This work was supported by a National Science Foundation Grant NSF-MCB1243645 (JZT), any opinions, findings, and conclusions or recommendations expressed in this material are those of the authors and do not necessarily reflect the views of the National Science Foundation. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

주 : 관심있는 단백질을 유도 LAP 태깅 안정한 세포주의 생성의 개요는도 1에 도시되어 LAP 표지 된 단백질의 발현, 정제 및 질량 단백체 준비의 개요가도 3에 도시되어 분석한다. 1. LAP-태그 벡터로 관심의 유전자의 오픈 리딩 프레임 (ORF)을 복제 <ol><li> 셔틀 벡터로 관심의 유전자의 ORF를 복제. <ol><li> N 말단 융합 또는 C 말단 융합 어느 용 프라이머 내의 적절한 attB1과 attB2 사이트와 관심의 ORF를 증폭하는 중합 효소 연쇄 반응 (PCR)을 사용한다. PCR 조건 프라이머 서열 표 2 표 1을 참조하십시오. </li><li> 겔을 1 % 아가 로스 겔에서 이러한 문제를 해결하여 PCR 산물을 정제. 겔에서 올바른 크기의 증폭 밴드를 절제하고, DNA의 g를 사용하여 겔 조각에서 압축을 풉니 다제조업체의 지침에 따라 엘 추출 키트. </li><li> 셔틀 벡터를 포함하는 attP 및 PCR 제품은 제조자의 지시에 따라 벡터에 재결합 할 수있는 재조합 효소로 PCR 산물을 함유하는 정제 attB 부화 (M aterials의 도표 참조). 참고 : 빈 셔틀 벡터와 LAP 태그 벡터가 CCD의 B 유전자를 포함하고 CCD의 B 내성 박테리아 세포에 전달되어야한다 (재료 표 참조). ORF가이 벡터 내로 삽입 될 때 그러나 ccdB 유전자를 클로닝하는 ORF와 벡터를 전파 할 때 그에 DH5α 표준 대장균을 사용하여 아웃 재결합된다. </li><li> 루리아 브로 쓰 (LB) 50mg을 한천 플레이트 / ml의 카나마이신 (13) 상에 변환 된 세포 반응 생성물 1 μL로 DH5α 대장균 세포를 형질 접시. </li><li> 카나마이신 내성 콜로니를 선택합니다. </li><li> LB 내에서 선택한 식민지를 성장50 ㎎ / ㎖ 카나마이신으로 직경은 DNA 미니 - 프렙을 표 3에 열거 된 시퀀싱 프라이머를 사용하여 DNA 시퀀싱에 의해 유전자 통합을 확인한다. </li></ol></li><li> LAP-태그 벡터에 셔틀 벡터에서 관심의 유전자를 전송. <ol><li> LAP-태그 벡터와에 따라, LAP-태그 벡터에 셔틀 벡터에서 관심의 유전자의 전달을 매개 재조합 효소 (융합 N 말단에 대한 pGLAP1)과이자 ORF의 서열 확인 유전자를 함유하는 셔틀 벡터를 품다 제조업체의 지침 (자료 참조). 주의 : 원하는 프로모터, 에피토프 태그에 기초하여 사용될 수있다 LAP / TAP 벡터 시리즈와 N 또는 C 말단 태그는 표 4에서 찾아 볼 수있다. </li><li> 100 ㎎ / ㎖ 암피실린 (13)과 함께 LB 한천 플레이트 상에 형질 전환 세포 반응 생성물 1 μL로 DH5α 대장균 세포를 형질 접시. </li><li> 암피실린 내성 콜로을 선택가 다진. </li><li> , 100 ㎎ / ㎖ 암피실린와 LB 미디어에서 선택한 식민지를 성장하는 DNA 미니 사전을, 표 5에 나열된 순서 프라이머를 사용하여 DNA 염기 서열에 의해 유전자의 통합을 확인합니다. </li></ol></li></ol> 관심의 LAP-태그 유전자를 표현합니다 유도 안정 세포주의 2 세대 <ol><li> 관심있는 프로젝트에 가장 적합한 세포주를 선택합니다. 대안 적으로, 구조적 TetR를 표현하고 (원료 참조) 관심 LAP 태깅 유전자가 안정적으로 게놈 내로 통합 될 수있는 FRT 부위를 포함하는 기존의 세포주에서 숙주 세포 라인을 생성한다. 주 :이 프로토콜은 4 테트라 사이클린 (-Tet)의 결여이며, 10 % 소 태아 혈청 (FBS)으로 만든] -Tet DMEM / F12 배지에서 배양되는 TetR 및 FRT 부위를 포함하는 HEK293 세포주를 사용 . </li><li> 하이 그로 마이신의 최소 농도를 결정하는 것은이 연소로 (1) 내의 숙주 세포주를 죽이는 데 필요한약물 첨가 후 KS. 농도는 대부분 100 ㎖ μg의 / 800 μg의 / ㎖ 사이의 범위로, 숙주 세포 라인에 따라 다를 수 있습니다. 참고 : 37 ° C와 5 % CO 2 1 ~ 2 주 이내에 죽을 것 100 μg의 / ㎖ 하이 그로 마이신과 -Tet DMEM / F12 미디어에서 성장 HEK293 세포. </li><li> 공동 형질 flippase의 재조합 효소는 형질 전환 시약을 사용하여 HEK293 세포에 LAP-태그 벡터 (세포의 게놈 내에서 FRT 사이트에 관심있는 LAP-태그 유전자의 통합을 매개) 발현 벡터를 같은 제조업체의 지침에 따라 . 4의 비율을 사용하여 재조합 벡터의 1 LAP 벡터 (14)에. 주 : 최적의 비율은 형질 숙주 세포주 및 방법에 의존하고, 적정을 요구할 수있다. 4의 비율 : 1은 대부분의 세포 라인에 적합합니다. 음성 대조군으로 모의 형질 플레이트를 포함합니다. </li><li> 어느 날 후 형질 전환, 새로운 미디어와 -Tet DMEM / F12 미디어를 교체합니다. </li><li> 이틀 후 transfecti25 %의 합류로, 분할 세포. 셀 ~ 부착 5 시간은, 단계 2.2 소정의 농도로 하이 그로 마이신 함유 -Tet DMEM / F12 미디어를 추가 할 수 있습니다. HEK293를 들어 세포는 100 μg의 / ㎖ 하이 그로 마이신을 사용합니다. 주 : HEK293 세포주를 포함하는 FRT 또한 블라스트 저항과 관련된 따라서 5 μg의 / ㎖ 블라스트이 TetR위한 선택하여 누설 식을 최소화하는 안정한 세포주의 선택 과정에 사용되는 TetR를 포함한다. </li><li> 별개의 세포 초점이 투명 판에 대한 불투명 한 점을 닮은이 나타날 때까지 필요에 따라 -Tet DMEM / F12 미디어를 하이 그로 마이신이 함유 교체합니다. </li><li> 200 μL 피펫 팁과 각 셀의 초점의 상단에 트립신 20 μl를 추가하고 최대 피펫 아래로 2 회. 장소 24 웰 플레이트에서 세포와 하이 그로 마이신 함유 -Tet DMEM / F12 미디어의 지속적인 성장에 의해 세포를 확장합니다. </li><li> 고정 셀 또는 라이브 셀 형광 현미경으로 유도 LAP-태그 단백질 발현을위한 화면 세포 및 / 또는LAP-태그 (15) 내에서 GFP 태그 웨스턴 블로 팅. </li></ol> LAP-태그 단백질 복합체의 3 정화 참고 : 이전의 경험을 바탕으로 일반적인 LAP-태그 단백질 정제에 사용되는 조건 및 볼륨에 다음 LAP-태그 단백질 정제 프로토콜 세부 권장 사항. 그러나주의 경험적 최적화가 최상의 결과를 제공하기 위해 관심의 단백질 복합체 단백질 발현 수준에 대해 수행되는 것을 보장하기 위해 행사되어야한다. <ol><li> 세포 성장과 세포 수확. <ol><li> 지속적으로 37 ° C, 5 % CO 2에서 -Tet DMEM / F12 미디어에 더 큰 판 및 / 또는 롤러 병에 모든 HEK293 세포를 계대에 의해, 단백질 복합체의 TAP 분리에 대한 검증 LAP-태그 세포주를 확장합니다. </li><li> 테트 / Dox를 유도 세포주, harvestin 전에 0.2 μg의 / ㎖ 테트 / Dox를 세포에 도달 ~ 70 % 포화 상태의 농도에서 10 내지 15 시간 동안 유도g 세포. 참고 : 농도와 유도 시간이 각각의 단백질 결정되어야한다, 10 ~ 15 시간 동안 0.1 μg의 / ㎖ 테트 / Dox가의 적정 권장합니다. </li><li> 교반 또는 트립신 및 펠릿 세포 5 ~ 10 분 동안 875 XG에 의해 수확 세포. </li></ol></li><li> 커플 링 방지 GFP 항체 단백질 A 구슬에 <ol><li> A A 0.5 ml의 세포 펠렛으로부터 제조 해물, 포장 세포 부피 (PCV)에서 면역에 대한 항체의 40 μg의를 사용합니다. 참고 : 다른 요소들 사이의 LAP-태그 단백질의 풍부에 따라 달라집니다 필요한 항체의 양 및 최적화가 필요합니다. 10 ~ 40 μg의의 적정 권장합니다. </li><li> 1.5 ML 튜브에 PBST (PBS + 0.1 % 트윈 20)에 160 ㎕의 포장 볼륨 (PV) 단백질 A 구슬 평형. PBST 1 ㎖로 3 회 반복한다. 참고 : 여기에 모든 세척이 10 초 동안 5,000 XG에 구슬을 원심 분리하여 수행된다. </li><li> 를 Resuspend 구슬 500 μL의 PBST과 친 화성의 80 μg의 추가160 μL 비드 각 튜브 - 정수 토끼 항 GFP 항체. 실온에서 1 시간 (RT) 동안 혼합한다. </li><li> PBST 1 ml의 구슬을 2 회 반복한다. 그런 다음, 0.2 M 붕산 나트륨, pH가 9 (20 ml의 0.2 M 붕산 나트륨 + 15 ml의 0.2 M 붕산)의 1 ml의 구슬을 2 회 반복한다. 최종 세척 후, 1 ml의 최종 볼륨을 가지고 0.2 M 붕산 나트륨의 900 μL, pH가 9를 추가합니다. </li><li> 20 mm의 최종 농도 220 MM의 dimethylpimelimidate (DMP) 100 μl를 추가합니다. 30 분 동안 실온에서 부드럽게 튜브를 회전합니다. 220 mM의 DMP를 들어, 0.2 M 붕산 나트륨, pH가 9 877 ㎕를 한 50 mg의 병의 내용을 재현 탁하고 비드 현탁액에 바로 추가 할 수 있습니다. </li><li> DMP와 함께 배양 한 후, 잔류 가교제를 비활성화하는 0.2 M 에탄올 아민, 0.2 M의 NaCl 산도 8.5의 1 ml의 구슬 1 시간을 씻는다. 같은 버퍼 1 ㎖과에 재현 탁 비즈 실온에서 1 시간 동안 회전합니다. 펠렛의 구슬과 0.2 M 에탄올 아민, 0.2 M의 NaCl의 pH 8.5의 500 μL에 재현 탁 구슬. 비즈 severa에 대한 안정4 ° C에서 리터 개월. </li></ol></li><li> 세포 용해 및 복합 정제를위한 버퍼의 준비 <ol><li> pH가 7.4 용액함으로써 (세포 용해를위한 300 mm의 가장 비드 세척 200 mm의 세척 구슬 100 mM의 용출에 앞서 단백질 X는 LAP 버퍼의 원하는 염 농도 [mM의 KCl을] 임) LAPX 버퍼를 준비 의 50 mM 4- (2- 히드 록시 에틸) -1- 피페 라진 에탄 술폰산 (HEPES), X 밀리미터의 KCl, 1 mM의 에틸렌 글리콜 테트라 산 (EGTA), 1 ㎜의 MgCl 2, 10 % 글리세롤을 함유. 주 :이 완충액의 성분은 살아있는 세포에서의 환경에 근사하는 데 사용된다. HEPES는 7.2-8.2의 pH 분노의 버퍼로 사용됩니다. KCl을 버퍼의 이온 강도를 유지하기 위해 사용되는 염이다. EGTA 마그네슘에 비하여 칼슘 수준을 감소시키기 위해 칼슘 이온 결합하는 킬레이트 제이다. 글리세롤의 MgCl 2 단백질의 안정성을 향상시키기 위해 사용된다. </li><li> 0.05 % 노닐 phenoxypol 추가하여 LAPX N 버퍼를 준비LAPX 버퍼에 yethoxylethanol. 주 : 노닐 phenoxypolyethoxylethanol 단백질을 가용화 중성 세제이지만, 이에 따라 높은 농도의 추출 과정에 사용되는 단백질 - 단백질 상호 작용을 유지하고이어서 결합 및 세척 단계에서 저하된다. </li></ol></li><li> 세포 용 해물의 제조 <ol><li> 0.5 mM의 디티 오 트레이 톨 (DTT) 및 프로테아제 억제제로 LAP300 2.5 ㎖ 중에 PCV 500 μl를 재현 탁. 10 % 노닐 phenoxypolyethoxylethanol (최종 0.3 %)의 90 μl를 추가하고 반전으로 섞는다. </li><li> 10 분 동안 얼음에 놓습니다. 10 분 동안 21,000 XG에 원심 분리기. 이 저속 상층 액 (LSS)를 수집합니다. 젤 분석을위한 LSS의 10 μL 샘플을 가져 가라. </li><li> 4 ° C에서 1 시간 동안 100,000 XG에서 TLA100.3 튜브와 스핀에 LSS를 전송합니다. 튜브에,이 고속 뜨는 (HSS)를 수집하고 얼음에 배치합니다. 젤 분석을위한 HSS의 10 μL 샘플을 가져 가라. 참고 : 최상위 지질 층을 복용하지 마십시오D 하단 대부분 세포 파편 층. 지방층은 HSS를 수집하기 전에, 진공 흡인에 의해 제거되어야한다. </li></ol></li><li> 첫째 선호도 캡처 : 안티 GFP 비즈에 바인딩 <ol><li> 사전 용출 항체 결합 구슬 비 결합을 제거하는 용출 버퍼 [20 mM 트리스, pH 7.4의 3.5 M의 MgCl 2] 1 ㎖로 3 회 세척 (0.5 ml의 세포 펠렛 (PCV) 당 구슬의 160 μl를 사용) 항체와 배경을 줄일 수 있습니다. 신속하게 수행합니다. 오랜 시간 동안 높은 소금에 구슬을 두지 마십시오. </li><li> LAP200 N의 1 ml의 구슬을 3 회 반복한다. HSS는 4 ° C에서 1 시간 동안 항체 구슬 추출 섞는다. 10 분 동안 21,000 XG에 원심 분리기. 상층 액의 10 μl의 샘플을 가지고 (즉, (FT)를 통해 흐름) 젤 분석. </li><li> 0.5 mM의 DTT 및 프로테아제 억제제와 LAP200 N의 1 ml의 구슬을 3 회 반복한다. 0.5 mM의 DTT 및 프로테아제 억제제와 LAP200 N의 1 ml의 구슬을 2 회 (5 분마다)를 씻으십시오. 2t 신속하게 세척1 0.5 mM의 DTT와 LAP200 N ㎖의 담배 식각 바이러스 (TEV) 단백질 분해 효소를 추가하기 전에없이 단백질 분해 효소 억제제와 IME를. </li></ol></li><li> TEV 절단 <ol><li> LAP200 N 1 ml의 10 μg의 TEV 단백질 분해 효소를 희석하고 밤새 4 ° C에서 튜브를 회전합니다. 참고 :이 단계는 모든 LAP-태그 단백질을 최적화 할 수는 LAP-태그 단백질 복합체의 보존에 도움이 될 수 TEV 단백질 분해 효소의 농도를 조절하여 몇 시간에 완료 할 수 있습니다. </li><li> 새로운 튜브에 펠렛 구슬과 전송 상층 액. 잔여 단백질을 제거하기 위해 0.5 mM의 DTT 160 ㎕를 LAP200 N과 단백질 분해 효소 억제제 (트리플 농도)로 두 번 구슬을 씻어. 젤 분석을위한 뜨는의 10 μL 샘플을 가져 가라. </li></ol></li><li> 둘째 선호도 캡처 : S 단백질 아가로 오스 바인딩 <ol><li> 80 μl의 S 단백질 아가로 오스 슬러리의 1 튜브 (40 μl의 포장 수지) LAP200 N 1 ml의 3 회 반복한다. 참고 : S의 제자EIN의 RNase 활성을 재구성 할 S-tag에 결합하고 다른 두번째 에피토프 태그를 함유하는 RNA 단백질 복합체에 대해 고려되어야한다. </li><li> 추가 TEV는 4 ° C에서 3 시간 동안 S 단백질 아가로 오스 구슬과 바위에 뜨는 용출. 펠렛의 구슬과 0.5 mM의 DTT 및 프로테아제 억제제와 LAP200 N 1 ㎖로 3 회 씻는다. LAP100 1 ml의 구슬을 2 회 반복한다. </li></ol></li><li> 단백질 용출 <ol><li> 10 분 동안 97 ° C에서 4X 램 믈리 시료 완충액과 열 50 μl를 첨가하여 아가 S 단백질을 단백질을 용출시킨다. 주 : 단백질은 용출 완충액 (20 mM 트리스, pH 7.4의 3.5 M의 MgCl 2)로 비드로부터 용출된다. </li></ol></li></ol> 4. 질량 분광법 분석에 의해 상호 작용 단백질을 확인 <ol><li> 볼 (도데 실 황산나트륨 폴리 아크릴 아미드 겔 전기 영동 (SDS-PAGE), 실버 염색 겔에 의해 수집 된 샘플을 분석하여, 정제의 품질을 테스트 <strong&gt; 자료 표)와 용출액을 면역 블과 그림 4 참조 LAP-태그 정화는 16 일 않도록 방지 GFP 항체와 프로빙에 의해. </li><li> 화학 양론과 화학량 론적 공동 정화 종을 식별하기 위해 최종 용출 샘플을 채취하고 SDS-PAGE하여 구분합니다. 질량 분석 호환 단백질 얼룩 젤을 얼룩. 가장 눈에 띄는 밴드와 겔에서 그들 사이의 공간을 절제 및 질량 분석 별도로 (16)에 의해 분석을 처리합니다. 참고 : 최종 정제 용출액을 분리하여 질량 분석 5를 제조하는 다양한 방법이있다. 예를 들어, LAP 정제 된 복합체는 높은 염 (3.5 M의 MgCl 2)를 한꺼번에 질량 분석계 (17)에 의해 분석 될 수 도중에 전체 단백질 집단을 이용하여 S - 단백질 비드로부터 용출된다. 대안 적으로, 최종 용출액 한 SDS-PAGE에 의해 mm 전자 수있는 단일 한 mm 대역에 대해 분리 될 수있다xcised 분석. 이 분석을 방해 할 수있는 비드 또는 입자상 물질의 복합체를 클리어한다. </li></ol>

<ol>
	<li>Rigaut, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+generic+protein+purification+method+for+protein+complex+characterization+and+proteome+exploration.">A generic protein purification method for protein complex characterization and proteome exploration.</a> Nat Biotechnol. 17, 1030-1032 (1999).</li><li>Puig, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+tandem+affinity+purification+(TAP)+method:+a+general+procedure+of+protein+complex+purification.">The tandem affinity purification (TAP) method: a general procedure of protein complex purification.</a> Methods. 24, 218-229 (2001).</li><li>Cheeseman, I. M., Desai, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+combined+approach+for+the+localization+and+tandem+affinity+purification+of+protein+complexes+from+metazoans.">A combined approach for the localization and tandem affinity purification of protein complexes from metazoans.</a> Sci STKE. , (2005).</li><li>Torres, J. Z., Miller, J. J., Jackson, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+generation+of+tagged+stable+cell+lines+for+proteomic+analysis.">High-throughput generation of tagged stable cell lines for proteomic analysis.</a> Proteomics. 9, 2888-2891 (2009).</li><li>LaCava, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Affinity+proteomics+to+study+endogenous+protein+complexes:+pointers,+pitfalls,+preferences+and+perspectives.">Affinity proteomics to study endogenous protein complexes: pointers, pitfalls, preferences and perspectives.</a> Biotechniques. 58, 103-119 (2015).</li><li>Landy, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic,+structural,+and+regulatory+aspects+of+lambda+site-specific+recombination.">Dynamic, structural, and regulatory aspects of lambda site-specific recombination.</a> Annu Rev Biochem. 58, 913-949 (1989).</li><li>Hartley, J. L., Temple, G. F., Brasch, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+cloning+using+in+vitro+site-specific+recombination.">DNA cloning using in vitro site-specific recombination.</a> Genome Res. 10, 1788-1795 (2000).</li><li>ORFeome Collaboration. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+ORFeome+Collaboration:+a+genome-scale+human+ORF-clone+resource.">The ORFeome Collaboration: a genome-scale human ORF-clone resource.</a> Nat Methods. 13, 191-192 (2016).</li><li>Brasch, M. A., Hartley, J. L., Vidal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ORFeome+cloning+and+systems+biology:+standardized+mass+production+of+the+parts+from+the+parts-list.">ORFeome cloning and systems biology: standardized mass production of the parts from the parts-list.</a> Genome Res. 14, 2001-2009 (2004).</li><li>Lamesch, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=hORFeome+v3.1:+a+resource+of+human+open+reading+frames+representing+over+10,000+human+genes.">hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes.</a> Genomics. 89, 307-315 (2007).</li><li>Rual, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+ORFeome+version+1.1:+a+platform+for+reverse+proteomics.">Human ORFeome version 1.1: a platform for reverse proteomics.</a> Genome Res. 14, 2128-2135 (2004).</li><li>Fiering, S., Kim, C. G., Epner, E. M., Groudine, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+&amp;#34;in-out&amp;#34;+strategy+using+gene+targeting+and+FLP+recombinase+for+the+functional+dissection+of+complex+DNA+regulatory+elements:+analysis+of+the+beta-globin+locus+control+region.">An &amp;#34;in-out&amp;#34; strategy using gene targeting and FLP recombinase for the functional dissection of complex DNA regulatory elements: analysis of the beta-globin locus control region.</a> Proc Natl Acad Sci U S A. 90, 8469-8473 (1993).</li><li>Sambrook, J., Fritsch, E. F., Maniatis, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (1989).</li><li>Uyttersprot, N., Costagliola, S., Miot, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+tool+for+efficient+transfection+of+dog+and+human+thyrocytes+in+primary+culture.">A new tool for efficient transfection of dog and human thyrocytes in primary culture.</a> Mol Cell Endocrinol. 142, 35-39 (1998).</li><li>Senese, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+unique+insertion+in+STARD9's+motor+domain+regulates+its+stability.">A unique insertion in STARD9's motor domain regulates its stability.</a> Mol Biol Cell. 26, 440-452 (2015).</li><li>Gholkar, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+X-Linked-Intellectual-Disability-Associated+Ubiquitin+Ligase+Mid2+Interacts+with+Astrin+and+Regulates+Astrin+Levels+to+Promote+Cell+Division.">The X-Linked-Intellectual-Disability-Associated Ubiquitin Ligase Mid2 Interacts with Astrin and Regulates Astrin Levels to Promote Cell Division.</a> Cell Rep. 14, 180-188 (2016).</li><li>Graumann, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applicability+of+tandem+affinity+purification+MudPIT+to+pathway+proteomics+in+yeast.">Applicability of tandem affinity purification MudPIT to pathway proteomics in yeast.</a> Mol Cell Proteomics. 3, 226-237 (2004).</li><li>Connolly, J. A., Kalnins, V. I., Cleveland, D. W., Kirschner, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunoflourescent+staining+of+cytoplasmic+and+spindle+microtubules+in+mouse+fibroblasts+with+antibody+to+tau+protein.">Immunoflourescent staining of cytoplasmic and spindle microtubules in mouse fibroblasts with antibody to tau protein.</a> Proc Natl Acad Sci U S A. 74, 2437-2440 (1977).</li><li>Gholkar, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tctex1d2+associates+with+short-rib+polydactyly+syndrome+proteins+and+is+required+for+ciliogenesis.">Tctex1d2 associates with short-rib polydactyly syndrome proteins and is required for ciliogenesis.</a> Cell Cycle. 14, 1116-1125 (2015).</li><li>Cheung, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomic+Analysis+of+the+Mammalian+Katanin+Family+of+Microtubule-severing+Enzymes+Defines+Katanin+p80+subunit+B-like+1+(KATNBL1)+as+a+Regulator+of+Mammalian+Katanin+Microtubule-severing.">Proteomic Analysis of the Mammalian Katanin Family of Microtubule-severing Enzymes Defines Katanin p80 subunit B-like 1 (KATNBL1) as a Regulator of Mammalian Katanin Microtubule-severing.</a> Mol Cell Proteomics. 15, 1658-1669 (2016).</li><li>Torres, J. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+STARD9/Kif16a+Kinesin+Associates+with+Mitotic+Microtubules+and+Regulates+Spindle+Pole+Assembly.">The STARD9/Kif16a Kinesin Associates with Mitotic Microtubules and Regulates Spindle Pole Assembly.</a> Cell. 147, 1309-1323 (2011).</li><li>Garcia-Gonzalo, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transition+zone+complex+regulates+mammalian+ciliogenesis+and+ciliary+membrane+composition.">A transition zone complex regulates mammalian ciliogenesis and ciliary membrane composition.</a> Nat Genet. 43, 776-784 (2011).</li><li>Chih, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ciliopathy+complex+at+the+transition+zone+protects+the+cilia+as+a+privileged+membrane+domain.">A ciliopathy complex at the transition zone protects the cilia as a privileged membrane domain.</a> Nat Cell Biol. 14, 61-72 (2012).</li><li>Leonetti, M. D., Sekine, S., Kamiyama, D., Weissman, J. S., Huang, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+scalable+strategy+for+high-throughput+GFP+tagging+of+endogenous+human+proteins.">A scalable strategy for high-throughput GFP tagging of endogenous human proteins.</a> Proc Natl Acad Sci U S A. 113, E3501-E3508 (2016).</li><li>Poser, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BAC+TransgeneOmics:+a+high-throughput+method+for+exploration+of+protein+function+in+mammals.">BAC TransgeneOmics: a high-throughput method for exploration of protein function in mammals.</a> Nat Methods. 5, 409-415 (2008).</li><li>Firat-Karalar, E. N., Stearns, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+mammalian+centrosome+structure+using+BioID+proximity-dependent+biotinylation.">Probing mammalian centrosome structure using BioID proximity-dependent biotinylation.</a> Methods Cell Biol. 129, 153-170 (2015).</li><li>Roux, K. J., Kim, D. I., Burke, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BioID:+a+screen+for+protein-protein+interactions.">BioID: a screen for protein-protein interactions.</a> Curr Protoc Protein Sci. 74, (2013).</li><li>Gupta, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Dynamic+Protein+Interaction+Landscape+of+the+Human+Centrosome-Cilium+Interface.">A Dynamic Protein Interaction Landscape of the Human Centrosome-Cilium Interface.</a> Cell. 163, 1484-1499 (2015).</li></ol>

The authors have nothing to disclose.

개설 된 프로토콜은 LAP 태그 벡터에 관심있는 유전자의 복제를 설명, 유도 LAP-태그 안정적인 세포주의 생성, 단백체 분석을위한 LAP-태그 단백질 복합체의 정제. 다른 LAP / TAP 태그 방식에 대해,이 프로토콜은 모든 세포 경로 내에서 단백질 현지화 및 단백질 - 단백질 상호 작용을 매핑하는 높은 처리량 방법과 호환되도록 간소화되었습니다. 이 접근 방법은 널리 몇 가지 이름을 세포주기 진행, 방추사 조립체 스핀들 극 항상성 및 ciliogenesis에 중요한 단백질의 기능적 특성에 적용된 이러한 단백질 misregulation 인간 질환 (15)로 유도 할 수있는 방법의 이해를 원조했다 16,19,20. 예를 들어, 우리 그룹 최근 스핀들 조립체 15,21 STARD9에서의 유사 분열 키네신 기능 및 규제 (후보 암 대상)을 정의하기 위해이 시스템을 사용하는 정의 할Tctex1d2의 네인 빛 체인 사이의 새로운 분자 링크 짧은 리브 다지증을 비롯한 다양한 기형 증후군 (SRPS) (19), 그리고 중간 2 유비퀴틴 리가 아제의 돌연변이 X-링크 지적 장애 (16)으로 이어질 수있는 방법을 이해하는 새로운 분자 링크를 정의 할 수 있습니다. 다른 실험실도 성공적으로 Tctn1, 마우스 고슴도치 신호의 조절이하는 ciliopathy 관련 단백질 복합체의 일부라고 판단 하나를 포함하여,이 방법을 적용한 조직 의존적으로 22, 23에 규정 된 섬모 막 조성 및 ciliogenesis가. 따라서,이 프로토콜은 크게 임의의 셀룰러 경로의 해부에 적용될 수있다. 이 프로토콜에서 중요한 단계는 하이 그로 마이신 내성 LAP 태깅 안정한 세포주의 선택이다. 특별한주의가 제어 플레이트의 모든 세포가 증폭 실험 접시에 초점을 선택하기 전에 죽은되도록주의해야한다. 하이 그로 마이신은 adde 할 수있다LAP-태그 안정적인 세포주의 일상적인 세포 배양시 d를 추가로 모든 세포가 FRT 사이트에서 관심있는 LAP-태그 유전자를 유지할 수 있도록합니다. 우리는 모든 LAP 태깅 된 단백질이 작동하게하고 단백질 기능을 테스트하는 데 사용할 수있는 장소의 분석을 위해 중요하다는 것을 경고한다. 단백질의 기능을 테스트하는 데 사용 분석의 예는 siRNA를 유도 표현형 및 시험 관내 활성 분석의 구조를 포함한다. 큰 LAP 태그가 추가 된 잠재적 인 문제점을 해결하기 위해 이전에 관심 단백질의 기능 및 위치 파악을 방해 할 가능성이 적은 FLAG 같은 작은 태그를 포함하고,이 시스템과 호환 TAP 태그 벡터를 생성 한 4. 또한, LAP 태그 벡터 C 말단 LAP 표지 된 단백질 또는 LAP / TAP 태그는 N에서 허용되지 않는 경우에 사용할 수있는 이러한 시스템과 호환되는 C 말단 TAP 표지 된 단백질을 생성하기 위해 존재 단백질의 -terminus. 또한, 일정제 버퍼 (LAPX N)의 전자 염 세제 농도를 높이거나 유료 또는 너무 많은 상호 작용이 관찰되는 경우, 정제 엄격함을 감소하도록 변형 될 수있다. 유사하게, 직렬 친 화성 정제 절차는 거의 또는 전혀 인터랙이 확인되면 이에 번의 정제 방식이 사용될 수 있으며, 손실 될 수 정제 과정 약한 인터랙 하나보다 더 엄격하다. 다른 GFP 에피토프 태그 방식은 단백질 현지화 및 정제 연구 (24, 25)에 대한 태그 대규모 GFP 단백질을 허용하는 존재한다는 것을 주목하는 것이 중요하다. 이러한 모든 규제 요소, 모방 내인성 유전자 발현 (24)를 포함 그들의 네이티브 환경에서 관심의 GFP - 태그 유전자를 표현하는 박테리아 인공 염색체를 이용하는 BAC TransgenOmics 접근 방식을 포함한다. 최근 CAS9 / 단일 가이드 RNA (sgRNA) 리보 핵산 단백질 복합체 (RNP들)을 종료하는 데 사용 된ogenously 자신의 내인성 유전자 좌위 (25)로부터 GFP - 태그 유전자의 발현을 허용하는 분할 GFP 시스템과 관심의 유전자를 태그. 이러한 접근 방식 모두 여기에 설명 된 LAP 태그 프로토콜에 비해 내생 조건에서 태그 단백질의 발현을 활성화하지만, 그들이 관심있는 태그 유전자의 유도 및 조정 가능한 표현을 허용하지 않습니다. 또한, 그들은 TAP에 대해 태깅 탠덤 에피토프에 적용될 아직. 다른 태그 시스템은 또한 유도 성 에피토프 태그 안정된 세포주를 생성하기위한 여기에 설명 된 시스템과 호환되기 위해 변형 될 수있다라는 점이다. 예를 들면, 근접성 - 의존성 비오틴 식별 (BioID)의 상호 작용으로 인해 단백질 (26) 사이에 공간 및 시간 관계를 정의하는 능력에 상당한 관심을 얻고있다. 이 기술은 대장균 비오틴 리가 피라의 난잡한 균주 오티 닐에 융합 단백질을 이용효소의 ~ 10 nm의 반경 내에있는 단백질이야. 바이오틴이 단백질은 친 화성 비오틴 화성 캡처를 사용하여 정제 및 질량 분석에 의한 조성 분석이다. 피라 복잡한 (27) 내에 강한 상호 작용 파트너를 검출하기에 특히 적합하게되는, 심지어 일시적 밀접 어떤 단백질 오티 것이다. 또한, 정제 기법은 내인성 단백질 - 단백질 상호 작용은 그대로 유지되므로 위양성의 비율을 줄이고, 변성 조건 하에서 수행 될 수 있다는 것을 필요로하지 않는다. 현재 프로토콜 내에서, 피라 태그 벡터에 의해 pGLAP1 벡터의 대체 근접성에 기반을 검출에 친 화성을 기반으로 단백질 - 단백질 상호 작용을 식별에서이 시스템을 변환 할 수 있습니다. 다양한 효소 - 기질 상호 작용 사이의 시공간 단백질 - 단백질 INTE을 매핑하는 경우와 같이 이러한 시스템은 과도 단백질 상호 작용을 검출하는 매우 유리할 것이다중심체과 섬모 (26, 28)에 대해 수행 된 정의 구조 내에서 ractions.

To investigate the cellular function of an uncharacterized protein it is important to determine its in vivo spatiotemporal subcellular localization and its interacting protein partners. Traditionally, single and tandem epitope tags fused to the N or C-terminus of a protein of interest have been used to facilitate protein localization and protein interaction studies. For example, the tandem affinity purification (TAP) technology has enabled the isolation of native protein complexes, even those that are in low abundance, in both yeast and mammalian cell lines1,2. The localization and affinity purification (LAP) technology, is a more recent development that modifies the TAP procedure to include a localization component through the introduction of the green fluorescent protein (GFP) as one of the epitope tags3. This approach has given researchers a deeper understanding of a protein's subcellular localization in living cells while also retaining the ability to perform TAP complex purifications to map protein-protein interaction networks. 
However, there are many issues associated with the use of TAP/LAP technologies that has hampered their widespread use in mammalian cells. For example, the length of time that is necessary to generate a stable cell line expressing a TAP/LAP tagged protein of interest; which typically relies on cloning the gene of interest into a viral vector and selecting single cell stable integrants with the desired expression level. Additionally, many cellular pathways are sensitive to constitutive protein overexpression (even at low levels) and can arrest cells or trigger cell death over time making the generation of a TAP/LAP stable cell line impossible. These and other constraints have impeded LAP/TAP methodologies from becoming high-throughput systems for protein localization and protein complex elucidation. Therefore, there has been considerable interest in the development of an inducible high-throughput LAP-tagging system for mammalian cells that takes advantage of current innovations in cloning and cell line technologies. 
Here we present a protocol for generating stable cell lines with Doxycycline/Tetracycline (Dox/Tet) inducible LAP-tagged proteins of interest that applies advances in both cloning and mammalian cell line technologies. This approach streamlines the acquisition of data with regards to LAP-tagged protein subcellular localization, protein complex purification and identification of interacting proteins4. Although affinity proteomics utilizes a wide range of techniques for protein complex elucidation5, our approach is beneficial for expediting the identification of these complexes and their native interaction networks and is amenable to high-throughput protein tagging that is necessary to investigate complex biological pathways that contain a multitude of protein constituents. Key to this approach are advancements in cloning strategies that enable high fidelity and expedited cloning of target genes into an array of vectors for gene expression in vitro, in various organisms like bacteria and baculovirus, and in mammalian cells6,7. Additionally, the ORFeome collaboration has cloned thousands of sequence validated open reading frames in vectors that incorporate these advances in cloning, which are available to the scientific community8-11. In our system, the pGLAP1 LAP-tagging vector enables the simultaneous cloning of a large number of clones, which facilitates high-throughput LAP-tagging. This expedited cloning procedure is coupled to a streamlined approach for generating cell lines with LAP-tagged genes of interest inserted at a single pre-determined genomic locus. This makes use of cell lines that contain a single flippase recognition target (FRT) site within their genome, which is the site of integration for LAP-tagged genes. These cell lines also express the tetracycline repressor (TetR) that binds to Tet operators (TetO2) upstream of the LAP-tagged genes and silences their expression in the absence of Dox/Tet. This allows for Dox/Tet inducible expression of the LAP-tagged protein at any given time. Having the capability of inducible LAP-tagged protein expression is critical, since many cellular pathways are sensitive to the levels of critical proteins governing the pathway and can arrest cell growth or trigger cell death when these proteins are constitutively overexpressed, even at low levels, making the generation of non-inducible LAP-tagged stable cell lines impossible12.

<table border="0" cellpadding="0" cellspacing="0" width="640">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Flp-In T-REx Core Kit</td>
			<td style="width:139px;">Invitrogen</td>
			<td style="width:119px;">K6500-01</td>
			<td style="width:167px;">Kit for generating cell lines that contain an FRT site and TrtR expression</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PETG, 5X</td>
			<td style="width:139px;">Nunc, Inc.&#160;</td>
			<td style="width:119px;">73520-734</td>
			<td>Roller bottle for growing cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PETG, 2.5X</td>
			<td style="width:139px;">Nunc, Inc.&#160;</td>
			<td style="width:119px;">73520-420</td>
			<td>Roller bottle for growing cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cell stackers</td>
			<td style="width:139px;">Corning CellSTACK</td>
			<td style="width:119px;">3271</td>
			<td>Cell stacker for growing cells</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">500 mL conical centrifuge tubes</td>
			<td style="width:139px;">Corning&#160;</td>
			<td style="width:119px;">431123</td>
			<td>Tubes for harvesting cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Anti-GFP antibody</td>
			<td style="width:139px;">Invitrogen</td>
			<td style="width:119px;">A11122</td>
			<td>Rabbit anti GFP antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Affiprep Protein A beads</td>
			<td style="width:139px;">Biorad</td>
			<td style="width:119px;">156-0006</td>
			<td>Used as a matrix for conjugating anti-GFP antibodies</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Dimethylpimelimidate (DMP)</td>
			<td style="width:139px;">ThermoFisher Scientific</td>
			<td>21667</td>
			<td>Used for conjugating anti-GFP antibodies to Protein A beads</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TLA100.3 tubes</td>
			<td style="width:139px;">Beckman</td>
			<td style="width:119px;">349622</td>
			<td>Tubes for centrifuging protein lysates during the clearing step</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TEV protease</td>
			<td style="width:139px;">Invitrogen</td>
			<td style="width:119px;">12575-015</td>
			<td>Used for cleaving the GFP tag off of N-terminal LAP-tagged proteins</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Precession Protease</td>
			<td style="width:139px;">GE Healthcare</td>
			<td style="width:119px;">27-0843-01</td>
			<td>Used for cleaving the GFP tag off of C-terminal LAP-tagged proteins</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">S-protein agarose</td>
			<td style="width:139px;">Novagen</td>
			<td style="width:119px;">69704</td>
			<td>Used as a second affinity matrix during the purification of LAP-tagged protein complexes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">QIAquick DNA gel extraction kit</td>
			<td style="width:139px;">Qiagen</td>
			<td>28704/28706</td>
			<td>For use in purifying PCR products from an agarose gel</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">BP clonase II</td>
			<td style="width:139px;">Invitrogen</td>
			<td>11789020</td>
			<td>Used for cloning ORF PCR products into the pDONR221 shuttle vector</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">LR clonase II</td>
			<td style="width:139px;">Invitrogen</td>
			<td>11791020</td>
			<td>Used for cloning the ORF of the gene of interest into the pGLAP1 LAP-tagging vector</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">ccdB Survival 2 T1R E. coli</td>
			<td style="width:139px;">Invitrogen</td>
			<td>A10460</td>
			<td>Used for propgating shuttle vectors and pGLAP empty vectors</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fugene 6</td>
			<td style="width:139px;">Promega</td>
			<td>E2691</td>
			<td>Transfection reagent for transfecting vectors into human cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tetracycline</td>
			<td style="width:139px;">Invitrogen</td>
			<td style="width:119px;">Q100-19</td>
			<td>Drug for inducing Dox/Tet inducible protein expression&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Doxycycline</td>
			<td style="width:139px;">Clontech</td>
			<td style="width:119px;">631311</td>
			<td>Drug for inducing Dox/Tet inducible protein expression&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hygromycin B</td>
			<td style="width:139px;">Invitrogen</td>
			<td>10687010</td>
			<td>Drug for selecting stable LAP-tagged integrants</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Kanamycin</td>
			<td style="width:139px;">Corning</td>
			<td>61-176-RG</td>
			<td>Drug for selecting Kanamycin resistant bacterial colonies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ampicillin</td>
			<td style="width:139px;">Fisher</td>
			<td>BP1760-5</td>
			<td>Drug for selecting Ampicillin resistant bacterial colonies</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">4-20% Tris Glycine SDS-PAGE gels</td>
			<td style="width:139px;">Biorad</td>
			<td>4561094</td>
			<td>Used for separating protein samples and final LAP-tag purification eluates</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Silver Stain Plus Kit</td>
			<td style="width:139px;">Biorad</td>
			<td>1610449</td>
			<td>Used for silver staining the eluates of LAP-tagged pufications and samples collected throughout the purification process&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Coomassie Blue stain</td>
			<td style="width:139px;">Invitrogen</td>
			<td>LC6060</td>
			<td>Used for staining SDS-PAGE gels to visulize LAP-tagged purifications and cutting out protein bands, mass spectrometry compatible</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Shuttle vector pDONR221</td>
			<td style="width:139px;">Invitrogen</td>
			<td>12536017</td>
			<td>Shuttle vector for cloning the ORFs of genes of interest</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Flippase expressing vector pOG44</td>
			<td style="width:139px;">Invitrogen</td>
			<td>V600520</td>
			<td>Vector that expresses the Flippase recombinase for integrating LAP-tagged genes into the genome of FRT site containing cell lines</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">Platinum Taq DNA Polymerase</td>
			<td style="width:139px;">ThermoFisher Scientific</td>
			<td style="width:119px;">10966018</td>
			<td>Used for PCR amplification of the ORFs of genes of interest</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">4X Laemmli sample buffer</td>
			<td style="width:139px;">Biorad</td>
			<td>1610747</td>
			<td>Sample buffer for eluting purified LAP-tagged protein complexes from the bead matrix</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Luria broth (LB) media</td>
			<td style="width:139px;">Fisher</td>
			<td>BP9723-2</td>
			<td>Used for growing DH5&#945; bacteria</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNA miniprep kit</td>
			<td style="width:139px;">Promega</td>
			<td>A1222</td>
			<td>Used for making DNA plasmid minipreps</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DMEM/F12 media</td>
			<td style="width:139px;">Hyclone</td>
			<td>SH30023.01</td>
			<td>For growing Hek293 human cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FBS lacking Tet</td>
			<td style="width:139px;">Altanta Biologicals</td>
			<td>S10350</td>
			<td>Used for making -Tet DMEM/F12 media for generating and growing inducible LAP-tagged stable cell lines</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Trypsin</td>
			<td style="width:139px;">Hyclone</td>
			<td>SH30042.01</td>
			<td>For lifting Hek293 cell foci from plates</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Protease inhibitor tablets</td>
			<td style="width:139px;">Roche</td>
			<td style="width:119px;">11836170001</td>
			<td>Used for making protocol buffers, EDTA-free</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">10% nonyl phenoxypolyethoxylethanol&#160;</td>
			<td style="width:139px;">Roche</td>
			<td style="width:119px;">11332473001</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PBS</td>
			<td style="width:139px;">Corning</td>
			<td>21-040-CM</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tween-20</td>
			<td style="width:139px;">Fisher</td>
			<td>BP337-500</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium Borate</td>
			<td style="width:139px;">Fisher</td>
			<td>S249-500</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Boric Acid</td>
			<td style="width:139px;">Fisher</td>
			<td>A78-500</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ethanolamine</td>
			<td style="width:139px;">Calbiochem</td>
			<td>34115</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NaCl</td>
			<td style="width:139px;">Fisher</td>
			<td>P217-3</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">KCl</td>
			<td style="width:139px;">Fisher</td>
			<td>BP358-10</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dithiothreitol (DTT)</td>
			<td style="width:139px;">Fisher</td>
			<td>BP172-25</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MgCl2</td>
			<td style="width:139px;">Fisher</td>
			<td>M33-500</td>
			<td>Used for making protocol buffers</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tris base</td>
			<td style="width:139px;">Fisher</td>
			<td>BP152-5</td>
			<td>Used for making protocol buffers</td>
		</tr>
	</tbody>
</table>

inducible lap-tagged stable cell lines for investigating protein function, spatiotemporal localization and protein interaction networks

Multi-protein complexes, rather than single proteins acting in isolation, often govern molecular pathways regulating cellular homeostasis. Based on this principle, the purification of critical proteins required for the functioning of these pathways along with their native interacting partners has not only allowed the mapping of the protein constituents of these pathways, but has also provided a deeper understanding of how these proteins coordinate to regulate these pathways. Within this context, understanding a protein's spatiotemporal localization and its protein-protein interaction network can aid in defining its role within a pathway, as well as how its misregulation may lead to disease pathogenesis. To address this need, several approaches for protein purification such as tandem affinity purification (TAP) and localization and affinity purification (LAP) have been designed and used successfully. Nevertheless, in order to apply these approaches to pathway-scale proteomic analyses, these strategies must be supplemented with modern technological developments in cloning and mammalian stable cell line generation. Here, we describe a method for generating LAP-tagged human inducible stable cell lines for investigating protein subcellular localization and protein-protein interaction networks. This approach has been successfully applied to the dissection of multiple cellular pathways including cell division and is compatible with high-throughput proteomic analyses.

이 시스템의 유용성을 강조하기 위해, 타우 미소 관 결합 단백질의 오픈 리딩 프레임 (ORF)을 갖는 PCR 제품 attB1과 attB2 사이트를 함유하는 프라이머 타우 ORF 증폭 (표 1)과 배양하여 셔틀 벡터 내로 클로닝 셔틀 벡터 및 셔틀 벡터 내로 PCR 산물의 삽입을 매개 재조합 효소. 반응 생성물 타우 삽입을 위해 서열화 된 카나마이신 내성 콜로니로부터 DH5α 박테리아 13 및 플라스미드 DNA를 형질 전환 하였다. 시퀀스 검증 셔틀 타우 벡터는 다음의 pGLAP1 벡터로 셔틀 - 타우 벡터를 배양하여 LAP (EGFP-TEV-S-단백질) 태그로 프레임에 타우를 융합 pGLAP1 벡터로 타우 ORF를 전송하는 데 사용되었다 및 pGLAP1에 셔틀 벡터에서 ORF의 전달을 매개 재조합 효소. 반응 생성물을 DH5α 균을 형질 전환했다암피실린 내성 콜로니에서 13 플라스미드 DNA는 LAP-타우 융합 프레임 있다는 보장하기 위해 염기 서열했다. 순서 pGLAP1-LAP-타우 후 단일 flippase 인식 대상 LAP-태그 유전자 통합 사이트가 그들의 게놈 내에서 (FRT) 사이트를 포함 HEK293 세포에 flippase 재조합 효소를 발현하는 벡터로 형질 공동 된 검증 14. 이 세포주는 또한 LAP-태그 유전자의 상류 구정 운영에 결합 테트 / Dox가의 부재에서 발현을 침묵 TetR를 표명했다. 안정적인 통합 체 5 일 동안 100 μg의 / ㎖ 하이 그로 마이신과 -Tet DMEM / F12 매체로 선정되었다. 개별 하이 그로 마이신 내성 세포의 초점은 상단에 트립신 20 μl를 추가하고 아래로 2 회를 ​​피펫 팅에 의해 수거 하였다. 세포를 24 웰 플레이트에 넣고 -Tet DMEM / F12 배지에서 연속 성장에 의해 팽창되었다. 하이 그로 마이신 내성 세포 있는지 확인하려면LAP (S)는 타우를 발현 할 수 있었다 HEK293 LAP 타우 세포는 15 시간 단백질 추출물 0.1 μg의 / ㎖의 Dox를로 유도 하였다는 유도되지 않은 및 유도 Dox를 세포로부터 제조 하였다. 이 추출물을 PVDF 막으로 전달, SDS-PAGE에 의해 분리하고, 로딩 대조군으로 튜 블린에 대한 GFP 및 immunoblotted 하였다. 도 4a, LAP 타우에서 보듯 (항 GFP 항체로 가시화) 만 존재 Dox를 표현 하였다. 이전 내생 타우 (18)에 대해 표시했다으로 LAP-타우 제대로, 유사 분열시 유사 분열 미세 소관 스핀들에 현지화 된 것을 확인하려면, HEK293 LAP-타우 세포는 15 시간 동안 0.1 μg의 / ㎖ Dox가로 유도하고, 세포를 4 %로 고정 하였다 파라 포름 알데히드와 공동 스테인드 DNA (훽스트 33342) 및 미세 소관 (안티 - 튜 불린 항체)를 참조하십시오. 지속적으로, LAP-타우는 유사 분열의 중기 (그림 4B) 동안 유사 분열 스핀들에 현지화했다. 그 LAP-타우와 상호 작용하는 단백질을 확인하려면이 SYS로 정제 할 수있다TEM, HEK293 LAP 타우 세포는 교반 수확 15 시간 동안 0.1 μg의 / ㎖의 Dox를로 유도 롤러 병으로 ~ 70 % 전면 생장 성장 LAP300 완충액으로 용해하고, LAP 타우은 상기 프로토콜을 사용하여 정제 하였다. LAP-타우 정화의 용출액은 SDS-PAGE에 의해 해결하고, 젤은 스테인드했다. 도 4c는 별표 (*)로 표시된 LAP-타우 정제, LAP-타우와 타우 상호 작용하는 단백질을 나타내는이 볼 수있는 여러 가지 다른 밴드 보여줍니다. <img alt="그림 1" src="/files/ftp_upload/54870/54870fig1.jpg" /> 그림 1 : 관심의 단백질에 대한 LAP-태그 유도 성 안정 세포 라인의 세대의 개요. 관심 유전자의 오픈 리딩 프레임 (ORF)은 attB1과 attB2 사이트를 각각 5 &#39;및 3&#39;말단 서열을 플 랭킹으로 증폭 (프라이머 서열에 나타내 표 1) 내로 클로닝<html> 셔틀 벡터. 관심의 유전자 서열 확인 셔틀 벡터는 다음 pGLAP1 벡터에 목적 유전자를 전달하기 위해 사용된다. 관심의 유전자 pGLAP1 벡터 확인 시퀀스는 단일 flippase 인식 대상 LAP에 대한 통합 사이트가 자신의 게놈 내에서 (FRT) 사이트를 포함하여 원하는 세포주에 flippase 재조합 효소를 함유하는 벡터로 공동 - 형질 -tagged 유전자. 이 세포주는 또한 LAP-태그 유전자의 상류 구정 리프레 구정 운영에 결합 (TetR) (TETO 2)를 표현하고 구정 / Dox가의 부재에서 발현을 침묵. 관심의 LAP-태그 유전자는 다음 FRT 사이트에 재결합하고 안정적인 통합 체는 하이 그로 마이신으로 선택됩니다. <a href="http://ecsource.jove.com/files/ftp_upload/54870/54870fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <html> 2 &quot;SRC =&quot;/ 파일 / ftp_upload / 54870 / 54870fig2.jpg &quot;/&gt; 그림 2 : LAP-태그 안정 세포주에 대한 응용 프로그램의 개요. LAP 태깅 유도 안정한 세포주 Dox를 첨가하여 관심 LAP 표지 된 단백질을 발현하도록 유도하고 세포주기의 여러 단계에서 동기화 될 수도 있고 임의의 신호 전달 경로를 활성화하는 화학 물질 또는 리간드로 자극 될 수있다. 관심있는 LAP-태그 단백질의 세포 내 현지화 라이브 셀 또는 고정 된 세포 이미징에 의해 분석 될 수있다. LAP 표지 된 단백질은 탠덤 친화 정제와 그들의 상호 작용 단백질 액체 크로마토 그래피 탠덤 질량 분석법 (LC-MS / MS)에 의해 확인 될 수있을 수있다. 마지막 Cytoscape 미끼 단백질의 단백질 - 단백질 상호 작용 네트워크를 생성하는데 사용될 수있다. DOX는 TEV는 TEV 단백질 분해 효소 절단 부위를 나타내고, EGFP가 녹색 형광 단백질을 강화 나타냅니다, IP는 면역 침전을 나타내고, 독시사이클린을 나타내고, S는 S-태그를 나타냅니다.http://ecsource.jove.com/files/ftp_upload/54870/54870fig2large.jpg &quot;대상 =&quot;_ 빈 &quot;&gt;이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. <img alt="그림 3" src="/files/ftp_upload/54870/54870fig3.jpg" /> 그림 3 : 질량 분석에 대한 LAP-태그 단백질 발현, 정제 및 제조의 개요. LAP-태그 단백질 발현의 1) 성장과 유도 해물의, 2) 세포 수확 및 용해, 3) 준비, 4) 항 GFP 구슬에 해물의 결합, 5) TEV 단백질 분해 효소 절단 : 프로토콜은 9 단계가 있습니다 GFP의 태그가, 6) S 단백질 비드 해물 결합 7) 미끼 단백질 및 상호 작용 단백질, 및 8-9) 질량 분석 기반 프로테옴 분석을위한 시료의 준비의 용출. <a href="http://ecsource.jove.com/files/ftp_upload/54870/54870fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> </p&gt; <img alt="그림 4" src="/files/ftp_upload/54870/54870fig4.jpg" /> 그림 4 : LAP-타우 식의 검증. (A) 웨스턴 블롯 (WB) 각각 LAP 태깅 된 타우 단백질과 튜 불린로드 제어를 검출 안티 GFP 및 안티 튜 불린 항체로 프로빙 유도 유도 비와 Dox를 LAP 타우 HEK293 세포로부터 단백질 샘플 분석. 세포가 Dox가로 유도하는 경우 그 LAP-타우 만 표현되어 있습니다. LAP-타우를 표현 (B) 유사 분열 세포를 고정하고 공동 스테인드 안티 - 튜 불린 항체 및 LAP 타우의 세포 내 현지화와 DNA (훽스트 33342) 및 튜 불린 (욕조)에 대한이 형광 축소 복사하여 분석 하였다. 그 LAP-타우가 유사 분열시 유사 분열 스핀들과 스핀들 극에 지역화합니다. (C) 실버는 LAP-타우 정화의 젤 스테인드. MW는 분자량을 나타내고, CL은 삭제 해물, 그리고 E의 인도어를 나타냅니다ATES 최종 용출액. 샘플은 4-20 % SDS-PAGE에서 실행하고, 겔 실버 정제 된 단백질을 시각화하기 위해 염색했다. LAP-타우에 해당하는 대역은 별표와 볼 수있는 단백질을 정화 공동 대응 여러 가지 다른 밴드로 표시되어 있습니다. <a href="http://ecsource.jove.com/files/ftp_upload/54870/54870fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> N- 말단 융합 </td><td></td></tr><tr><td> 앞으로 </td><td> 5&#39; GGGGACAAGT TTGTACAAAAAAGCAGGCT TCATG - (&gt; 18gsn) -3 &#39; </td></tr><tr><td> 역 </td><td> 5&#39; GGGGACCACTTTGTACAAGAAAGCTGGGT T TTATCA - (&gt; 18gsn) -3 &#39; </td></tr><tr><td> C 말단 융합 </td><td></td></tr><tr><td> 앞으로 </td><td> 5&#39; GGGGACAAGTTTGTACAAAAAAGCAGGCT TCACC - (&gt; 18gsn) -3 &#39; </td></tr><tr><td> 역 </td><td> 5&#39; GGGGACCACTTTGTACAAGAAAGCTGGGT G - (&gt; 18gsn) -3 &#39; </td></tr></tbody></table> 표 1 : 정 및 셔틀 벡터에 삽입하는 ORF 또는 관심을 증폭하기위한 프라이머 역. attB 사이트는 굵은 글씨로 강조되어 있으며, GSN은 18 개 이상의 유전자 특정 뉴클레오티드 프라이머에 추가되는 것을 의미한다. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td colspan="2"> 단계 </td><td> 온도 </td><td> 시각 </td></tr><tr><td colspan="2"> 초기 변성 </td><td> 94 ° C </td><td> 2 분 </td></tr><tr><td rowspan="3"> PCR 증폭 사이클 (35) </td><td> 변성하다 </td><td> 94 ° C </td><td> 30 초 </td></tr><tr><td> 어닐링 </td><td> 55 ° C (프라이머 Tm은에 따라 다름) </td><td> 30 초 </td></tr><tr><td> 넓히다 </td><td> 72 ° C </td><td> 1 분 / 킬로바이트 </td></tr><tr><td colspan="2"> 보류 </td><td> 4 ° C </td><td> 무기한 </td></tr></tbody></table> 표 2 : 관심의 개의 ORF의 증폭을위한 PCR 조건. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 벡터 </td><td> 앞으로 시퀀싱 프라이머 </td><td> 시퀀싱 프라이머 역 </td></tr><tr><td> 셔틀 벡터 </td><td> 5&#39;-TGTAAAACGACGGCCAGT-3 &#39; </td><td> 5&#39;-CAGGAAACAGCTATGAC-3 &#39; </td></tr></tbody></table> 표 3 : 셔틀 벡터에 대한 순방향 및 역방향 시퀀싱 프라이머. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 신분증 </td><td> 구조 </td><td> 부모의 </td><td> 발기인 </td><td> 혈중 알코올 농도가 해상도 </td><td> 엄만 해상도 </td><td> 구정 등록? </td></tr><tr><td> pGLAP1 </td><td> N-용어 EGFP-TEV-S 펩티드 </td><td> pcDNA5 / FRT / TO </td><td> CMV </td><td> 앰프 </td><td> HYG </td><td> 예 </td></tr><tr><td> pGLAP2 </td><td> N-용어 국기-TEV-S 펩티드 </td><td> pcDNA5 / FRT / TO </td><td> CMV </td><td> 앰프 </td><td> HYG </td><td> 예 </td></tr><tr><td> pGLAP3 </td><td> N-용어 EGFP-TEV-S 펩타이드; C-용어 V5 </td><td> pEF5 / FRT-V5 </td><td> EF1a </td><td> 앰프 </td><td> HYG </td><td> 아니 </td></tr><tr><td> pGLAP4 </td><td> N-용어 국기-TEV-S 펩타이드; ; C-용어 V5 </td><td> pEF5 / FRT-V5 </td><td> EF1a </td><td&gt; 앰프 </td><td> HYG </td><td> 아니 </td></tr><tr><td> pGLAP5 </td><td> C-용어 S 펩타이드 - PreProt X2-EGFP </td><td> pEF5 / FRT-V5 </td><td> EF1a </td><td> 앰프 </td><td> HYG </td><td> 아니 </td></tr></tbody></table> 표 4 : 변수 발기인, 에피토프 - 태그 및 N에 대한 Dox를 유도 성 표현 기능 또는 C 말단 단백질 태그와 함께 사용 가능 LAP / TAP 일러스트의 목록입니다. 벡터가 시판되고있다. 혈중 알코올 농도가 해상도가 세균의 내성 마커를 표시, 엄만 해상도는 포유 동물 세포 저항 마커, 구정의 등록 번호를 표시? 식 구정 / Dox가의 조절 성 여부를 나타냅니다. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 벡터 </td><td> 앞으로 시퀀싱 프라이머 </td><td> 시퀀싱 프라이머 역 </td></tr><tr><td> pGLAP1 </td><td> 5&#39;-ATCACTCTCGGCATGGACGAGCTGTACAAG-3 &#39; </td><td> 5&#39;-TGGCTGGCAACTAGAAGGCACAGTCGAGGC-3 &#39; </td></tr><tr><td> pGLAP2 </td><td> 5&#39;-CGAACGCCAGCACATGGACAGGG-3 &#39; </td><td> 5&#39;-TGGCTGGCAACTAGAAGGCACAGTCGAGGC-3 &#39; </td></tr><tr><td> pGLAP3 </td><td> 5&#39;-AGAAACCGCTGCTGCTAA-3 &#39; </td><td> 5&#39;-TAGAAGGCACAGTCGAGG-3 &#39; </td></tr><tr><td> pGLAP4 </td><td> 5&#39;-AGACCCAAGCTGGCTAGGTAAGC-3 &#39; </td><td> 5&#39;-TAGAAGGCACAGTCGAGG-3 &#39; </td></tr><tr><td> pGLAP5 </td><td> 5&#39;-CGTAATACGACTCACTATAG-3 &#39; </td><td> 5&#39;-TCCAGGGTCAAGGAAGGCACGG-3 &#39; </td></tr></tbody></table> 표 5 : pGLAP 벡터에 대한 순방향 및 역방향 시퀀싱 프라이머.

Watch this Scientific Journal Video about Inducible LAP-tagged Stable Cell Lines for Investigating Protein Function, Spatiotemporal Localization and Protein Interaction Networks at JoVE.com

Inducible LAP-tagged Stable Cell Lines for Investigating Protein Function, Spatiotemporal Localization and Protein Interaction Networks

We describe a method for generating localization and affinity purification (LAP)-tagged inducible stable cell lines for investigating protein function, spatiotemporal subcellular localization and protein-protein interaction networks.

조사 단백질 기능, 시공간 현지화 및 단백질 상호 작용 네트워크를위한 유도 LAP-태그 안정 세포주

Multi-protein complexes, rather than single proteins acting in isolation, often govern molecular pathways regulating cellular homeostasis. Based on this ...

inducible-lap-tagged-stable-cell-lines-for-investigating-protein

Research

JoVE Journal

Biology

9.8K 조회수.  University of California, Los Angeles. We describe a method for generating localization and affinity purification (LAP)-tagged inducible stable cell lines for investigating protein function, spatiotemporal subcellular localization and protein-protein interaction networks. 

비디오: Inducible LAP-tagged Stable Cell Lines for Investigating Protein Function, Spatiotemporal Localization and Protein Interaction Networks

Staining of Proteins in Gels with Coomassie G-250 without Organic Solvent and Acetic Acid

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents (Methanol, Ethanol or 2-Propanol) and acetic acid are used for fixation, staining and destaining of proteins in a gel after SDS-PAGE. To speed up the procedure, heating the staining solution in the microwave oven for a short time is frequently used. This usually results in evaporation of toxic or hazardous Methanol, Ethanol or 2-Propanol and a strong smell of acetic acid in the lab which should be avoided due to safety considerations. In a protocol originally published in two patent applications by E.M. Wondrak (US2001046709 (A1), US6319720 (B1)), an alternative composition of the staining solution is described in which no organic solvent or acid is used. The CBB is dissolved in bidistilled water (60-80mg of CBB G-250 per liter) and 35 mM HCl is added as the only other compound in the staining solution. The CBB staning of the gel is done after SDS-PAGE and thorough washing of the gel in bidistilled water. By heating the gel during the washing and staining steps, the process can be finished faster and no toxic or hazardous compunds are evaporating. The staining of proteins occurs already within 1 minute after heating the gel in staining solution and is fully developed after 15-30 min with a slightly blue background that is destained completely by prolonged washing of the stained gel in bidistilled water, without affecting the stained protein bands.

A short protocol for protein staining with Coomassie Brilliant Blue (CBB) G-250 in polyacrylamide gels is described without using organic solvents or acetic acid as in the classical staining procedures with CBB.

유기 용매 및 초산없이 쿠매시 G - 250로 젤의 단백질 염색법

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents ...

연구

생물학

Using the GELFREE 8100 Fractionation System for Molecular Weight-Based Fractionation with Liquid Phase Recovery

The GELFREE 8100 Fractionation System is a novel protein fractionation system designed to maximize protein recovery during molecular weight based fractionation. The system is comprised of single-use, 8-sample capacity cartridges and a benchtop GELFREE Fractionation Instrument. During separation, a constant voltage is applied between the anode and cathode reservoirs, and each protein mixture is electrophoretically driven from a loading chamber into a specially designed gel column gel. Proteins are concentrated into a tight band in a stacking gel, and separated based on their respective electrophoretic mobilities in a resolving gel. As proteins elute from the column, they are trapped and concentrated in liquid phase in the collection chamber, free of the gel. The instrument is then paused at specific time intervals, and fractions are collected using a pipette. This process is repeated until all desired fractions have been collected. If fewer than 8 samples are run on a cartridge, any unused chambers can be used in subsequent separations.
This novel technology facilitates the quick and simple separation of up to 8 complex protein mixtures simultaneously, and offers several advantages when compared to previously available fractionation methods. This system is capable of fractionating up to 1mg of total protein per channel, for a total of 8mg per cartridge. Intact proteins over a broad mass range are separated on the basis of molecular weight, retaining important physiochemical properties of the analyte. The liquid phase entrapment provides for high recovery while eliminating the need for band or spot cutting, making the fractionation process highly reproducible1.

The accompanying video describes the use of the GELFREE 8100 Fractionation System, which partitions complex protein samples on the basis of molecular weight and recovers the fractions in liquid phase. The video describes how the technology works, how it is used, and provides resultant data, with polyacrylamide gel electrophoresis analysis of fractionated bovine liver homogenate.

액상 복구와 분자량 기반 분류에 대한 GELFREE 8100 분획화 시스템을 사용하여

The GELFREE 8100 Fractionation System is a novel protein fractionation system designed to maximize protein recovery during molecular weight based ...

Bimolecular Fluorescence Complementation (BiFC) Assay for Protein-Protein Interaction in Onion Cells Using the Helios Gene Gun

Investigation of gene function in diverse organisms relies on knowledge of how the gene products interact with each other in their normal cellular environment. The Bimolecular Fluorescence Complementation (BiFC) Assay1 allows researchers to visualize protein-protein interactions in living cells and has become an essential research tool. This assay is based on the facilitated association of two fragments of a fluorescent protein (GFP) that are each fused to a potential interacting protein partner. The interaction of the two protein partners would facilitate the association of the N-terminal and C-terminal fragment of GFP, leading to fluorescence. For plant researchers, onion epidermal cells are an ideal experimental system for conducting the BiFC assay because of the ease in obtaining and preparing onion tissues and the direct visualization of fluorescence with minimal background fluorescence. The Helios Gene Gun (BioRad) is commonly used for bombarding plasmid DNA into onion cells. We demonstrate the use of Helios Gene Gun to introduce plasmid constructs for two interacting Arabidopsis thaliana transcription factors, SEUSS (SEU) and LEUNIG HOMOLOG (LUH)2 and the visualization of their interactions mediated by BiFC in onion epidermal cells.

Bimolecular Fluorescence Complementation BiFC Assay for Protein-Protein Interaction in Onion Cells Using the Helios Gene Gun

This article illustrates how to properly use the BioRad Helios Gene Gun to introduce plasmid DNA into onion epidermal cells and how to test for protein-protein interactions in onion cells based on the principle of Bimolecular Fluorescence Complementation (BiFC)

헬리 우스 진 건을 사용하여 양파 세포에서 단백질 - 단백질 상호 작용에 대한 Bimolecular 형광 Complementation (BiFC) 어세이

Investigation of gene function in diverse organisms relies on knowledge of how the gene products interact with each other in their normal cellular ...

Generation of Stable Human Cell Lines with Tetracycline-inducible (Tet-on) shRNA or cDNA Expression

A major approach in the field of mammalian cell biology is the manipulation of the expression of genes of interest in selected cell lines, with the aim to reveal one or several of the gene's function(s) using transient/stable overexpression or knockdown of the gene of interest. Unfortunately, for various cell biological investigations this approach is unsuitable when manipulations of gene expression result in cell growth/proliferation defects or unwanted cell differentiation. Therefore, researchers have adapted the Tetracycline repressor protein (TetR), taken from the E. coli tetracycline resistance operon1, to generate very efficient and tight regulatory systems to express cDNAs in mammalian cells2,3. In short, TetR has been modified to either (1) block initiation of transcription by binding to the Tet-operator (TO) in the promoter region upon addition of tetracycline (termed Tet-off system) or (2) bind to the TO in the absence of tetracycline (termed Tet-on system) (Figure 1). Given the inconvenience that the Tet-off system requires the continuous presence of tetracycline (which has a half-life of about 24 hr in tissue cell culture medium) the Tet-on system has been more extensively optimized, resulting in the development of very tight and efficient vector systems for cDNA expression as used here.
Shortly after establishment of RNA interference (RNAi) for gene knockdown in mammalian cells4, vectors expressing short-hairpin RNAs (shRNAs) were described that function very similar to siRNAs5-11. However, these shRNA-mediated knockdown approaches have the same limitation as conventional knockout strategies, since stable depletion is not feasible when gene targets are essential for cellular survival. To overcome this limitation, van de Wetering et al.12 modified the shRNA expression vector pSUPER5 by inserting a TO in the promoter region, which enabled them to generate stable cell lines with tetracycline-inducible depletion of their target genes of interest.
Here, we describe a method to efficiently generate stable human Tet-on cell lines that reliably drive either inducible overexpression or depletion of the gene of interest. Using this method, we have successfully generated Tet-on cell lines which significantly facilitated the analysis of the MST/hMOB/NDR cascade in centrosome13,14 and apoptosis signaling15,16. In this report, we describe our vectors of choice, in addition to describing the two consecutive manipulation steps that are necessary to efficiently generate human Tet-on cell lines (Figure 2). Moreover, besides outlining a protocol for the generation of human Tet-on cell lines, we will discuss critical aspects regarding the technical procedures and the characterization of Tet-on cells.

Generation of Stable Human Cell Lines with Tetracycline-inducible Tet-on shRNA or cDNA Expression

A rapid and simple way to generate human cell lines with inducible and reversible cDNA overexpression or shRNA-mediated knock-down of the gene of interest. This method enables researchers to reliably and highly reproducibly manipulate cell lines that are difficult to alter by transient transfection methods or conventional knockdown/knockout strategies.

테트라싸이클린-inducible (Tet-에서) shRNA 또는 cDNA 표현과 안정적인 인간 세포 라인의 생성

A major approach in  the field of mammalian cell biology is the manipulation of the expression of  genes of interest in selected cell lines, with the aim ...

Investigating Protein-protein Interactions in Live Cells Using Bioluminescence Resonance Energy Transfer

Assays based on Bioluminescence Resonance Energy Transfer (BRET) provide a sensitive and reliable means to monitor protein-protein interactions in live cells. BRET is the non-radiative transfer of energy from a 'donor' luciferase enzyme to an 'acceptor' fluorescent protein. In the most common configuration of this assay, the donor is Renilla reniformis luciferase and the acceptor is Yellow Fluorescent Protein (YFP). Because the efficiency of energy transfer is strongly distance-dependent, observation of the BRET phenomenon requires that the donor and acceptor be in close proximity. To test for an interaction between two proteins of interest in cultured mammalian cells, one protein is expressed as a fusion with luciferase and the second as a fusion with YFP. An interaction between the two proteins of interest may bring the donor and acceptor sufficiently close for energy transfer to occur. Compared to other techniques for investigating protein-protein interactions, the BRET assay is sensitive, requires little hands-on time and few reagents, and is able to detect interactions which are weak, transient, or dependent on the biochemical environment found within a live cell. It is therefore an ideal approach for confirming putative interactions suggested by yeast two-hybrid or mass spectrometry proteomics studies, and in addition it is well-suited for mapping interacting regions, assessing the effect of post-translational modifications on protein-protein interactions, and evaluating the impact of mutations identified in patient DNA.

Interactions between proteins are fundamental to all cellular processes. Using Bioluminescence Resonance Energy Transfer, the interaction between a pair of proteins can be monitored in live cells and in real time. Furthermore, the effects of potentially pathogenic mutations can be assessed.

생물 발광 공명 에너지 전달을 이용하여 살아있는 세포에서 단백질 - 단백질 상호 작용을 조사

Assays based on Bioluminescence Resonance Energy Transfer (BRET) provide a sensitive and reliable means to monitor protein-protein interactions in live ...

Discovering Protein Interactions and Characterizing Protein Function Using HaloTag Technology

Research in proteomics has exploded in recent years with advances in mass spectrometry capabilities that have led to the characterization of numerous proteomes, including those from viruses, bacteria, and yeast.&#160; In comparison, analysis of the human proteome lags behind, partially due to the sheer number of proteins which must be studied, but also the complexity of networks and interactions these present. To specifically address the challenges of understanding the human proteome, we have developed HaloTag technology for protein isolation, particularly strong for isolation of multiprotein complexes and allowing more efficient capture of weak or transient interactions and/or proteins in low abundance. &#160;HaloTag is a genetically encoded protein fusion tag, designed for covalent, specific, and rapid immobilization or labelling of proteins with various ligands. Leveraging these properties, numerous applications for mammalian cells were developed to characterize protein function and here we present methodologies including: protein pull-downs used for discovery of novel interactions or functional assays, and cellular localization. We find significant advantages in the speed, specificity, and covalent capture of fusion proteins to surfaces for proteomic analysis as compared to other traditional non-covalent approaches. We demonstrate these and the broad utility of the technology using two important epigenetic proteins as examples, the human bromodomain protein BRD4, and histone deacetylase HDAC1.&#160; These examples demonstrate the power of this technology in enabling &#160;the discovery of novel interactions and characterizing cellular localization in eukaryotes, which will together further understanding of human functional proteomics. &#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;

HaloTag technology is a multifunctional technology which has shown significant success in isolation of both small and large protein complexes from mammalian cells.&#160; Here we highlight the advantages of this technology compared to existing alternatives and demonstrate its utility to study numerous aspects of protein function inside eukaryotic cells.

단백질 상호 작용을 발견하고 HaloTag 기술을 사용하여 단백질의 기능을 특성화

Research in proteomics has exploded in recent years with advances in mass spectrometry capabilities that have led to the characterization of numerous ...

Identifying Protein-protein Interaction Sites Using Peptide Arrays

Protein-protein interactions mediate most of the processes in the living cell and control homeostasis of the organism. Impaired protein interactions may result in disease, making protein interactions important drug targets. It is thus highly important to understand these interactions at the molecular level. Protein interactions are studied using a variety of techniques ranging from cellular and biochemical assays to quantitative biophysical assays, and these may be performed either with full-length proteins, with protein domains or with peptides. Peptides serve as excellent tools to study protein interactions since peptides can be easily synthesized and allow the focusing on specific interaction sites. Peptide arrays enable the identification of the interaction sites between two proteins as well as screening for peptides that bind the target protein for therapeutic purposes. They also allow high throughput SAR studies. For identification of binding sites, a typical peptide array usually contains partly overlapping 10-20 residues peptides derived from the full sequences of one or more partner proteins of the desired target protein. Screening the array for binding the target protein reveals the binding peptides, corresponding to the binding sites in the partner proteins, in an easy and fast method using only small amount of protein.
In this article we describe a protocol for screening peptide arrays for mapping the interaction sites between a target protein and its partners. The peptide array is designed based on the sequences of the partner proteins taking into account their secondary structures. The arrays used in this protocol were Celluspots arrays prepared by INTAVIS Bioanalytical Instruments. The array is blocked to prevent unspecific binding and then incubated with the studied protein. Detection using an antibody reveals the binding peptides corresponding to the specific interaction sites between the proteins.

Peptide array screening is a high throughput assay for identifying protein-protein interaction sites. This allows mapping multiple interactions of a target protein and can serve as a method for identifying sites for inhibitors that target a protein. Here we describe a protocol for screening and analyzing peptide arrays.

펩타이드 배열을 사용하여 단백질 - 단백질 상호 작용 사이트를 확인

Protein-protein interactions mediate most of the processes in the living cell and control homeostasis of the organism. Impaired protein interactions may ...

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and the inherent instability of many membrane proteins once solubilized in detergents. A protocol is described that combines ligation independent cloning of membrane proteins as GFP fusions with expression in Escherichia coli detected by GFP fluorescence. This enables the construction and expression screening of multiple membrane protein/variants to identify candidates suitable for further investment of time and effort. The GFP reporter is used in a primary screen of expression by visualizing GFP fluorescence following SDS polyacrylamide gel electrophoresis (SDS-PAGE). Membrane proteins that show both a high expression level with minimum degradation as indicated by the absence of free GFP, are selected for a secondary screen. These constructs are scaled and a total membrane fraction prepared and solubilized in four different detergents. Following ultracentrifugation to remove detergent-insoluble material, lysates are analyzed by fluorescence detection size exclusion chromatography (FSEC). Monitoring the size exclusion profile by GFP fluorescence provides information about the mono-dispersity and integrity of the membrane proteins in different detergents. Protein: detergent combinations that elute with a symmetrical peak with little or no free GFP and minimum aggregation are candidates for subsequent purification. Using the above methodology, the heterologous expression in E. coli of SED (shape, elongation, division, and sporulation) proteins from 47 different species of bacteria was analyzed. These proteins typically have ten transmembrane domains and are essential for cell division. The results show that the production of the SEDs orthologues in E. coli was highly variable with respect to the expression levels and integrity of the GFP fusion proteins. The experiment identified a subset for further investigation.

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

A streamlined approach to screening for the expression of recombinant membrane proteins in Escherichia coli based on fusion to green fluorescent protein is presented.

막 단백질의 녹색 형광 단백질 기반의 표현 상영에<em&gt; 대장균</em

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and ...

Functional Reconstitution and Channel Activity Measurements of Purified Wildtype and Mutant CFTR Protein

The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a unique channel-forming member of the ATP Binding Cassette (ABC) superfamily of transporters. The phosphorylation and nucleotide dependent chloride channel activity of CFTR has been frequently studied in whole cell systems and as single channels in excised membrane patches. Many Cystic Fibrosis-causing mutations have been shown to alter this activity. While a small number of purification protocols have been published, a fast reconstitution method that retains channel activity and a suitable method for studying population channel activity in a purified system have been lacking. Here rapid methods are described for purification and functional reconstitution of the full-length CFTR protein into proteoliposomes of defined lipid composition that retains activity as a regulated halide channel. This reconstitution method together with a novel flux-based assay of channel activity is a suitable system for studying the population channel properties of wild type CFTR and the disease-causing mutants F508del- and G551D-CFTR. Specifically, the method has utility in studying the direct effects of phosphorylation, nucleotides and small molecules such as potentiators and inhibitors on CFTR channel activity. The methods are also amenable to the study of other membrane channels/transporters for anionic substrates.

Described here is a rapid and effective procedure for functional reconstitution of purified wild-type and mutant CFTR protein that preserves activity for this chloride channel, which is defective in Cystic Fibrosis. Iodide efflux from reconstituted proteoliposomes mediated by CFTR allows studies of channel activity and the effects of small molecules.

정제 된 야생형과 돌연변이 체 CFTR 단백질의 기능의 재구성 및 채널 활동 측정

The Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a unique channel-forming member of the ATP Binding Cassette (ABC) superfamily of ...

Selected Reaction Monitoring Mass Spectrometry for Absolute Protein Quantification

Absolute quantification of target proteins within complex biological samples is critical to a wide range of research and clinical applications. This protocol provides step-by-step instructions for the development and application of quantitative assays using selected reaction monitoring (SRM) mass spectrometry (MS). First, likely quantotypic target peptides are identified based on numerous criteria. This includes identifying proteotypic peptides, avoiding sites of posttranslational modification, and analyzing the uniqueness of the target peptide to the target protein. Next, crude external peptide standards are synthesized and used to develop SRM assays, and the resulting assays are used to perform qualitative analyses of the biological samples. Finally, purified, quantified, heavy isotope labeled internal peptide standards are prepared and used to perform isotope dilution series SRM assays. Analysis of all of the resulting MS data is presented. This protocol was used to accurately assay the absolute abundance of proteins of the chemotaxis signaling pathway within RAW 264.7 cells (a mouse monocyte/macrophage cell line). The quantification of Gi2 (a heterotrimeric G-protein &#945;-subunit) is described in detail.

This protocol describes how to perform absolute quantification assays of target proteins within complex biological samples using selected reaction monitoring. It was used to accurately quantify proteins of the mouse macrophage chemotaxis signaling pathway. Target peptide selection, assay development, and qualitative and quantitative assays are described in detail.

절대 단백질 정량 질량 분석을 모니터링 선정 반응

Absolute quantification of target proteins within complex biological samples is critical to a wide range of research and clinical applications. This ...