of polymerase chain reaction (PCR)-based tools, diagnosis of Eimeria infection still relies almost entirely on traditional approaches such as lesion scoring and oocyst morphology, but neither is straightforward. Limitations of the existing molecular tools include the requirement for specialist equipment and difficulties accessing DNA as template. In response a simple field DNA preparation protocol and a panel of species-specific loop-mediated isothermal amplification (LAMP) assays have been developed for the seven Eimeria recognised to infect the chicken. We now provide a detailed protocol describing the preparation of genomic DNA from intestinal tissue collected post-mortem, followed by setup and readout of the LAMP assays. Eimeria species-specific LAMP can be used to monitor parasite occurrence, assessing the efficacy of a farm&#8217;s anticoccidial strategy, and to diagnose sub-clinical infection or clinical disease with particular value when expert surveillance is unavailable.

분석 검증 검증 동안 각 에이 메리아 종 특이 LAMP 분석은 호스트 제어로서 닭뿐만 아니라, 닭 게놈 DNA를 감염 일곱 에이 메리아 종을 나타내는 순수한 DNA 샘플의 패널을 사용하여 시험 하였다. 아가로 오스 겔 전기 영동은 각각의 분석을 해결하는 데 사용없이 호스트 교차 반응 (18)와 절대 종 특이성을 입증했다. 다음에, 10 배 일련 희석 시리즈 게놈 DNA는 하나 내지 열 게놈 사본 (18)의 분석 감도 한계를 공개 정제 에이 메리아 tenella를 사용하여 제조. 상한은 최고 농도 (100,000 게놈 부) (18)를 포함한 포지티브까지 달성 결과로 결정되지 않았다. 필드 샘플 응용 프로그램 에이 메리아 시험용 샘플을 수집 (p)의 결과로서 추려, 죽은 닭으로부터 유래 될 가능성OOR 건강 또는 하나 사이에 세 가지의 가능성이 표본의 크기를 나타내는, 감시 건강 감시 학살 할 때 루틴의 일부. 감시 프로그램의 일환으로 미국의 육계 농장에서 수집 한 세 마리의 새를 테스트하는 것은 장 샘플 3 세트 얻었다. 각 에이 메리아 종 (표 1)에 대한 선호 장 사이트를 우선 순위, 종 특이 LAMP 분석의 응용 프로그램을 대상으로 한 지표로 블루 hydroxynaphthol (그림 2A)를 사용하여 테스트 한 모든 조류에 eimerian 감염의 시각적 식별을 허용했다. hydroxynaphthol 블루를 사용하는 경우 음의 LAMP 반응을 달성 색상은 핑크 보라색에 이르기까지 다양하지만, 항상 긍정적 인 결과에 의해 달성 푸른 구별된다 할 수 있습니다. 아가로 오스 겔 전기 영동으로 확인이 비교 결과 (그림 2B)를 제공했다. 현장 적용시 사용자는 일곱 종에 대해 전체 화면을 적용하도록 선택하거나 같은 우선 순위 만 종을 대상으로 할 수있다중요하거나 알려진 농장에서 순환 또는 주변 지역합니다. 에이 메리아의 발생이 새로운 테스트의 편의를 위해 요구 사항을 강조위한 PCR 기반 접근 방식의 고장 진단으로 설립 될 수 있습니다. LAMP는 PCR보다 간단 준비와 처리를 제공하지만, 조류 당 여러 장 사이트를 테스트 할 수있는 요구 사항은 실망 남아있다. 하나 이상의 LAMP 분석법으로 테스트 할 수있는 조류 당 단일 풀링 된 DNA 시료의 생산은 더 매력적이 될 가능성이 높다. 각 장 사이트가 개별적으로 처리했을 때와 동일한 결과 (도 2 일곱 LAMP 분석법으로 시험을 위해, 표 1에 기재된 DNA 준비 전에 풀링 특정 장내 사이트들 각각으로부터 수집 된 물질을 나타내는 조류 하나씩 풀링 된 샘플을 제공 처리 ) 그림 3과 비교. <img alt="그림 1" src=&quot;/files/ftp_upload/52552/52552fig1.jpg&quot;/&gt; 닭을 감염 에이 메리아 종 기생충의 LAMP 감지 그림 1. 장내 샘플링 사이트는. 각 에이 메리아 종의 대상이 장 영역은 E. (점선 검은 선 사이의 숫자로 표시 샘플링 선호하는 사이트와, 색 선으로 강조 acervulina : 노랑 / 1, E.의 브루 네티 : 핑크 / 2, E. 최대 값 : 블루 / 3, E. mitis가 각각 1 주 씩으로 : 레드 / 5, E.의 praecox : 오렌지 / 4, E.의 necatrix 녹색 / 6 E. tenella를 : 회색 / 7). <a href="https://www.jove.com/files/ftp_upload/52552/52552fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/52552/52552fig2.jpg" /> eimerian 감염의 그림 2. 램프 진단 이리저리푸른 하늘 반응은 긍정적이었다 핑크 반응에 보라색이 부정적이고, (B) 아가로 오스 겔 전기 영동 경우 m 세 상업 육계. LAMP 반응은, (A)를 사용하여 블루 hydroxynaphthol 해결. 샘플링 사이트는 장내 기생충 각 종 표 1에 나타내었다. A = E. acervulina, B = E. 브루 네티, 엄마 = E. 최대, 미 = E. mitis가 각각 1 주 씩으로, N = E. necatrix, P = E. praecox 및 T = E. 돌 가사리. 레인 1 GeneRuler 1KB DNA 사다리가 포함되어 있습니다. <a href="https://www.jove.com/files/ftp_upload/52552/52552fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/52552/52552fig3.jpg" /> eimerian 감염의 그림 3. 램프 진단은 세 개의 분리 된 상업 육계에서 샘플을 풀링 사용. 램프 REAC을TIONS는 하늘색 반응은 긍정적이었다 핑크 반응에 보라색이 부정적 hydroxynaphthol 파란색을 사용하여 해결. A = E. acervulina, B = E. 브루 네티, 엄마 = E. 최대, 미 = E. mitis가 각각 1 주 씩으로, N = E. necatrix, P = E. praecox 및 T = E. 돌 가사리. <a href="https://www.jove.com/files/ftp_upload/52552/52552fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> 샘플 사이트 </td><td> 에이 메리아 종 분석 (대부분) </td></tr><tr><td> 십이지장 (D) </td><td> E.의 acervulina, E.의 praecox </td></tr><tr><td> 공장 / 회장의 * (J / I) </td><td> E. 최대, E.의 necatrix </td></tr><tr><td> Caeca (C) </td><td> E.의 necatrix, E. tenella를 </td></tr><tr><td> 터미널 회장 (TI) </td><td> E.의 브루 네티, E. mitis가 각각 1 주 씩으로 </td></tR&gt; <tr><td> 풀링 된 샘플 (P) </td><td> E.의 acervulina, E.의 브루 네티, E. 최대, E. mitis가 각각 1 주 씩으로, E.의 necatrix, E.의 praecox, E. tenella를 </td></tr></tbody></table> 후보 에이 메리아 종 분석 표 1. 장내 영역 별 선택. 지역의 선택은 그림 1에 도시 된 바와 같이 각각의 에이 메리아 종에 따라 다릅니다 샘플링합니다. 풀링 된 샘플은 다음 DNA의 준비를 위해 결합 된 네 개의 특정 사이트에서 수집 된 자료를 포함한다. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> 프라이머 * </td><td> 주식 농도 (μM) </td><td> 볼륨 (μL) </td></tr><tr><td> 물 </td><td> - </td><td> (60) </td></tr><tr><td> 앞으로 내부 프라이머 (FIP) </td><td> (100) </td><td> (40) </td></tr><tr><td> 이전 버전과의 내부 PRI의메르 (BIP) </td><td> (100) </td><td> (40) </td></tr><tr><td> 앞으로 외부 프라이머 (F3) </td><td> (100) </td><td> (10) </td></tr><tr><td> 이전 버전과의 외부 프라이머 (B3) </td><td> (100) </td><td> (10) </td></tr><tr><td> 루프 전달 (LF) </td><td> (100) </td><td> (20) </td></tr><tr><td> 이전 버전과의 루프 (LB) </td><td> (100) </td><td> (20) </td></tr><tr><td> 합계 </td><td></td><td> (200) </td></tr></tbody></table> LAMP 프라이머 프리믹스 표 2. 준비. LAMP의 프라이머 프리믹스를 준비하는 데 필요한 구성 요소와 비율. 표시된 볼륨은 100 LAMP 반응에 대한 것입니다. * 자료에 도시 된 바와 같이 프라이머의 정체성 Barkway 등 (2011) 18. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td></td><td> 주식 진한 없음 </td><td> 최종 반응 진한 없음 </td><td> 반응 당 볼륨 (μL) </td></tr><tr><td> DDW </td><td> - </td><td> - </td><td> 10.1 </td></tr><tr><td> ThermoPol 버퍼 </td><td> 10 × </td><td> 1 개 </td><td> 2.5 </td></tr><tr><td> 황산 </td><td> 100 mM의 </td><td> 2 mM의 </td><td> 0.5 </td></tr><tr><td> 프라이머 믹스 * </td><td colspan="2"> 표 2 </td><td> 2.5 </td></tr><tr><td> 의 dNTPs </td><td> 25 mM의 </td><td> 400 μM의 </td><td> 0.4 </td></tr><tr><td> 베타 </td><td> 5 M </td><td> 1 M </td><td> (5) </td></tr><tr><td> Hydroxynaphthol 블루 </td><td> 3 mM의 </td><td> 120 μM </td><td> (1) </td></tr><tr><td> BST DNA 중합 효소 </td><td> 8000 U / ㎖ </td><td> 8 U </td><td> (1) </td></tr><tr><td> 합계 </td><td></td><td></td><td> (23) </td></tr></tbody></table> LAM 표 3. 준비P 반응 mastermix. * 에이 메리아 종 특이.

Watch this Scientific Journal Video about Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens at JoVE.com

Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens

Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.

의 종 특이 검출을위한 루프 - 매개 등온 증폭 (LAMP) 분석 실험<em&gt; 에이 메리아</em&gt; 닭을 감염이

Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the ...

loop-mediated-isothermal-amplification-lamp-assays-for-species

Research

JoVE Journal

Immunology and Infection

Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens

26.9K 조회수.  Royal Veterinary College, London. Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.

비디오: Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens

Rapid Diagnosis of Avian Influenza Virus in Wild Birds: Use of a Portable rRT-PCR and Freeze-dried Reagents in the Field

Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds for avian influenza virus (AIV) is often conducted in remote regions, but results are often delayed because of the need to transport samples to a laboratory equipped for molecular testing. Real-time reverse transcriptase polymerase chain reaction (rRT-PCR) is a molecular technique that offers one of the most accurate and sensitive methods for diagnosis of AIV. The previously strict lab protocols needed for rRT-PCR are now being adapted for the field. Development of freeze-dried (lyophilized) reagents that do not require cold chain, with sensitivity at the level of wet reagents has brought on-site remote testing to a practical goal.
Here we present a method for the rapid diagnosis of AIV in wild birds using an rRT-PCR unit (Ruggedized Advanced Pathogen Identification Device or RAPID, Idaho Technologies, Salt Lake City, UT) that employs lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies). The reagents contain all of the necessary components for testing at appropriate concentrations in a single tube: primers, probes, enzymes, buffers and internal positive controls, eliminating errors associated with improper storage or handling of wet reagents. The portable unit performs a screen for Influenza A by targeting the matrix gene and yields results in 2-3 hours. Genetic subtyping is also possible with H5 and H7 primer sets that target the hemagglutinin gene.
The system is suitable for use on cloacal and oropharyngeal samples collected from wild birds, as demonstrated here on the migratory shorebird species, the western sandpiper (Calidrus mauri) captured in Northern California. Animal handling followed protocols approved by the Animal Care and Use Committee of the U.S. Geological Survey Western Ecological Research Center and permits of the U.S. Geological Survey Bird Banding Laboratory. The primary advantage of this technique is to expedite diagnosis of wild birds, increasing the chances of containing an outbreak in a remote location. On-site diagnosis would also prove useful for identifying and studying infected individuals in wild populations. The opportunity to collect information on host biology (immunological and physiological response to infection) and spatial ecology (migratory performance of infected birds) will provide insights into the extent to which wild birds can act as vectors for AIV over long distances.

This study describes diagnosis of avian influenza in wild birds using a portable rRT-PCR system. The method takes advantage of freeze-dried reagents to screen wild birds in a non-laboratory setting, typical of an outbreak scenario. Use of molecular tools provides accurate and sensitive alternatives for rapid diagnosis.

야생 조류에서 조류 독감 바이러스의 신속한 진단 : 현장에서 휴대용 RRT - PCR 및 정지 - 건조 시약의 사용

Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory ...

연구

면역학 및 감염병학

Avian Influenza Surveillance with FTA  Cards: Field Methods, Biosafety, and Transportation Issues Solved

Avian Influenza Viruses (AIVs) infect many mammals, including humans1. These AIVs are diverse in their natural hosts, harboring almost all possible viral subtypes2. Human pandemics of flu originally stem from AIVs3. Many fatal human cases during the H5N1 outbreaks in recent years were reported. Lately, a new AIV related strain swept through the human population, causing the 'swine flu epidemic'4. Although human trading and transportation activity seems to be responsible for the spread of highly pathogenic strains5, dispersal can also partly be attributed to wild birds6, 7. However, the actual reservoir of all AIV strains is wild birds.
In reaction to this and in face of severe commercial losses in the poultry industry, large surveillance programs have been implemented globally to collect information on the ecology of AIVs, and to install early warning systems to detect certain highly pathogenic strains8-12. Traditional virological methods require viruses to be intact and cultivated before analysis. This necessitates strict cold chains with deep freezers and heavy biosafety procedures to be in place during transport. Long-term surveillance is therefore usually restricted to a few field stations close to well equipped laboratories. Remote areas cannot be sampled unless logistically cumbersome procedures are implemented. These problems have been recognised13, 14 and the use of alternative storage and transport strategies investigated (alcohols or guanidine)15-17. Recently, Kraus et al.18 introduced a method to collect, store and transport AIV samples, based on a special filter paper. FTA cards19 preserve RNA on a dry storage basis20 and render pathogens inactive upon contact21. This study showed that FTA cards can be used to detect AIV RNA in reverse-transcription PCR and that the resulting cDNA could be sequenced and virus genes and determined.
In the study of Kraus et al.18 a laboratory isolate of AIV was used, and samples were handled individually. In the extension presented here, faecal samples from wild birds from the duck trap at the Ottenby Bird Observatory (SE Sweden) were tested directly to illustrate the usefulness of the methods under field conditions. Catching of ducks and sample collection by cloacal swabs is demonstrated. The current protocol includes up-scaling of the work flow from single tube handling to a 96-well design. Although less sensitive than the traditional methods, the method of FTA cards provides an excellent supplement to large surveillance schemes. It allows collection and analysis of samples from anywhere in the world, without the need to maintaining a cool chain or safety regulations with respect to shipping of hazardous reagents, such as alcohol or guanidine.

A method to preserve, detect and sequence RNA from Avian Influenza Viruses was validated and extended using natural faecal samples from birds. This technique removes the necessity of maintaining a cool chain and handling of infectious viruses and can be applied in a 96-well high-throughput setup.

조류 FTA 카드 인플루엔자 감시 : 필드 방법, Biosafety, 그리고 교통 문제 해결

Avian Influenza Viruses (AIVs) infect many mammals, including humans1. These AIVs are diverse in their natural hosts, harboring almost all possible viral ...

Multiplexed Isothermal Amplification Based Diagnostic Platform to Detect Zika, Chikungunya, and Dengue 1

Zika, dengue, and chikungunya viruses are transmitted by mosquitoes, causing diseases with similar patient symptoms. However, they have different downstream patient-to-patient transmission potentials, and require very different patient treatments. Thus, recent Zika outbreaks make it urgent to develop tools that rapidly discriminate these viruses in patients and trapped mosquitoes, to select the correct patient treatment, and to understand and manage their epidemiology in real time.
Unfortunately, current diagnostic tests, including those receiving 2016 emergency use authorizations and fast-track status, detect viral RNA by reverse transcription polymerase chain reaction (RT-PCR), which requires instrumentation, trained users, and considerable sample preparation. Thus, they must be sent to &#34;approved&#34; reference laboratories, requiring time. Indeed, in August 2016, the Center for Disease Control (CDC) was asking pregnant women who had been bitten by a mosquito and developed a Zika-indicating rash to wait an unacceptable 2 to 4 weeks before learning whether they were infected. We very much need tests that can be done on site, with few resources, and by trained but not necessarily licensed personnel.
This video demonstrates an assay that meets these specifications, working with urine or serum (for patients) or crushed mosquito carcasses (for environmental surveillance), all without much sample preparation. Mosquito carcasses are captured on paper carrying quaternary ammonium groups (Q-paper) followed by ammonia treatment to manage biohazards. These are then directly, without RNA isolation, put into assay tubes containing freeze-dried reagents that need no chain of refrigeration. A modified form of reverse transcription loop-mediated isothermal amplification with target-specific fluorescently tagged displaceable probes produces readout, in 30 min, as a three-color fluorescence signal. This is visualized with a handheld, battery-powered device with an orange filter. Forward contamination is prevented with sealed tubes, and the use of thermolabile uracil DNA glycosylase (UDG) in the presence of dUTP in the amplification mixture.

Current multiplexed diagnostics to detect Zika, chikungunya, and dengue viruses require complex sample preparation and expensive instrumentation, and are difficult to use in low resource environments. We show a diagnostic that uses isothermal amplification with target-specific strand displaceable probes to detect and differentiate these viruses with high sensitivity and specificity.

멀티플렉스 등온 증폭 Zika, Chikungunya, 뎅 그 열의 1 감지 진단 플랫폼을 기반으로

Zika, dengue, and chikungunya viruses are transmitted by mosquitoes, causing diseases with similar patient symptoms. However, they have different ...

생화학

Parasite Induced Genetically Driven Autoimmune Chagas Heart Disease in the Chicken Model

The Trypanosoma cruzi acute infections acquired in infancy and childhood seem asymptomatic, but approximately one third of the chronically infected cases show Chagas disease up to three decades or later. Autoimmunity and parasite persistence are competing theories to explain the pathogenesis of Chagas disease 1, 2. To separate roles played by parasite persistence and autoimmunity in Chagas disease we inoculate the T. cruzi in the air chamber of fertilized eggs. The mature chicken immune system is a tight biological barrier against T. cruzi and the infection is eradicated upon development of its immune system by the end of the first week of growth 3. The chicks are parasite-free at hatching, but they retain integrated parasite mitochondrial kinetoplast DNA (kDNA) minicircle within their genome that are transferred to their progeny. Documentation of the kDNA minicircle integration in the chicken genome was obtained by a targeted prime TAIL-PCR, Southern hybridizations, cloning, and sequencing 3, 4. The kDNA minicircle integrations rupture open reading frames for transcription and immune system factors, phosphatase (GTPase), adenylate cyclase and phosphorylases (PKC, NF-Kappa B activator, PI-3K) associated with cell physiology, growth, and differentiation 3, 5-7, and other gene functions. Severe myocarditis due to rejection of target heart fibers by effectors cytotoxic lymphocytes is seen in the kDNA mutated chickens, showing an inflammatory cardiomyopathy similar to that seen in human Chagas disease. Notably, heart failure and skeletal muscle weakness are present in adult chickens with kDNA rupture of the dystrophin gene in chromosome 1 8. Similar genotipic alterations are associated with tissue destruction carried out by effectors CD45+, CD8&gamma;&delta;+, CD8&alpha; lymphocytes. Thus this protozoan infection can induce genetically driven autoimmune disease.

The inoculation of Trypanosoma cruzi in fertile eggs prior to incubation renders the parasite kDNA minicircle integration in embryo cells genome. Crossbreeding reveals the vertical transfer of the mutations to progeny. The kDNA integrates into coding regions at several chromosomes and the chickens die with an inflammatory autoimmune heart disease.

기생충은 치킨 모델에서 유전 힘입어 면역 Chagas의 심장 질환을 유발

The Trypanosoma cruzi acute infections acquired in infancy and childhood seem asymptomatic, but approximately one third of the chronically infected cases ...

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. burnetii DNA in cell cultures and clinical samples. PCR requires specialized equipment and extensive end user training, and therefore, it is not suitable for routine work especially in a resource-constrained area. We have developed a loop-mediated isothermal amplification (LAMP) assay to detect the presence of C. burnetii in patient samples. This method is performed at a single temperature around 60 &#176;C in a water bath or heating block. The sensitivity of this LAMP assay is very similar to PCR with a detection limit of about 25 copies per reaction. This report describes the preparation of the reaction using lyophilized reagents and visualization of results using hydroxynaphthol blue (HNB) or a UV lamp with fluorescent intercalating dye in the reaction. The LAMP reagents were lyophilized and stored at room temperature (RT) for one month without loss of detection sensitivity. This LAMP assay is particularly robust because the reaction mixture preparation does not involve complex steps. This method is ideal for use in resource-limited settings where Q fever is endemic.

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

We described here a simple loop-mediated isothermal amplification (LAMP) method using lyophilized reagents for the detection of C. burnetii in patient samples.

의 탐지를위한 동결 건조 루프 - 매개 등온 증폭 시약의 개발<em&gt; Coxiella burnetii의</em

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. ...

Visual Detection of Multiple Nucleic Acids in a Capillary Array

Multi-target, short time, and resource-affordable methodologies for the detection of multiple nucleic acids in a single, easy to operate test are urgently needed in disease diagnosis, microbial monitoring, genetically modified organism (GMO) detection, and forensic analysis. We have previously described the platform called CALM (Capillary Array-based Loop-mediated isothermal amplification for Multiplex visual detection of nucleic acids). Herein, we describe improved fabrication and performance processes for this platform. Here, we apply a small, ready-to-use cassette assembled by capillary array for multiplex visual detection of nucleic acids. The capillary array is pre-treated into a hydrophobic and hydrophilic pattern before fixing loop-mediated isothermal amplification (LAMP) primer sets in capillaries. After assembly of the loading adaptor, LAMP reaction mixture is loaded and isolated into each capillary, due to capillary force by a single pipetting step. The LAMP reactions are performed in parallel in the capillaries. The results are visually read out by illumination with a hand-held UV flashlight. Using this platform, we demonstrate monitoring of 8 frequently appearing elements and genes in GMO samples with high specificity and sensitivity. In summary, the platform described herein is intended to facilitate the detection of multiple nucleic acids. We believe it will be widely applicable in fields where high-throughput nucleic acid analysis is required.

This protocol describes the fabrication of a small, ready-to-use cassette that can be applied for visual detection of multiple nucleic acids in a single, test that is easy to operate. In this approach, a capillary array was used for multiplex and highly efficient detection of GMO targets.

모 세관 배열에 여러 개의 핵 산의 비주얼 검색

Multi-target, short time, and resource-affordable methodologies for the detection of multiple nucleic acids in a single, easy to operate test are urgently ...

생체공학

High-throughput Detection of Respiratory Pathogens in Animal Specimens by Nanoscale PCR

Nanoliter scale real-time PCR uses spatial multiplexing to allow multiple assays to be run in parallel on a single plate without the typical drawbacks of combining reactions together. We designed and evaluated a panel based on this principle to rapidly identify the presence of common disease agents in dogs and horses with acute respiratory illness. This manuscript describes a nanoscale diagnostic PCR workflow for sample preparation, amplification, and analysis of target pathogen sequences, focusing on procedures that are different from microliter scale reactions. In the respiratory panel presented, 18 assays were each set up in triplicate, accommodating up to 48 samples per plate. A universal extraction and pre-amplification workflow was optimized for high-throughput sample preparation to accommodate multiple matrices and DNA and RNA based pathogens. Representative data are presented for one RNA target (influenza A matrix) and one DNA target (equine herpesvirus 1). The ability to quickly and accurately test for a comprehensive, syndrome-based group of pathogens is a valuable tool for improving efficiency and ergonomics of diagnostic testing and for acute respiratory disease diagnosis and management.

High-throughput testing of DNA and RNA based pathogens by nanoscale PCR is described using a syndromic canine and equine respiratory PCR panel.

나노 PCR에 의한 동물 표본의 호흡기 병원체의 높은 처리량 검출

Nanoliter scale real-time PCR uses spatial multiplexing to allow multiple assays to be run in parallel on a single plate without the typical drawbacks of ...

Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) Assay for the Specific and Rapid Detection of Tilapia Lake Virus

Tilapia lake virus disease (TiLVD), an emerging viral disease in tilapia caused by the tilapia lake virus (TiLV), is a persistent challenge in the aquaculture industry that has resulted in the mass morbidity and mortality of tilapia in many parts of the world. An effective, rapid, and accurate diagnostic assay for TiLV infection is therefore necessary to detect the initial infection and to prevent the spread of the disease in aquaculture farming. In this study, a highly sensitive and practical reverse transcription loop-mediated isothermal amplification (RT-LAMP) method is presented to detect tilapia lake virus in fish tissue. A comparison of the RT-qPCR and RT-LAMP assays of infected samples revealed positive results in 63 (100%) and 51 (80.95%) samples, respectively. Moreover, an analysis of uninfected samples showed that all 63 uninfected tissues yielded negative results for both the RT-qPCR and RT-LAMP assays. The cross-reactivity with five pathogens in tilapia was evaluated using RT-LAMP, and all the tests showed negative results. Both the liver and mucus samples obtained from infected fish showed comparable results using the RT-LAMP method, suggesting that mucus can be used in RT-LAMP as a nonlethal assay to avoid killing fish. In conclusion, the results demonstrated that the presented RT-LAMP assay provides an effective method for TiLV detection in tilapia tissue within 1 h. The method is therefore recommended as a screening tool on farms for the rapid diagnosis of TiLV.

Reverse Transcription Loop-Mediated Isothermal Amplification RT-LAMP Assay for the Specific and Rapid Detection of Tilapia Lake Virus

We present an RT-LAMP assay for the detection of TiLV in tilapia fish using simple instruments over a relatively short period of time compared to conventional RT-PCR techniques. This protocol may help control the epidemic spread of TiLVD, especially in developing countries.

틸라피아 호수 바이러스의 특이적이고 신속한 검출을 위한 역전사 루프 매개 등온 증폭(RT-LAMP) 분석

Tilapia lake virus disease (TiLVD), an emerging viral disease in tilapia caused by the tilapia lake virus (TiLV), is a persistent challenge in the ...

등온 증폭을 이용한 인간 호흡기 세균 감염 진단

Rapid Detection of Bacterial Pathogens Causing Lower Respiratory Tract Infections via Microfluidic-Chip-Based Loop-Mediated Isothermal Amplification

Respiratory tract infections (RTIs) are among the most common problems in clinical settings. Rapid and accurate identification of bacterial pathogens will provide practical guidelines for managing and treating RTIs. This study describes a method for rapidly detecting bacterial pathogens that cause respiratory tract infections via multi-channel loop-mediated isothermal amplification (LAMP). LAMP is a sensitive and specific diagnostic tool that rapidly detects bacterial nucleic acids with high accuracy and reliability. The proposed method offers a significant advantage over traditional bacterial culturing methods, which are time-consuming and often require greater sensitivity for detecting low levels of bacterial nucleic acids. This article presents representative results of K. pneumoniae infection and its multiple co-infections using LAMP to detect samples (sputum, bronchial lavage fluid, and alveolar lavage fluid) from the lower respiratory tract. In summary, the multi-channel LAMP method provides a rapid and efficient means of identifying single and multiple bacterial pathogens in clinical samples, which can help prevent the spread of bacterial pathogens and aid in the appropriate treatment of RTIs.

저자 스포트라이트: Advancing Rapid detection of respiratory Pathogens Using Microfluidic Chip(미세유체 칩을 사용한 호흡기 병원체의 신속한 검출 발전) 

Various bacterial pathogens can cause respiratory tract infections and lead to serious health issues if not detected accurately and treated promptly. Rapid and accurate detection of these pathogens via&#160;loop-mediated isothermal amplification provides effective management and control of respiratory tract infections in clinical settings.

Microfluidic-Chip-based Loop-Mediated Isothermal Amplification을 통해 하기도 감염을 일으키는 세균성 병원체의 신속한 검출

Respiratory tract infections (RTIs) are among the most common problems in clinical settings. Rapid and accurate identification of bacterial pathogens will ...

의 종 특이 검출을위한 루프 - 매개 등온 증폭 (LAMP) 분석 실험

요약

더 많은 비디오 탐색

야생 조류에서 조류 독감 바이러스의 신속한 진단 : 현장에서 휴대용 RRT - PCR 및 정지 - 건조 시약의 사용

조류 FTA 카드 인플루엔자 감시 : 필드 방법, Biosafety, 그리고 교통 문제 해결

멀티플렉스 등온 증폭 Zika, Chikungunya, 뎅 그 열의 1 감지 진단 플랫폼을 기반으로

기생충은 치킨 모델에서 유전 힘입어 면역 Chagas의 심장 질환을 유발

의 탐지를위한 동결 건조 루프 - 매개 등온 증폭 시약의 개발

모 세관 배열에 여러 개의 핵 산의 비주얼 검색

나노 PCR에 의한 동물 표본의 호흡기 병원체의 높은 처리량 검출

틸라피아 호수 바이러스의 특이적이고 신속한 검출을 위한 역전사 루프 매개 등온 증폭(RT-LAMP) 분석

Microfluidic-Chip-based Loop-Mediated Isothermal Amplification을 통해 하기도 감염을 일으키는 세균성 병원체의 신속한 검출

Microfluidic-Chip-based Loop-Mediated Isothermal Amplification을 통해 하기도 감염을 일으키는 세균성 병원체의 신속한 검출