The authors have no acknowledgements.

1. 분석 혼합물 준비 <ol><li> TE의 pH 8 버퍼에있는 모든 분자 수준의 물에 프라이머 및 프로브 [Entero F1A, Entero R1, GPL813TQ 12 100 μmol / L의 재고 농도를 확인; HF183-1, BthetR1, BthetP1 3]. 참고 :이 타겟 프로브는 형광 재료 / 장비 목록에 표시된 다른 형광 (7)으로 표시됩니다. </li><li> 계획 반응에 따라 혼합하여 12 μl의 디지털 PCR 믹스 마스터 믹스를 준비 0.216 ㎕를 앞으로 각 (배 재고, 자재 / 장비의 목록 참조) 프라이머, 0.06 ㎕를 각 형광 프로브를 반대하고, 클레아없는 물 μl를 5.016 (최종 농도 : 900 nM의 각각의 프라이머, 250 nM의 각 프로브). 용액에 공기 방울을 소개 않도록주의하면서 혼합 아래로 적어도 10 시간을 피펫합니다. </li><li> 6 μL의 DNA 템플릿에 혼합 일반 PCR 튜브 또는 판에, (단계 1.2에서) 피펫 18 μL 마스터 믹스 (기술은 기존과 같이 추출교활한 13) 액적 생성에 대한 분석 혼합물을 확인합니다. 중복 샘플을 실행하면, 피펫 마스터 믹스 36 μl를 잘 각각에 12 μl의 DNA 템플릿입니다. 접시에 해당하는 복제 우물이 비어 둡니다. 양성 대조군 (자재 / 장비의 목록 참조)없이 템플릿 컨트롤 (NTC를) 포함 (즉, 템플릿으로 사용되는 분자 수준의 물). 주 : 양성 대조군 분석이 올바르게 실행되고 있는지 확인하기 위해 필요하며, NTC 플레이트 내에 오염이없는 보장하고 데이터 분석 뒷부분 형광 기준선을 설정하는 것이 필요하다. 처음 사용자는 모두 원액 희석 DNA 샘플을 사용하는 것이 좋습니다. </li></ol> 2. 물방울 생성 및 PCR 플레이트 설치 <ol><li> 멀티 채널 피펫을 사용하여 아래로 약 15 시간을 피펫 팅하여 분석 혼합물을 섞는다. 피펫 팁이 혼합물 내에서 초과 거품을 방지하기 위해 액체 내에서 유지 있는지 확인합니다. </li><li> 기능ERT의 흰색 카트리지 홀더에 카트리지 1 (포함 8 우물) 카트리지 홀더 종료를 클릭합니다. 카트리지 1은 제자리에 있으며 방울을 생성하는 동안 홀더에서 빠질 수 없습니다. 멀티 채널 피펫을 사용하여 조심스럽게 기포를 도입하지 않고 카트리지 표시된 &quot;예제&quot;의 중간 위치로 분석 혼합물 20 μl를 옮긴다. </li><li> 피펫은 카트리지의 좌측 액적 생성 오일을 70 μL의 ( &#39;유&#39;로 표시). </li><li> 개스킷 개스킷과 플랫 (4)에 의해 균일하게 유지된다 확인한와 커버 카트리지는 카트리지의 가장자리를 향해 틱. 열고 카트리지를 배치 방울 생성기의 녹색 조명 버튼을 누릅니다. 를 눌러 발전기를 닫 버튼을 다시 녹색 조명. 참고 : 문이 닫히고 나면, 버튼을 흐리게 문을 다시 열 수 없으며 액적 발생 즉시 약 1 분 동안 계속 시작합니다. </li><li> 두 번째 이상 8 반응, 장소 카트리지 2 일 경우액적 생성 총 설정 시간을 저장하는 진행 중에 흰색 카트리지 홀더 및 카트리지 (1)과 동일한 방법으로 준비한다. </li><li> 희미한 조명 버튼을 액적 생성의 완료를 나타내는 녹색으로 바뀌면 방울 생성기 문을 엽니 다. 방울 생성기에 흰색 카트리지 1 포함 카트리지 홀더, 따로 설정 및 장소 카트리지 (2)를 제거합니다. </li><li> 카트리지 1 가스켓을 제거하고 폐기합니다. 부드럽게 열 사이클링 (실온에서 유지), 최종 PCR 플레이트에 카트리지 ( &#39;물방울&#39;로 표시)의 세 번째 열에서 생성 된 방울의 전체 부피 (약 40 μL)를 옮긴다. 참고 : 새로 생성 된 물방울을 깰 수있는 작업으로 흰색 카트리지 홀더를 해제합니다하지 마십시오 방울 최종 판에 전사 된 후에 만​​ 카트리지 홀더를 연다. </li><li> 반복하여 추가 샘플에 대한 2.1-2.7 단계를 반복합니다. </li><li> 모든 방울 최종 PCR 플레이트되면 뚫을 배치접시 위에 호일 커버와 접시 시일에 놓습니다. 실러에 180 ° C 키를 눌러 &#39;재생&#39;에 대한 봉인을 설정하고 10 초 동안 실을 수 있습니다. </li></ol> 3. 열 사이클링과 물방울 읽기 <ol><li> 열 사이 클러에 밀봉 판을 놓고, 단계 2.7에서 사용 된 최종 PCR 플레이트, 2.0 ° C / sec의 온도 램핑 속도에 대응 한. </li><li> 다음 열 프로그램을 실행하여 10 분간 유지 한 다음 94 ℃에서 30 초, 95 ° C에서 10 분, 60 ° C에서 60 초 선택적 98 ° C (AT : 최종 보류 4 또는 15 ° C). </li><li> 사이클 종료 후, 각 웰에 각각의 액적에서 형광의 자동 측정을위한 액적 리더 플레이트를 옮긴다. 또한, 액적 읽기 전에 최대 3 일 동안 4 ° C에서 접시를 저장합니다. 물방울 읽기를 진행하기 전에 실온에 있는지 확인. <ol><li> 설정에 방울 독서를 동반하는 소프트웨어를 엽니 다. 에서&#39;샘플&#39;, &#39;분석 1&#39;과 &#39;분석 2.&#39;빈 96 웰 플레이트의 개략적 인을 포함하는 기본 &#39;설정&#39;메뉴는 두 번 세 부분을 포함하는 메뉴를 엽니 다 잘 A1을 클릭 </li><li> &#39;샘플&#39;섹션에서 &#39;이름&#39;키를 누릅니다 입력하거나 표시 오른쪽에있는 상자를 확인 표시된 상자에 샘플 ID를 입력합니다 &#39;적용을.&#39; 다음, 메뉴 표시 &#39;실험&#39;드롭 다운을 클릭하고 &#39;RED&#39;(희귀 이벤트 감지)를 선택하고 입력을 클릭합니다. </li><li> &#39;분석 1.&#39;표시 부분으로 이동 &#39;이름&#39;섹션에서 분석 (예를 들어, 엔테로)를 작성하여 입력을 클릭합니다. 라벨 &#39;형식&#39;아래 상자에서 드롭 다운 메뉴를 클릭하고 &#39;채널 알 수없는 1&#39;을 선택하고 입력을 클릭합니다. </li><li> &#39;분석 2.&#39;표시 부분으로 이동 &#39;이름&#39;섹션에서 분석 (예 : HF183)를 작성하여 입력을 클릭합니다. 라벨 &#39;형식&#39;아래 상자에 메뉴 드롭 다운을 클릭&#39;채널 알 수없는 2&#39;를 선택하고 입력을 클릭 거라고. 3.3.4에 3.3.2 지금 단계에서 모든 정보는 잘 A1에서 제시한다. </li><li> 방울을 포함하는 모든 후속 우물의 이름을 지정합니다. 총 설치 시간을 절약하기 위해 동시에 여러 우물을 선택하는 &#39;시프트&#39;또는 &#39;Ctrl 키를,&#39;을 클릭합니다. </li><li> 판의 디지털 묘사 메뉴의 오른쪽 하단에 물리적 판을 눌러 &#39;OK&#39;를 반영합니다. &#39;템플릿&#39;섹션 아래에있는 판 회로도의 상단에 표시되는 새 메뉴에서 &#39;다른 이름으로 저장&#39;와 이름을 선택하고 판을 저장합니다. </li><li> 화면의 왼쪽에있는 &#39;실행&#39;을 클릭하고 팝업 아웃 &quot;실행 옵션&quot;창에 적절한 염료 설정을 선택합니다. 데이터 수집 시작하고 소프트웨어에서 실시간으로 표시됩니다. </li></ol></li></ol> 4. 데이터 분석 및보고 <ol><li> 독자가 완료되고 상자 &#39;완벽한 실행&#39;라는 나타나면 &#39;확인&#39;을 클릭합니다. 참고 : 소프트도자기는 소프트웨어의 &#39;분석&#39;섹션에서 최종 데이터 파일을 표시합니다. 이 관점에서, 소프트웨어는 &#39;2D 진폭의 데이터 플롯에 선택한 모든 접시에 우물과 기본값을 가지고있다. </li><li> 양극과 음극 방울 사이의 거리를 확인합니다. NTC 우물에있는 모든 방울의 형광베이스 라인 근처에 있는지 확인합니다. </li><li> 표시된 버튼을 클릭 &#39;이벤트.&#39; 제시된 막대 그래프의 오른쪽에 &#39;총&#39;라는 이름의 상자 당 잘 받아 방울의 총 수를 표시하기 위해 하단에있는 &quot;하나&quot;라는 이름의 상자를 클릭합니다. Ctrl 키를 누른 제외 할 잘 (들)을 클릭하여 &lt;10,000 방울 (7)를 포함하는 모든 우물을 제외합니다. </li><li> 모두 타겟 NTC 우물에 부정적인 방울 위의 약 하나의 표준 편차 (500-700 형광 단위)에서 형광 임계 값을 설정하는 &#39;1D 진폭&#39;로 표시 버튼을 클릭합니다. 화면 유엔의 바로 왼쪽에두 개의 임계 버튼을 보여주는 &#39;자동 분석&#39;그것을 통해 실행하는 솔리드 핑크 수평 라인이 오른쪽에있는 아이콘을 선택 데르. </li><li> 진폭 그래프의 각에서 &#39;설정 임계 값&#39;의 왼쪽에있는 상자를 클릭하고 적절한 형광 임계 값을 입력합니다. μL 반응 당 복사본 목표 농도를 자동적으로 계산된다. 주 : 임계 값 다른 표적에 대해 동일 할 필요는 없다. </li><li> 1D 진폭 화면의 왼쪽 상단 모서리에있는 &#39;내보내기&#39;버튼을 클릭하여 .csv 파일에 결과를 보냅니다. .csv 파일에서 DNA 템플릿 μL 당 대상의 복사 ㎕의 반응에 따라 대상의 사본 (엔테로 종의 23S 유전자. 또는 HF183 마커)에서 변환 (4)에 의해 수출 목표 농도를 곱합니다. </li></ol>

<ol>
	<li>Boehm, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+forty-one+microbial+source+tracking+methods:+A+twenty-seven+lab+evaluation+study.">Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study.</a> Water Res. 47 (18), 6812-6828 (2013).</li><li>Layton, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+human+fecal+anaerobe-associated+PCR-based+assays+in+a+multi-laboratory+method+evaluation+study.">Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study.</a> Water Res. 47 (18), 6897-6908 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+platform,+reference+material,+and+quantification+model+on+enumeration+of+Enterococcus+by+quantitative+PCR+methods.">Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods.</a> Water Res. 47 (1), 233-241 (2013).</li><li>Sivaganesan, M., Siefring, S., Varma, M., Haugland, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MPN+estimation+of+qPCR+target+sequence+recoveries+from+whole+cell+calibrator+samples.">MPN estimation of qPCR target sequence recoveries from whole cell calibrator samples.</a> J. Microbiol. Methods. 87 (3), 343-349 (2011).</li><li>Huggett, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Digital+MIQE+Guidelines:+Minimum+Information+for+Publication+of+Quantitative+Digital+PCR+Experiments.">The Digital MIQE Guidelines: Minimum Information for Publication of Quantitative Digital PCR Experiments.</a> Clin. Chem. 59 (6), 892-902 (2013).</li><li>Cao, Y., Raith, M. R., Griffith, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+digital+PCR+for+simultaneous+quantification+of+general+and+human-associated+fecal+indicators+for+water+quality+assessment.">Droplet digital PCR for simultaneous quantification of general and human-associated fecal indicators for water quality assessment.</a> Water Res. 70, 337-349 (2015).</li><li>Sanders, R., Huggett, J. F., Bushell, C. A., Cowen, S., Scott, D. J., Foy, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+Digital+PCR+for+Absolute+DNA+Quantification.">Evaluation of Digital PCR for Absolute DNA Quantification.</a> Anal. Chem. 83 (17), 6474-6484 (2011).</li><li>Whale, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+microfluidic+digital+PCR+and+conventional+quantitative+PCR+for+measuring+copy+number+variation.">Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation.</a> Nucleic Acid Res. 40 (11), 82-89 (2012).</li><li>Hindson, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+quantification+by+droplet+digital+PCR+versus+analog+real-time+PCR.">Absolute quantification by droplet digital PCR versus analog real-time PCR.</a> Nature Methods. 10 (10), 1003-1005 (2013).</li><li>Morisset, D., &#352;tebih, D., Milavec, M., Gruden, K., &#381;el, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+food+and+feed+aamples+with+droplet+digital+PCR.">Quantitative analysis of food and feed aamples with droplet digital PCR.</a> PLoS One. 8 (5), e62583 (2013).</li><li>Cao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+molecular+community+analysis+methods+for+discerning+fecal+sources+and+human+waste.">Evaluation of molecular community analysis methods for discerning fecal sources and human waste.</a> Water Res. 47 (18), 6862-6872 (2013).</li></ol>

The authors declare that they have no competing financial interests.

프로토콜에서 몇 가지 중요한 단계가 있습니다. 마스터 믹스 종래 qPCR의 마스터 믹스보다 점성이기 때문에 먼저, 분석 혼합물의 혼합은 어렵다. 간단한 텍싱 차례로 분석 혼합물에이어서 방울에 DNA 템플릿의 비 균일 한 분포로 연결 불충분 한 혼합, 발생할 수 있습니다. 프로토콜에 설명 된 혼합 별 피펫 팅 기술은 정확한 dPCR 정량을 보장하기 위해 따라야합니다. 둘째, 물방울이 균일 한 형태와 크...

들이보다 빠르고 유연하고 전통 문화 기반 방법에 비해 특정한 때문에 정량적 PCR (qPCR에) 방법이 널리 오락 수질 모니터링 및 미생물 소스 추적 애플리케이션에 사용되어왔다. 따라서, qPCR에이 같은 엔테로 종으로 일반 배설물 지표에 대한 신속한 물 모니터링 결과를 달성하는 것이 좋습니다. 개정 USEPA 레크리에이션 수질 기준 1. 대부분의 qPCR 분석은 개발 환경이 물에 분변 오염의 소스를 식별하기위한 검증되었다. 이들 중에서도 HF183 마커 분석은 가장 자주 인간 분변 오염 연관된 3 식별하는데 사용들이다. 그들이 정량 표준 곡선에 의존하기 때문에, qPCR의 결과는 종종 편향 될 수있다. qPCR에는 스탠에서 자신의 정량주기 (Cq와)를 보간하여 샘플 대상의 알 수없는 농도를 정량화Cq와와 직렬로 희석 된 표준 세트의 로그 양 사이에 선형 관계를 설명 바 닥 곡선. 안정적이고 일관된 표준 참조 물질의 부족 때문에 크게 qPCR에 결과를 바이어스 할 수 있습니다. 연구 qPCR의 결과가 서로 다른 공급 업체의 4에서 약 절반 로그 사용 기준에 차이와 같은 공급 업체 5 표준의 다른 배치를 사용하여 2 배에 의해 것으로 나타났다. 디지털 PCR (dPCR) 기술은 균일 한 나노 리터 또는 피코 리터 반응 6 수천 또는 수백만 벌크 qPCR의 분할에 의해 생성 된 소형 PCR들의 다수의 긍정의 빈도를 카운트하여 미지 시료를 정량화한다. 파티션이 물 유 방울 (즉,이 문서) 또는 칩에 작은 챔버 경우 그것은 각각 (즉,이 문서) 방울 디지털 PCR 또는 챔버 디지털 PCR로 언급된다. 높은 샘플 농도는 대상 DNA의 존재를 야기 할파티션의 높은 비율 (따라서 긍정적 인 PCR), 포아송 분포로 근사 관계. 이와 같이, 이진 결과 (양 또는 음 PCR)이 기록되어 포지티브 액적 주파수 qPCR에 같이 표준 곡선에 대한 필요성을 제거 직접 포아송 근사 통해 미지의 샘플 농도를 계산하는데 사용된다. 디지털 PCR 정량이 진 본성은 qPCR에 7 위에 추가 이점을 제공한다. 지연 증폭 여전히 양성 PCR을 수득 할 수 있기 때문에, dPCR 정량화는 증폭 효율을 감소 억제에 대해 더 강력하다. qPCR에 8 ~ 10에 비해 dPCR 높은 정밀도로 이어지는, qPCR에있다 마찬가지로, dPCR 정량이 된 CQ 값의 변동에 의해 영향을받지 않습니다. 또한, 분할 프로세스는 효과적으로 amplificatio 동안 (기판의 경쟁을 최소화하는 각 방울에 타겟 DNA에 존재하는 매우 소량 보장qPCR에에 (즉, 분석이 동시에 두 개의 DNA 목표를 측정) 양면 인쇄를 달성하기위한 일반적인 장애물 서로 다른 DNA 대상)의 n은. 따라서, 양면 또는 단면에 실행 (즉 하나의 대상이 하나의 분석에서 측정) 여부를 dPCR 모두 대상 7,11의 거의 구별 정량을 생산하고 있습니다. 이 문서에서 설명하는 디지털 PCR 분석 (EntHF183 dPCR)의 목표는 일반 배설물 표시 엔테로 종의 동시 직접 정량화를 얻을 수 있습니다. 향상된 정밀도, 재현성 및 억제에 대한 견고성과 인간 배설물 관련 HF183 마커는 qPCR에 비교 대응. 이 분석은 성공적 환경 담수, 해수 및 각종 분뇨 7 분변 오염의 정량을 위해 사용되었지만, 또한 물 및 폐수의 다른 유형에도 적용될 수있다. 이 분석은 때문에 그것을 퇴적물 또는 토양 분석을위한 큰 약속을 보유하고억제에 높은 내성을이야,하지만 억제제는 샘플의 이러한 종류의 혼합의 추가 시험 때문에 복잡성 요구된다.

<table border="0" cellpadding="0" cellspacing="0" width="1361">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Low Bind Microtubes</td>
			<td style="width:84px;">Costar</td>
			<td style="width:439px;">3207</td>
			<td style="width:575px;">For storage of reagents, samples/production of master mixes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Nuclease Free Water</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2484-50</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">TE pH 8 buffer</td>
			<td style="width:84px;">FisherSci</td>
			<td style="width:439px;">BP2473-100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Hardshell 96 Well Plate</td>
			<td style="width:84px;">BioRad</td>
			<td>HSP-9601</td>
			<td>For initial master mix and sample inoculation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Aluminum Sealing Film</td>
			<td style="width:84px;">BioRad</td>
			<td>359-0133</td>
			<td>To seal sample plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generator</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3002</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Generation Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3005</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Cartridge</td>
			<td style="width:84px;">BioRad</td>
			<td>186-4008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">DG8 Cartridge Holder</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3051</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Gasket</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3009</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">20uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L10F</td>
			<td>For tansferring sample/master mix to cartidge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">200uL pipet tips</td>
			<td style="width:84px;">Rainin</td>
			<td style="width:439px;">GP-L200F</td>
			<td>For transferring droplets to final Twin.Tec Plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Twin.Tec 96 Well Plate</td>
			<td style="width:84px;">Eppendorf</td>
			<td style="width:439px;">951020320</td>
			<td>For final droplets thermal cycling and reading</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Pierceable Heat Seal Foil</td>
			<td style="width:84px;">BioRad</td>
			<td>181-4040</td>
			<td>To seal Twin.Tec plate before thermalcycling</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">PX1 PCR Plate Sealer</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">181-4000</td>
			<td>Only the thermal cycler is needed, no optics</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">CFX96 Thermalcycler</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">CFX96 and C1000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">QX100 Droplet Reader</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Droplet Reader Oil</td>
			<td style="width:84px;">BioRad</td>
			<td>186-3004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Droplet PCR Supermix&#160;</td>
			<td style="width:84px;">BioRad</td>
			<td style="width:439px;">186-3024</td>
			<td>i.e. the digital PCR mix in manuscript</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QuantaSoft software (v1.3.2)</td>
			<td style="width:84px;">Quantasoft&#160;</td>
			<td style="width:439px;">QX100&#160;</td>
			<td>For viewing, analyzing, and exporting ddPCR data</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Forward Primer (Ent F1A)</td>
			<td style="width:84px;">Operon</td>
			<td>GAGAAATTCCAAACGAACTTG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Reverse Primer (Ent R1)</td>
			<td style="width:84px;">Operon</td>
			<td>CAGTGCTCTACCTCCATCATT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">Entero Probe (GPL813TQ)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-FAM]-TGG TTC TCT CCG AAA TAG CTT TAG GGC TA-[BHQ1]</td>
			<td>Alternative vendor can be used, but the florophore has to be FAM</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Forward Primer (HF183-1)</td>
			<td style="width:84px;">Operon</td>
			<td>ATCATGAGTTCACATGTCCG</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:265px;">HF183 Reverse Primer (BthetR1)</td>
			<td style="width:84px;">Operon</td>
			<td>CGTAGGAGTTTGGACCGTGT</td>
			<td>Alternative vendor can be used</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:265px;">HF183 Probe (BthetP1)</td>
			<td style="width:84px;">Operon</td>
			<td>[6-HEX]-CTGAGAGGAAGGTCCCCC 
			ACATTGGA-[BHQ1]</td>
			<td style="width:575px;">Alternative vendor can be used, but the florophore has to be HEX (if using VIC, then the appropriate matric compensation must be chosen.&#160;</td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:265px;">Positive control</td>
			<td style="width:84px;"></td>
			<td style="width:439px;"></td>
			<td style="width:575px;">Mixture of E.faecalius genomic DNA and HF183 standard plasmid (ordered from IDT). For detailed methods in culturing E. faecalius and sequences of the ordered HF183 plasmid, please see Cao et al 2015 (doi:10.1016/j.watres.2014.12.008). Commercilaly available Enterococcus DNA standards (ATCC 29212Q-FZ) can also be used in the positive control in place of lab-prepared E. faecalis genomic DNA.</td>
		</tr>
	</tbody>
</table>

a duplex digital pcr assay for simultaneous quantification of the enterococcus spp. and the human fecal-associated hf183 marker in waters

이 원고는 엔테로 종의 동시 정량. 인간 배설물 관련 HF183 마커에 대한 이중 디지털 PCR 분석 (EntHF183 dPCR)에 대해 설명합니다. EntHF183 이중 dPCR (EntHF183 dPCR로 함 이에 관해서) 분석은 공개 된 개별 정량 PCR (qPCR에) 대응과 같은 프라이머 및 프로브 시퀀스를 사용합니다. 마찬가지로, 이전 qPCR에 대해 수행과 같은 물 여과 및 DNA 추출 절차는 dPCR를 실행하기 전에 다음에 있습니다. 그러나, 이중 dPCR 분석은 qPCR에 분석을 통해 몇 가지 장점이 있습니다. 가장 중요한 dPCR 분석은 대상의 직접 정량화하여, 따라서 표준 곡선을 실행에 대한 필요성, 관련 바이어스 및 가변성을 제거합니다. qPCR에있는 (즉, 동시 정량) 엔테로 및 HF183를 양면 인쇄하는 동안뿐만 아니라, 종종 샘플 덜 풍부한 대상의 심각한 과소 평가로 연결, dPCR 두 목표의 일관성 정량을 제공하며, 자극그녀는 동일한 반응을 개별적으로 또는 동시에 정량. dPCR 분석도 qPCR에 의해 용인보다 높은 크기 1 ~ 2 오더이다 PCR 억제제의 농도를 허용 할 수있다. 그것은 동시에 두 개의 별도 qPCR에 분석을 실행할 필요없이 환경 바다에서 모두 일반과 인간의 관련 분변 오염에 대한 정확하고 반복 가능한 정보를 제공하기 때문에 이러한 장점은 EntHF183 dPCR 분석이 특히 매력적. qPCR에 이상 장점에도 불구하고, 현재 사용 가능한 장비와 dPCR 분석의 상부 정량 한계는 약 qPCR에 의한 달성보다 낮은 크기의 네 주문이다. 따라서, 희석 등의 일반적으로 하수 유출이 관찰 된 것과 대상 생물의 높은 농도의 측정을 위해 요구된다.

좋은 EntHF183 이중 dPCR 실행 허용 방울 (약 10,000-17,000) 및 음과 양의 물방울 7 형광 값 사이의 비교적 큰 차이 (약 5,000)의 상대적으로 높은 숫자가 발생한다. 방울의 수가 비정상적으로 낮은 가능성 액적 생성 공정에서 문제를 나타내고, 만 방울의 차단이 문서에서 사용되는 액적 dPCR 시스템으로부터 경험적 데이터에 기초하여 제시된다. 양극과 음극 방?...

Watch this Scientific Journal Video about A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters at JoVE.com

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

이 원고를 동시에 엔테로 종을 정량화하는 데 사용할 수있는 이중 디지털 PCR 분석. 레크리에이션 바다에서 일반과 인간의 관련 분변 오염의 지표로 HF183 유전자 마커를 설명합니다.

동시 정량을위한 이중 디지털 PCR 분석<em&gt; 엔테로 종.</em&gt;과 바다에서 인간 방패 관련 HF183 마커

This manuscript describes a duplex digital PCR assay (EntHF183 dPCR) for simultaneous quantification of Enterococcus spp. and the human fecal-associated ...

a-duplex-digital-pcr-assay-for-simultaneous-quantification

Research

JoVE Journal

Environment

A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

9.7K 조회수.  Southern California Costal Water Research Project Authority.  이 원고를 동시에 엔테로 종을 정량화하는 데 사용할 수있는 이중 디지털 PCR 분석. 레크리에이션 바다에서 일반과 인간의 관련 분변 오염의 지표로 HF183 유전자 마커를 설명합니다. 

비디오: A Duplex Digital PCR Assay for Simultaneous Quantification of the Enterococcus spp. and the Human Fecal-associated HF183 Marker in Waters

Determination of Microbial Extracellular Enzyme Activity in Waters, Soils, and Sediments using High Throughput Microplate Assays

Much of the nutrient cycling and carbon processing in natural environments occurs through the activity of extracellular enzymes released by microorganisms. Thus, measurement of the activity of these extracellular enzymes can give insights into the rates of ecosystem level processes, such as organic matter decomposition or nitrogen and phosphorus mineralization. Assays of extracellular enzyme activity in environmental samples typically involve exposing the samples to artificial colorimetric or fluorometric substrates and tracking the rate of substrate hydrolysis. Here we describe microplate based methods for these procedures that allow the analysis of large numbers of samples within a short time frame. Samples are allowed to react with artificial substrates within 96-well microplates or deep well microplate blocks, and enzyme activity is subsequently determined by absorption or fluorescence of the resulting end product using a typical microplate reader or fluorometer. Such high throughput procedures not only facilitate comparisons between spatially separate sites or ecosystems, but also substantially reduce the cost of such assays by reducing overall reagent volumes needed per sample.

Microplate based procedures are described for the colorimetric or fluorometric analysis of extracellular enzyme activity. These procedures allow for the rapid assay of such activity in large numbers of environmental samples within a manageable time frame.

높은 처리량 마이크로 분석 실험을 사용하여 워터스, 토양 및 퇴적물에있는 미생물 세포 외 효소 활성의 결정

Much of the nutrient cycling and carbon  processing in natural environments occurs through the activity of extracellular  enzymes released by ...

연구

환경과학

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of agricultural waters. Here, water is filtered through sterile Modified Moore Swabs (MMS), which consist&#160;of a simple gauze filter enclosed in a plastic cartridge, to concentrate bacteria. Following filtration, non-selective or selective enrichments for the target bacteria are performed in the MMS. For colorimetric detection of the target bacteria, the enrichments are then assayed using paper-based analytical devices (&#181;PADs) embedded with bacteria-indicative substrates. Each substrate reacts with target-indicative bacterial enzymes, generating colored products that can be detected visually (qualitative detection) on the &#181;PAD. Alternatively, digital images of the reacted &#181;PADs can be generated with common scanning or photographic devices and analyzed using ImageJ software, allowing for more objective and standardized interpretation of results. Although the biochemical screening procedures are designed to identify the aforementioned bacterial pathogens, in some cases enzymes produced by background microbiota or the degradation of the colorimetric substrates may produce a false positive. Therefore, confirmation using a more discriminatory diagnostic is needed. Nonetheless, this bacterial concentration and detection platform is inexpensive, sensitive (0.1 CFU/ml detection limit), easy to perform, and rapid (concentration, enrichment, and detection are performed within approximately 24&#160;hr), justifying its use as an initial screening method for the microbiological quality of agricultural water.

Colorimetric Paper-based Detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from Large Volumes of Agricultural Water

A protocol involving integrated concentration, enrichment, and end-point colorimetric detection of foodborne pathogens in large volumes of agricultural water is presented here. Water is filtered through Modified Moore Swabs (MMS), enriched with selective or non-selective media, and detection is performed using paper-based analytical devices (&#181;PAD) imbedded with bacterial-indicative colorimetric substrates.

색도계 탐지의 종이 기반의<em&gt; 대장균</em&gt;<em&gt; 살모넬라</em&gt; SPP., 그리고<em&gt; 리스테리아</em&gt; 농업 다량의 물에서

This protocol describes rapid colorimetric detection of Escherichia coli, Salmonella spp., and Listeria monocytogenes from large volumes (10 L) of ...

Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with &#39;end-point&#39; PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included.

A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. The methodology includes the co-extraction of DNA and RNA; preparation of DNA-free RNA; and 16S rRNA gene and transcript quantification via RT-q-PCR, including standard curve construction.

실시간 PCR에 의한 연안 퇴적물 및 정량 16S의 rRNA의 유전자 및 성적 증명서에서 동시 DNA-RNA 추출

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of ...

Clean Sampling and Analysis of River and Estuarine Waters for Trace Metal Studies

Most of the trace metal concentrations in ambient waters obtained a few decades ago have been considered unreliable owing to the lack of contamination control. Developments of some techniques aiming to reduce trace metal contamination in the last couple of decades have resulted in concentrations reported now being orders of magnitude lower than those in the past. These low concentrations often necessitate preconcentration of water samples prior to instrumental analysis of samples. Since contamination can appear in all phases of trace metal analyses, including sample collection (and during preparation of sampling containers), storage and handling, pretreatments, and instrumental analysis, specific care needs to be taken in order to reduce contamination levels at all steps. The effort to develop and utilize "clean techniques" in trace metal studies allows scientists to investigate trace metal distributions and chemical and biological behavior in greater details. This advancement also provides the required accuracy and precision of trace metal data allowing for environmental conditions to be related to trace metal concentrations in aquatic environments.
This protocol that is presented here details needed materials for sample preparation, sample collection, sample pretreatment including preconcentration, and instrumental analysis. By reducing contamination throughout all phases mentioned above for trace metal analysis, much lower detection limits and thus accuracy can be achieved. The effectiveness of "clean techniques" is further demonstrated using low field blanks and good recoveries for standard reference material. The data quality that can be obtained thus enables the assessment of trace metal distributions and their relationships to environmental parameters.

Special care using "clean techniques" is required to properly collect and process water samples for trace metal studies in aquatic environments. A protocol for sampling, processing, and analytical procedures with the aim of obtaining reliable environmental monitoring data and results with high sensitivity for detailed trace metal studies is presented.

클린 샘플링 및 추적 금속 연구 강 하구 바다의 분석

Most of the trace metal concentrations in ambient waters obtained a few decades ago have been considered unreliable owing to the lack of contamination ...

Protocol for Microplastics Sampling on the Sea Surface and Sample Analysis

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of scientific publications address microplastic pollution of the sea surface. The protocol below describes the methodology for sampling, sample preparation, separation and chemical identification of microplastic particles. A manta net fixed on an &#187;A frame&#171; attached to the side of the vessel was used for sampling. Microplastic particles caught in the cod end of the net were separated from samples by visual identification and use of stereomicroscopes. Particles were analyzed for their size using an image analysis program and for their chemical structure using ATR-FTIR and micro FTIR spectroscopy. The described protocol is in line with recommendations for microplastics monitoring published by the Marine Strategy Framework Directive (MSFD) Technical Subgroup on Marine Litter. This written protocol with video guide will support the work of researchers that deal with microplastics monitoring all over the world.

The protocol below describes the methodology for: microplastics sampling on the sea surface, separation of microplastic and chemical identification of particles. This protocol is in line with the recommendations for microplastics monitoring published by the MSFD Technical Subgroup on Marine Litter.

바다 표면 및 샘플 분석에 Microplastics 샘플링을위한 프로토콜

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of ...

Extraction of Organochlorine Pesticides from Plastic Pellets and Plastic Type Analysis

Plastic resin pellets, categorized as microplastics (&#8804;5 mm in diameter), are small granules that can be unintentionally released to the environment during manufacturing and transport. Because of their environmental persistence, they are widely distributed in the oceans and on beaches all over the world. They can act as a vector of potentially toxic organic compounds (e.g., polychlorinated biphenyls) and might consequently negatively affect marine organisms. Their possible impacts along the food chain are not yet well understood. In order to assess the hazards associated with the occurrence of plastic pellets in the marine environment, it is necessary to develop methodologies that allow for rapid determination of associated organic contaminant levels. The present protocol describes the different steps required for sampling resin pellets, analyzing adsorbed organochlorine pesticides (OCPs) and identifying the plastic type. The focus is on the extraction of OCPs from plastic pellets by means of a pressurized fluid extractor (PFE) and on the polymer chemical analysis applying Fourier Transform-InfraRed (FT-IR) spectroscopy. The developed methodology focuses on 11 OCPs and related compounds, including dichlorodiphenyltrichloroethane (DDT) and its two main metabolites, lindane and two production isomers, as well as the two biologically active isomers of technical endosulfan. This protocol constitutes a simple and rapid alternative to existing methodology for evaluating the concentration of organic contaminants adsorbed on plastic pieces.

Microplastics act as vector of potentially toxic organic contaminants with unpredictable effects. This protocol describes an alternative methodology for assessing the levels of organochlorine pesticides adsorbed on plastic pellets and identifying the polymer chemical structure. The focus is on pressurized fluid extraction and attenuated total reflectance Fourier transform infrared spectroscopy.

플라스틱 펠렛 및 플라스틱 유형 분석에서 유기 염소 농약의 추출

Plastic resin pellets, categorized as microplastics (&#8804;5 mm in diameter), are small granules that can be unintentionally released to the environment ...

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Citrus greening, also known as huanglongbing, is a destructive citrus disease ravaging citrus farms globally. This disease causes asymmetrical yellow leaf mottling, vein yellowing, defoliation, root decay, and ultimately, the death of the citrus plant. When infected, the citrus plants have stunted growth and produce flowers out of season. These flowers rarely yield fruit, and those that do yield small, bitter, irregularly shaped citrus fruit that are not desirable. This disease is spread by the Asian citrus psyllid, Diaphorina citri, and by the grafting of infected citrus tissue. The pathogen has a long and variable incubation period within the citrus plant&#8212;sometimes years, before symptoms appear. Attempts to culture this pathogen in vitro have been unsuccessful, possibly due to the low and uneven concentration of the pathogen within infected citrus tissue, or because it is difficult to replicate the environmental conditions conducive to growth of the pathogen. It is very difficult to identify the disease before it has spread, due to its long incubation period and researchers&#39; inability to culture the pathogen. As a result, the disease only becomes apparent after suddenly destroying a citrus farmer&#39;s entire yield. Presented here is a method for the accurate and specific detection of the citrus greening pathogen, Candidatus liberibacter spp. using a genomic DNA extraction kit and PCR. This method is simple, efficient, cost effective, and adaptable for quantitative analysis. This method can be adapted for use on any citrus tissue; however, it is potentially limited by the amount of pathogen present in the tissue. Nevertheless, this method will allow citrus farmers to identify infected citrus plants earlier, and curb the spread of this destructive disease before it can further spread.

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter  spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Citrus Greening is a particularly destructive disease affecting citrus crops globally. Presented here is a simple method using PCR and genomic DNA extraction of citrus leaf tissue for the accurate and precise identification of the citrus greening pathogen, Candidatus liberibacter spp.

특정 및 감귤 류 녹화 병원 체 Candidatus liberibacter 종 감귤 잎 조직 샘플에서 사용 하 여 기존의 PCR의 정확한 검출

Citrus greening, also known as huanglongbing, is a destructive citrus disease ravaging citrus farms globally. This disease causes asymmetrical yellow leaf ...

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus (Murayama), Using a Low-Cost, Small, and Easily Constructed Flight Mill

The ambrosia beetle, Platypus quercivorus (Murayama), is the vector of a fungal pathogen that causes mass mortality of Fagaceae trees (Japanese oak wilt). Therefore, knowing the dispersal capacity may help inform trapping/tree removal efforts to prevent this disease more effectively. In this study, we measured the flight velocity and duration and estimated the flight distance of the beetle using a newly developed flight mill. The flight mill is low cost, small, and constructed using commonly available items. Both the flight mill arm and its vertical axis comprise a thin needle. A beetle specimen is glued to one tip of the arm using instant glue. The other tip is thick due to being covered with plastic, thus it facilitates the detection of rotations of the arm. The revolution of the arm is detected by a photo sensor mounted on an infrared LED, and is indicated by a change in the output voltage when the arm passed above the LED. The photo sensor is connected to a personal computer and the output voltage data are stored at a sampling rate of 1 kHz. By conducting experiments using this flight mill, we found that P. quercivorus can fly at least 27 km. Because our flight mill comprises cheap and small ordinary items, many flight mills can be prepared and used simultaneously in a small laboratory space. This enables experimenters to obtain a sufficient amount of data within a short period.

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus Murayama, Using a Low-Cost, Small, and Easily Constructed Flight Mill

We developed a low cost and small flight mill, constructed with commonly available items and easily used in experimentation. Using this apparatus, we measured the flight ability of an ambrosia beetle, Platypus quercivorus.

저가, 소형, 그리고 쉽게 생성 된 비행 밀을 사용 하 여 신들의 딱정벌레, 오리너구리 Quercivorus (무라야마)의 비행 능력을 측정

The ambrosia beetle, Platypus quercivorus (Murayama), is the vector of a fungal pathogen that causes mass mortality of Fagaceae trees (Japanese oak wilt). ...

Harvesting Venom Toxins from Assassin Bugs and Other Heteropteran Insects

Heteropteran insects such as assassin bugs (Reduviidae) and giant water bugs (Belostomatidae) descended from a common predaceous and venomous ancestor, and the majority of extant heteropterans retain this trophic strategy. Some heteropterans have transitioned to feeding on vertebrate blood (such as the kissing bugs, Triatominae; and bed bugs, Cimicidae) while others have reverted to feeding on plants (most Pentatomomorpha). However, with the exception of saliva used by kissing bugs to facilitate blood-feeding, little is known about heteropteran venoms compared to the venoms of spiders, scorpions and snakes.
One obstacle to the characterization of heteropteran venom toxins is the structure and function of the venom/labial glands, which are both morphologically complex and perform multiple biological roles (defense, prey capture, and extra-oral digestion). In this article, we describe three methods we have successfully used to collect heteropteran venoms. First, we present electrostimulation as a convenient way to collect venom that is often lethal when injected into prey animals, and which obviates contamination by glandular tissue. Second, we show that gentle harassment of animals is sufficient to produce venom extrusion from the proboscis and/or venom spitting in some groups of heteropterans. Third, we describe methods to harvest venom toxins by dissection of anaesthetized animals to obtain the venom glands. This method is complementary to other methods, as it may allow harvesting of toxins from taxa in which electrostimulation and harassment are ineffective. These protocols will enable researchers to harvest toxins from heteropteran insects for structure-function characterization and possible applications in medicine and agriculture.

Although many insects in the suborder Heteroptera (Insecta: Hemiptera) are venomous, their venom composition and the functions of their venom toxins are mostly unknown. This protocol describes methods to harvest heteropteran venoms for further characterization, using electrostimulation, harassment, and gland dissection.

독 독 소 암살자 버그와 다른 Heteropteran 곤충에서 수확

Heteropteran insects such as assassin bugs (Reduviidae) and giant water bugs (Belostomatidae) descended from a common predaceous and venomous ancestor, ...

A High-throughput Assay for the Prediction of Chemical Toxicity by Automated Phenotypic Profiling of Caenorhabditis elegans

Applying toxicity testing of chemicals in higher order organisms, such as mice or rats, is time-consuming and expensive, due to their long lifespan and maintenance issues. On the contrary, the nematode Caenorhabditis elegans (C. elegans) has advantages to make it an ideal choice for toxicity testing: a short lifespan, easy cultivation, and efficient reproduction. Here, we describe a protocol for the automatic phenotypic profiling of C. elegans in a 384-well plate. The nematode worms are cultured in a 384-well plate with liquid medium and chemical treatment, and videos are taken of each well to quantify the chemical influence on 33 worm features. Experimental results demonstrate that the quantified phenotype features can classify and predict the acute toxicity for different chemical compounds and establish a priority list for further traditional chemical toxicity assessment tests in a rodent model.

A High-throughput Assay for the Prediction of Chemical Toxicity by Automated Phenotypic Profiling of Caenorhabditis elegans

A quantitative method has been developed to identify and predict the acute toxicity of chemicals by automatically analyzing the phenotypic profiling of Caenorhabditis elegans. This protocol describes how to treat worms with chemicals in a 384-well plate, capture videos, and quantify toxicological related phenotypes.

꼬마 선 충 의 프로 파일링 Phenotypic 자동화 하 여 화학 독성의 예측에 대 한 높은 처리량 분석 결과

Applying toxicity testing of chemicals in higher order organisms, such as mice or rats, is time-consuming and expensive, due to their long lifespan and ...