This work was supported by a National Science Foundation Grant NSF-MCB1243645 (JZT), any opinions, findings, and conclusions or recommendations expressed in this material are those of the authors and do not necessarily reflect the views of the National Science Foundation. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

주 : 관심있는 단백질을 유도 LAP 태깅 안정한 세포주의 생성의 개요는도 1에 도시되어 LAP 표지 된 단백질의 발현, 정제 및 질량 단백체 준비의 개요가도 3에 도시되어 분석한다. 1. LAP-태그 벡터로 관심의 유전자의 오픈 리딩 프레임 (ORF)을 복제 <ol><li> 셔틀 벡터로 관심의 유전자의 ORF를 복제. <ol><li> N 말단 융합 또는 C 말단 융합 어느 용 프라이머 내의 적절한 attB1과 attB2 사이트와 관심의 ORF를 증폭하는 중합 효소 연쇄 반응 (PCR)을 사용한다. PCR 조건 프라이머 서열 표 2 표 1을 참조하십시오. </li><li> 겔을 1 % 아가 로스 겔에서 이러한 문제를 해결하여 PCR 산물을 정제. 겔에서 올바른 크기의 증폭 밴드를 절제하고, DNA의 g를 사용하여 겔 조각에서 압축을 풉니 다제조업체의 지침에 따라 엘 추출 키트. </li><li> 셔틀 벡터를 포함하는 attP 및 PCR 제품은 제조자의 지시에 따라 벡터에 재결합 할 수있는 재조합 효소로 PCR 산물을 함유하는 정제 attB 부화 (M aterials의 도표 참조). 참고 : 빈 셔틀 벡터와 LAP 태그 벡터가 CCD의 B 유전자를 포함하고 CCD의 B 내성 박테리아 세포에 전달되어야한다 (재료 표 참조). ORF가이 벡터 내로 삽입 될 때 그러나 ccdB 유전자를 클로닝하는 ORF와 벡터를 전파 할 때 그에 DH5α 표준 대장균을 사용하여 아웃 재결합된다. </li><li> 루리아 브로 쓰 (LB) 50mg을 한천 플레이트 / ml의 카나마이신 (13) 상에 변환 된 세포 반응 생성물 1 μL로 DH5α 대장균 세포를 형질 접시. </li><li> 카나마이신 내성 콜로니를 선택합니다. </li><li> LB 내에서 선택한 식민지를 성장50 ㎎ / ㎖ 카나마이신으로 직경은 DNA 미니 - 프렙을 표 3에 열거 된 시퀀싱 프라이머를 사용하여 DNA 시퀀싱에 의해 유전자 통합을 확인한다. </li></ol></li><li> LAP-태그 벡터에 셔틀 벡터에서 관심의 유전자를 전송. <ol><li> LAP-태그 벡터와에 따라, LAP-태그 벡터에 셔틀 벡터에서 관심의 유전자의 전달을 매개 재조합 효소 (융합 N 말단에 대한 pGLAP1)과이자 ORF의 서열 확인 유전자를 함유하는 셔틀 벡터를 품다 제조업체의 지침 (자료 참조). 주의 : 원하는 프로모터, 에피토프 태그에 기초하여 사용될 수있다 LAP / TAP 벡터 시리즈와 N 또는 C 말단 태그는 표 4에서 찾아 볼 수있다. </li><li> 100 ㎎ / ㎖ 암피실린 (13)과 함께 LB 한천 플레이트 상에 형질 전환 세포 반응 생성물 1 μL로 DH5α 대장균 세포를 형질 접시. </li><li> 암피실린 내성 콜로을 선택가 다진. </li><li> , 100 ㎎ / ㎖ 암피실린와 LB 미디어에서 선택한 식민지를 성장하는 DNA 미니 사전을, 표 5에 나열된 순서 프라이머를 사용하여 DNA 염기 서열에 의해 유전자의 통합을 확인합니다. </li></ol></li></ol> 관심의 LAP-태그 유전자를 표현합니다 유도 안정 세포주의 2 세대 <ol><li> 관심있는 프로젝트에 가장 적합한 세포주를 선택합니다. 대안 적으로, 구조적 TetR를 표현하고 (원료 참조) 관심 LAP 태깅 유전자가 안정적으로 게놈 내로 통합 될 수있는 FRT 부위를 포함하는 기존의 세포주에서 숙주 세포 라인을 생성한다. 주 :이 프로토콜은 4 테트라 사이클린 (-Tet)의 결여이며, 10 % 소 태아 혈청 (FBS)으로 만든] -Tet DMEM / F12 배지에서 배양되는 TetR 및 FRT 부위를 포함하는 HEK293 세포주를 사용 . </li><li> 하이 그로 마이신의 최소 농도를 결정하는 것은이 연소로 (1) 내의 숙주 세포주를 죽이는 데 필요한약물 첨가 후 KS. 농도는 대부분 100 ㎖ μg의 / 800 μg의 / ㎖ 사이의 범위로, 숙주 세포 라인에 따라 다를 수 있습니다. 참고 : 37 ° C와 5 % CO 2 1 ~ 2 주 이내에 죽을 것 100 μg의 / ㎖ 하이 그로 마이신과 -Tet DMEM / F12 미디어에서 성장 HEK293 세포. </li><li> 공동 형질 flippase의 재조합 효소는 형질 전환 시약을 사용하여 HEK293 세포에 LAP-태그 벡터 (세포의 게놈 내에서 FRT 사이트에 관심있는 LAP-태그 유전자의 통합을 매개) 발현 벡터를 같은 제조업체의 지침에 따라 . 4의 비율을 사용하여 재조합 벡터의 1 LAP 벡터 (14)에. 주 : 최적의 비율은 형질 숙주 세포주 및 방법에 의존하고, 적정을 요구할 수있다. 4의 비율 : 1은 대부분의 세포 라인에 적합합니다. 음성 대조군으로 모의 형질 플레이트를 포함합니다. </li><li> 어느 날 후 형질 전환, 새로운 미디어와 -Tet DMEM / F12 미디어를 교체합니다. </li><li> 이틀 후 transfecti25 %의 합류로, 분할 세포. 셀 ~ 부착 5 시간은, 단계 2.2 소정의 농도로 하이 그로 마이신 함유 -Tet DMEM / F12 미디어를 추가 할 수 있습니다. HEK293를 들어 세포는 100 μg의 / ㎖ 하이 그로 마이신을 사용합니다. 주 : HEK293 세포주를 포함하는 FRT 또한 블라스트 저항과 관련된 따라서 5 μg의 / ㎖ 블라스트이 TetR위한 선택하여 누설 식을 최소화하는 안정한 세포주의 선택 과정에 사용되는 TetR를 포함한다. </li><li> 별개의 세포 초점이 투명 판에 대한 불투명 한 점을 닮은이 나타날 때까지 필요에 따라 -Tet DMEM / F12 미디어를 하이 그로 마이신이 함유 교체합니다. </li><li> 200 μL 피펫 팁과 각 셀의 초점의 상단에 트립신 20 μl를 추가하고 최대 피펫 아래로 2 회. 장소 24 웰 플레이트에서 세포와 하이 그로 마이신 함유 -Tet DMEM / F12 미디어의 지속적인 성장에 의해 세포를 확장합니다. </li><li> 고정 셀 또는 라이브 셀 형광 현미경으로 유도 LAP-태그 단백질 발현을위한 화면 세포 및 / 또는LAP-태그 (15) 내에서 GFP 태그 웨스턴 블로 팅. </li></ol> LAP-태그 단백질 복합체의 3 정화 참고 : 이전의 경험을 바탕으로 일반적인 LAP-태그 단백질 정제에 사용되는 조건 및 볼륨에 다음 LAP-태그 단백질 정제 프로토콜 세부 권장 사항. 그러나주의 경험적 최적화가 최상의 결과를 제공하기 위해 관심의 단백질 복합체 단백질 발현 수준에 대해 수행되는 것을 보장하기 위해 행사되어야한다. <ol><li> 세포 성장과 세포 수확. <ol><li> 지속적으로 37 ° C, 5 % CO 2에서 -Tet DMEM / F12 미디어에 더 큰 판 및 / 또는 롤러 병에 모든 HEK293 세포를 계대에 의해, 단백질 복합체의 TAP 분리에 대한 검증 LAP-태그 세포주를 확장합니다. </li><li> 테트 / Dox를 유도 세포주, harvestin 전에 0.2 μg의 / ㎖ 테트 / Dox를 세포에 도달 ~ 70 % 포화 상태의 농도에서 10 내지 15 시간 동안 유도g 세포. 참고 : 농도와 유도 시간이 각각의 단백질 결정되어야한다, 10 ~ 15 시간 동안 0.1 μg의 / ㎖ 테트 / Dox가의 적정 권장합니다. </li><li> 교반 또는 트립신 및 펠릿 세포 5 ~ 10 분 동안 875 XG에 의해 수확 세포. </li></ol></li><li> 커플 링 방지 GFP 항체 단백질 A 구슬에 <ol><li> A A 0.5 ml의 세포 펠렛으로부터 제조 해물, 포장 세포 부피 (PCV)에서 면역에 대한 항체의 40 μg의를 사용합니다. 참고 : 다른 요소들 사이의 LAP-태그 단백질의 풍부에 따라 달라집니다 필요한 항체의 양 및 최적화가 필요합니다. 10 ~ 40 μg의의 적정 권장합니다. </li><li> 1.5 ML 튜브에 PBST (PBS + 0.1 % 트윈 20)에 160 ㎕의 포장 볼륨 (PV) 단백질 A 구슬 평형. PBST 1 ㎖로 3 회 반복한다. 참고 : 여기에 모든 세척이 10 초 동안 5,000 XG에 구슬을 원심 분리하여 수행된다. </li><li> 를 Resuspend 구슬 500 μL의 PBST과 친 화성의 80 μg의 추가160 μL 비드 각 튜브 - 정수 토끼 항 GFP 항체. 실온에서 1 시간 (RT) 동안 혼합한다. </li><li> PBST 1 ml의 구슬을 2 회 반복한다. 그런 다음, 0.2 M 붕산 나트륨, pH가 9 (20 ml의 0.2 M 붕산 나트륨 + 15 ml의 0.2 M 붕산)의 1 ml의 구슬을 2 회 반복한다. 최종 세척 후, 1 ml의 최종 볼륨을 가지고 0.2 M 붕산 나트륨의 900 μL, pH가 9를 추가합니다. </li><li> 20 mm의 최종 농도 220 MM의 dimethylpimelimidate (DMP) 100 μl를 추가합니다. 30 분 동안 실온에서 부드럽게 튜브를 회전합니다. 220 mM의 DMP를 들어, 0.2 M 붕산 나트륨, pH가 9 877 ㎕를 한 50 mg의 병의 내용을 재현 탁하고 비드 현탁액에 바로 추가 할 수 있습니다. </li><li> DMP와 함께 배양 한 후, 잔류 가교제를 비활성화하는 0.2 M 에탄올 아민, 0.2 M의 NaCl 산도 8.5의 1 ml의 구슬 1 시간을 씻는다. 같은 버퍼 1 ㎖과에 재현 탁 비즈 실온에서 1 시간 동안 회전합니다. 펠렛의 구슬과 0.2 M 에탄올 아민, 0.2 M의 NaCl의 pH 8.5의 500 μL에 재현 탁 구슬. 비즈 severa에 대한 안정4 ° C에서 리터 개월. </li></ol></li><li> 세포 용해 및 복합 정제를위한 버퍼의 준비 <ol><li> pH가 7.4 용액함으로써 (세포 용해를위한 300 mm의 가장 비드 세척 200 mm의 세척 구슬 100 mM의 용출에 앞서 단백질 X는 LAP 버퍼의 원하는 염 농도 [mM의 KCl을] 임) LAPX 버퍼를 준비 의 50 mM 4- (2- 히드 록시 에틸) -1- 피페 라진 에탄 술폰산 (HEPES), X 밀리미터의 KCl, 1 mM의 에틸렌 글리콜 테트라 산 (EGTA), 1 ㎜의 MgCl 2, 10 % 글리세롤을 함유. 주 :이 완충액의 성분은 살아있는 세포에서의 환경에 근사하는 데 사용된다. HEPES는 7.2-8.2의 pH 분노의 버퍼로 사용됩니다. KCl을 버퍼의 이온 강도를 유지하기 위해 사용되는 염이다. EGTA 마그네슘에 비하여 칼슘 수준을 감소시키기 위해 칼슘 이온 결합하는 킬레이트 제이다. 글리세롤의 MgCl 2 단백질의 안정성을 향상시키기 위해 사용된다. </li><li> 0.05 % 노닐 phenoxypol 추가하여 LAPX N 버퍼를 준비LAPX 버퍼에 yethoxylethanol. 주 : 노닐 phenoxypolyethoxylethanol 단백질을 가용화 중성 세제이지만, 이에 따라 높은 농도의 추출 과정에 사용되는 단백질 - 단백질 상호 작용을 유지하고이어서 결합 및 세척 단계에서 저하된다. </li></ol></li><li> 세포 용 해물의 제조 <ol><li> 0.5 mM의 디티 오 트레이 톨 (DTT) 및 프로테아제 억제제로 LAP300 2.5 ㎖ 중에 PCV 500 μl를 재현 탁. 10 % 노닐 phenoxypolyethoxylethanol (최종 0.3 %)의 90 μl를 추가하고 반전으로 섞는다. </li><li> 10 분 동안 얼음에 놓습니다. 10 분 동안 21,000 XG에 원심 분리기. 이 저속 상층 액 (LSS)를 수집합니다. 젤 분석을위한 LSS의 10 μL 샘플을 가져 가라. </li><li> 4 ° C에서 1 시간 동안 100,000 XG에서 TLA100.3 튜브와 스핀에 LSS를 전송합니다. 튜브에,이 고속 뜨는 (HSS)를 수집하고 얼음에 배치합니다. 젤 분석을위한 HSS의 10 μL 샘플을 가져 가라. 참고 : 최상위 지질 층을 복용하지 마십시오D 하단 대부분 세포 파편 층. 지방층은 HSS를 수집하기 전에, 진공 흡인에 의해 제거되어야한다. </li></ol></li><li> 첫째 선호도 캡처 : 안티 GFP 비즈에 바인딩 <ol><li> 사전 용출 항체 결합 구슬 비 결합을 제거하는 용출 버퍼 [20 mM 트리스, pH 7.4의 3.5 M의 MgCl 2] 1 ㎖로 3 회 세척 (0.5 ml의 세포 펠렛 (PCV) 당 구슬의 160 μl를 사용) 항체와 배경을 줄일 수 있습니다. 신속하게 수행합니다. 오랜 시간 동안 높은 소금에 구슬을 두지 마십시오. </li><li> LAP200 N의 1 ml의 구슬을 3 회 반복한다. HSS는 4 ° C에서 1 시간 동안 항체 구슬 추출 섞는다. 10 분 동안 21,000 XG에 원심 분리기. 상층 액의 10 μl의 샘플을 가지고 (즉, (FT)를 통해 흐름) 젤 분석. </li><li> 0.5 mM의 DTT 및 프로테아제 억제제와 LAP200 N의 1 ml의 구슬을 3 회 반복한다. 0.5 mM의 DTT 및 프로테아제 억제제와 LAP200 N의 1 ml의 구슬을 2 회 (5 분마다)를 씻으십시오. 2t 신속하게 세척1 0.5 mM의 DTT와 LAP200 N ㎖의 담배 식각 바이러스 (TEV) 단백질 분해 효소를 추가하기 전에없이 단백질 분해 효소 억제제와 IME를. </li></ol></li><li> TEV 절단 <ol><li> LAP200 N 1 ml의 10 μg의 TEV 단백질 분해 효소를 희석하고 밤새 4 ° C에서 튜브를 회전합니다. 참고 :이 단계는 모든 LAP-태그 단백질을 최적화 할 수는 LAP-태그 단백질 복합체의 보존에 도움이 될 수 TEV 단백질 분해 효소의 농도를 조절하여 몇 시간에 완료 할 수 있습니다. </li><li> 새로운 튜브에 펠렛 구슬과 전송 상층 액. 잔여 단백질을 제거하기 위해 0.5 mM의 DTT 160 ㎕를 LAP200 N과 단백질 분해 효소 억제제 (트리플 농도)로 두 번 구슬을 씻어. 젤 분석을위한 뜨는의 10 μL 샘플을 가져 가라. </li></ol></li><li> 둘째 선호도 캡처 : S 단백질 아가로 오스 바인딩 <ol><li> 80 μl의 S 단백질 아가로 오스 슬러리의 1 튜브 (40 μl의 포장 수지) LAP200 N 1 ml의 3 회 반복한다. 참고 : S의 제자EIN의 RNase 활성을 재구성 할 S-tag에 결합하고 다른 두번째 에피토프 태그를 함유하는 RNA 단백질 복합체에 대해 고려되어야한다. </li><li> 추가 TEV는 4 ° C에서 3 시간 동안 S 단백질 아가로 오스 구슬과 바위에 뜨는 용출. 펠렛의 구슬과 0.5 mM의 DTT 및 프로테아제 억제제와 LAP200 N 1 ㎖로 3 회 씻는다. LAP100 1 ml의 구슬을 2 회 반복한다. </li></ol></li><li> 단백질 용출 <ol><li> 10 분 동안 97 ° C에서 4X 램 믈리 시료 완충액과 열 50 μl를 첨가하여 아가 S 단백질을 단백질을 용출시킨다. 주 : 단백질은 용출 완충액 (20 mM 트리스, pH 7.4의 3.5 M의 MgCl 2)로 비드로부터 용출된다. </li></ol></li></ol> 4. 질량 분광법 분석에 의해 상호 작용 단백질을 확인 <ol><li> 볼 (도데 실 황산나트륨 폴리 아크릴 아미드 겔 전기 영동 (SDS-PAGE), 실버 염색 겔에 의해 수집 된 샘플을 분석하여, 정제의 품질을 테스트 <strong&gt; 자료 표)와 용출액을 면역 블과 그림 4 참조 LAP-태그 정화는 16 일 않도록 방지 GFP 항체와 프로빙에 의해. </li><li> 화학 양론과 화학량 론적 공동 정화 종을 식별하기 위해 최종 용출 샘플을 채취하고 SDS-PAGE하여 구분합니다. 질량 분석 호환 단백질 얼룩 젤을 얼룩. 가장 눈에 띄는 밴드와 겔에서 그들 사이의 공간을 절제 및 질량 분석 별도로 (16)에 의해 분석을 처리합니다. 참고 : 최종 정제 용출액을 분리하여 질량 분석 5를 제조하는 다양한 방법이있다. 예를 들어, LAP 정제 된 복합체는 높은 염 (3.5 M의 MgCl 2)를 한꺼번에 질량 분석계 (17)에 의해 분석 될 수 도중에 전체 단백질 집단을 이용하여 S - 단백질 비드로부터 용출된다. 대안 적으로, 최종 용출액 한 SDS-PAGE에 의해 mm 전자 수있는 단일 한 mm 대역에 대해 분리 될 수있다xcised 분석. 이 분석을 방해 할 수있는 비드 또는 입자상 물질의 복합체를 클리어한다. </li></ol>

<ol><li>Rigaut, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+generic+protein+purification+method+for+protein+complex+characterization+and+proteome+exploration%5BTitle%5D)+AND+%22Nat+Biotechnol%22%5BJournal%5D)">A generic protein purification method for protein complex characterization and proteome exploration.</a> Nat Biotechnol. 17, 1030-1032 (1999).</li>
<li>Puig, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+tandem+affinity+purification+%28TAP%29+method%3A+a+general+procedure+of+protein+complex+purification%5BTitle%5D)+AND+%22Methods%22%5BJournal%5D)">The tandem affinity purification (TAP) method: a general procedure of protein complex purification.</a> Methods. 24, 218-229 (2001).</li>
<li>Cheeseman, I. M., Desai, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+combined+approach+for+the+localization+and+tandem+affinity+purification+of+protein+complexes+from+metazoans%5BTitle%5D)+AND+%22Sci+STKE%22%5BJournal%5D)">A combined approach for the localization and tandem affinity purification of protein complexes from metazoans.</a> Sci STKE. , (2005).</li>
<li>Torres, J. Z., Miller, J. J., Jackson, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((High-throughput+generation+of+tagged+stable+cell+lines+for+proteomic+analysis%5BTitle%5D)+AND+%22Proteomics%22%5BJournal%5D)">High-throughput generation of tagged stable cell lines for proteomic analysis.</a> Proteomics. 9, 2888-2891 (2009).</li>
<li>LaCava, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Affinity+proteomics+to+study+endogenous+protein+complexes%3A+pointers%2C+pitfalls%2C+preferences+and+perspectives%5BTitle%5D)+AND+%22Biotechniques%22%5BJournal%5D)">Affinity proteomics to study endogenous protein complexes: pointers, pitfalls, preferences and perspectives.</a> Biotechniques. 58, 103-119 (2015).</li>
<li>Landy, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dynamic%2C+structural%2C+and+regulatory+aspects+of+lambda+site-specific+recombination%5BTitle%5D)+AND+%22Annu+Rev+Biochem%22%5BJournal%5D)">Dynamic, structural, and regulatory aspects of lambda site-specific recombination.</a> Annu Rev Biochem. 58, 913-949 (1989).</li>
<li>Hartley, J. L., Temple, G. F., Brasch, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+cloning+using+in+vitro+site-specific+recombination%5BTitle%5D)+AND+%22Genome+Res%22%5BJournal%5D)">DNA cloning using in vitro site-specific recombination.</a> Genome Res. 10, 1788-1795 (2000).</li>
<li>ORFeome Collaboration. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+ORFeome+Collaboration%3A+a+genome-scale+human+ORF-clone+resource%5BTitle%5D)+AND+%22Nat+Methods%22%5BJournal%5D)">The ORFeome Collaboration: a genome-scale human ORF-clone resource.</a> Nat Methods. 13, 191-192 (2016).</li>
<li>Brasch, M. A., Hartley, J. L., Vidal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((ORFeome+cloning+and+systems+biology%3A+standardized+mass+production+of+the+parts+from+the+parts-list%5BTitle%5D)+AND+%22Genome+Res%22%5BJournal%5D)">ORFeome cloning and systems biology: standardized mass production of the parts from the parts-list.</a> Genome Res. 14, 2001-2009 (2004).</li>
<li>Lamesch, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((hORFeome+v3.1%3A+a+resource+of+human+open+reading+frames+representing+over+10%2C000+human+genes%5BTitle%5D)+AND+%22Genomics%22%5BJournal%5D)">hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes.</a> Genomics. 89, 307-315 (2007).</li>
<li>Rual, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Human+ORFeome+version+1.1%3A+a+platform+for+reverse+proteomics%5BTitle%5D)+AND+%22Genome+Res%22%5BJournal%5D)">Human ORFeome version 1.1: a platform for reverse proteomics.</a> Genome Res. 14, 2128-2135 (2004).</li>
<li>Fiering, S., Kim, C. G., Epner, E. M., Groudine, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+%26%2334%3Bin-out%26%2334%3B+strategy+using+gene+targeting+and+FLP+recombinase+for+the+functional+dissection+of+complex+DNA+regulatory+elements%3A+analysis+of+the+beta-globin+locus+control+region%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">An &#34;in-out&#34; strategy using gene targeting and FLP recombinase for the functional dissection of complex DNA regulatory elements: analysis of the beta-globin locus control region.</a> Proc Natl Acad Sci U S A. 90, 8469-8473 (1993).</li>
<li>Sambrook, J., Fritsch, E. F., Maniatis, T. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aSambrook%2C+J+%22Molecular+cloning+%3A+a+laboratory+manual%22">Molecular cloning : a laboratory manual</a>. , 2nd, Cold Spring Harbor Laboratory. (1989).</li>
<li>Uyttersprot, N., Costagliola, S., Miot, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+new+tool+for+efficient+transfection+of+dog+and+human+thyrocytes+in+primary+culture%5BTitle%5D)+AND+%22Mol+Cell+Endocrinol%22%5BJournal%5D)">A new tool for efficient transfection of dog and human thyrocytes in primary culture.</a> Mol Cell Endocrinol. 142, 35-39 (1998).</li>
<li>Senese, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+unique+insertion+in+STARD9%27s+motor+domain+regulates+its+stability%5BTitle%5D)+AND+%22Mol+Biol+Cell%22%5BJournal%5D)">A unique insertion in STARD9's motor domain regulates its stability.</a> Mol Biol Cell. 26, 440-452 (2015).</li>
<li>Gholkar, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+X-Linked-Intellectual-Disability-Associated+Ubiquitin+Ligase+Mid2+Interacts+with+Astrin+and+Regulates+Astrin+Levels+to+Promote+Cell+Division%5BTitle%5D)+AND+%22Cell+Rep%22%5BJournal%5D)">The X-Linked-Intellectual-Disability-Associated Ubiquitin Ligase Mid2 Interacts with Astrin and Regulates Astrin Levels to Promote Cell Division.</a> Cell Rep. 14, 180-188 (2016).</li>
<li>Graumann, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Applicability+of+tandem+affinity+purification+MudPIT+to+pathway+proteomics+in+yeast%5BTitle%5D)+AND+%22Mol+Cell+Proteomics%22%5BJournal%5D)">Applicability of tandem affinity purification MudPIT to pathway proteomics in yeast.</a> Mol Cell Proteomics. 3, 226-237 (2004).</li>
<li>Connolly, J. A., Kalnins, V. I., Cleveland, D. W., Kirschner, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Immunoflourescent+staining+of+cytoplasmic+and+spindle+microtubules+in+mouse+fibroblasts+with+antibody+to+tau+protein%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Immunoflourescent staining of cytoplasmic and spindle microtubules in mouse fibroblasts with antibody to tau protein.</a> Proc Natl Acad Sci U S A. 74, 2437-2440 (1977).</li>
<li>Gholkar, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Tctex1d2+associates+with+short-rib+polydactyly+syndrome+proteins+and+is+required+for+ciliogenesis%5BTitle%5D)+AND+%22Cell+Cycle%22%5BJournal%5D)">Tctex1d2 associates with short-rib polydactyly syndrome proteins and is required for ciliogenesis.</a> Cell Cycle. 14, 1116-1125 (2015).</li>
<li>Cheung, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Proteomic+Analysis+of+the+Mammalian+Katanin+Family+of+Microtubule-severing+Enzymes+Defines+Katanin+p80+subunit+B-like+1+%28KATNBL1%29+as+a+Regulator+of+Mammalian+Katanin+Microtubule-severing%5BTitle%5D)+AND+%22Mol+Cell+Proteomics%22%5BJournal%5D)">Proteomic Analysis of the Mammalian Katanin Family of Microtubule-severing Enzymes Defines Katanin p80 subunit B-like 1 (KATNBL1) as a Regulator of Mammalian Katanin Microtubule-severing.</a> Mol Cell Proteomics. 15, 1658-1669 (2016).</li>
<li>Torres, J. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+STARD9%2FKif16a+Kinesin+Associates+with+Mitotic+Microtubules+and+Regulates+Spindle+Pole+Assembly%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">The STARD9/Kif16a Kinesin Associates with Mitotic Microtubules and Regulates Spindle Pole Assembly.</a> Cell. 147, 1309-1323 (2011).</li>
<li>Garcia-Gonzalo, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+transition+zone+complex+regulates+mammalian+ciliogenesis+and+ciliary+membrane+composition%5BTitle%5D)+AND+%22Nat+Genet%22%5BJournal%5D)">A transition zone complex regulates mammalian ciliogenesis and ciliary membrane composition.</a> Nat Genet. 43, 776-784 (2011).</li>
<li>Chih, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+ciliopathy+complex+at+the+transition+zone+protects+the+cilia+as+a+privileged+membrane+domain%5BTitle%5D)+AND+%22Nat+Cell+Biol%22%5BJournal%5D)">A ciliopathy complex at the transition zone protects the cilia as a privileged membrane domain.</a> Nat Cell Biol. 14, 61-72 (2012).</li>
<li>Leonetti, M. D., Sekine, S., Kamiyama, D., Weissman, J. S., Huang, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+scalable+strategy+for+high-throughput+GFP+tagging+of+endogenous+human+proteins%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">A scalable strategy for high-throughput GFP tagging of endogenous human proteins.</a> Proc Natl Acad Sci U S A. 113, E3501-E3508 (2016).</li>
<li>Poser, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((BAC+TransgeneOmics%3A+a+high-throughput+method+for+exploration+of+protein+function+in+mammals%5BTitle%5D)+AND+%22Nat+Methods%22%5BJournal%5D)">BAC TransgeneOmics: a high-throughput method for exploration of protein function in mammals.</a> Nat Methods. 5, 409-415 (2008).</li>
<li>Firat-Karalar, E. N., Stearns, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Probing+mammalian+centrosome+structure+using+BioID+proximity-dependent+biotinylation%5BTitle%5D)+AND+%22Methods+Cell+Biol%22%5BJournal%5D)">Probing mammalian centrosome structure using BioID proximity-dependent biotinylation.</a> Methods Cell Biol. 129, 153-170 (2015).</li>
<li>Roux, K. J., Kim, D. I., Burke, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((BioID%3A+a+screen+for+protein-protein+interactions%5BTitle%5D)+AND+%22Curr+Protoc+Protein+Sci%22%5BJournal%5D)">BioID: a screen for protein-protein interactions.</a> Curr Protoc Protein Sci. 74, (2013).</li>
<li>Gupta, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+Dynamic+Protein+Interaction+Landscape+of+the+Human+Centrosome-Cilium+Interface%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">A Dynamic Protein Interaction Landscape of the Human Centrosome-Cilium Interface.</a> Cell. 163, 1484-1499 (2015).</li>
</ol>

The authors have nothing to disclose.

개설 된 프로토콜은 LAP 태그 벡터에 관심있는 유전자의 복제를 설명, 유도 LAP-태그 안정적인 세포주의 생성, 단백체 분석을위한 LAP-태그 단백질 복합체의 정제. 다른 LAP / TAP 태그 방식에 대해,이 프로토콜은 모든 세포 경로 내에서 단백질 현지화 및 단백질 - 단백질 상호 작용을 매핑하는 높은 처리량 방법과 호환되도록 간소화되었습니다. 이 접근 방법은 널리 몇 가지 이름을 세포주기 진행, 방추사 조립체 스핀들 극 항상성 및 ciliogenesis에 중요한 단백질의 기능적 특성에 적용된 이러한 단백질 misregulation 인간 질환 (15)로 유도 할 수있는 방법의 이해를 원조했다 16,19,20. 예를 들어, 우리 그룹 최근 스핀들 조립체 15,21 STARD9에서의 유사 분열 키네신 기능 및 규제 (후보 암 대상)을 정의하기 위해이 시스템을 사용하는 정의 할Tctex1d2의 네인 빛 체인 사이의 새로운 분자 링크 짧은 리브 다지증을 비롯한 다양한 기형 증후군 (SRPS) (19), 그리고 중간 2 유비퀴틴 리가 아제의 돌연변이 X-링크 지적 장애 (16)으로 이어질 수있는 방법을 이해하는 새로운 분자 링크를 정의 할 수 있습니다. 다른 실험실도 성공적으로 Tctn1, 마우스 고슴도치 신호의 조절이하는 ciliopathy 관련 단백질 복합체의 일부라고 판단 하나를 포함하여,이 방법을 적용한 조직 의존적으로 22, 23에 규정 된 섬모 막 조성 및 ciliogenesis가. 따라서,이 프로토콜은 크게 임의의 셀룰러 경로의 해부에 적용될 수있다. 이 프로토콜에서 중요한 단계는 하이 그로 마이신 내성 LAP 태깅 안정한 세포주의 선택이다. 특별한주의가 제어 플레이트의 모든 세포가 증폭 실험 접시에 초점을 선택하기 전에 죽은되도록주의해야한다. 하이 그로 마이신은 adde 할 수있다LAP-태그 안정적인 세포주의 일상적인 세포 배양시 d를 추가로 모든 세포가 FRT 사이트에서 관심있는 LAP-태그 유전자를 유지할 수 있도록합니다. 우리는 모든 LAP 태깅 된 단백질이 작동하게하고 단백질 기능을 테스트하는 데 사용할 수있는 장소의 분석을 위해 중요하다는 것을 경고한다. 단백질의 기능을 테스트하는 데 사용 분석의 예는 siRNA를 유도 표현형 및 시험 관내 활성 분석의 구조를 포함한다. 큰 LAP 태그가 추가 된 잠재적 인 문제점을 해결하기 위해 이전에 관심 단백질의 기능 및 위치 파악을 방해 할 가능성이 적은 FLAG 같은 작은 태그를 포함하고,이 시스템과 호환 TAP 태그 벡터를 생성 한 4. 또한, LAP 태그 벡터 C 말단 LAP 표지 된 단백질 또는 LAP / TAP 태그는 N에서 허용되지 않는 경우에 사용할 수있는 이러한 시스템과 호환되는 C 말단 TAP 표지 된 단백질을 생성하기 위해 존재 단백질의 -terminus. 또한, 일정제 버퍼 (LAPX N)의 전자 염 세제 농도를 높이거나 유료 또는 너무 많은 상호 작용이 관찰되는 경우, 정제 엄격함을 감소하도록 변형 될 수있다. 유사하게, 직렬 친 화성 정제 절차는 거의 또는 전혀 인터랙이 확인되면 이에 번의 정제 방식이 사용될 수 있으며, 손실 될 수 정제 과정 약한 인터랙 하나보다 더 엄격하다. 다른 GFP 에피토프 태그 방식은 단백질 현지화 및 정제 연구 (24, 25)에 대한 태그 대규모 GFP 단백질을 허용하는 존재한다는 것을 주목하는 것이 중요하다. 이러한 모든 규제 요소, 모방 내인성 유전자 발현 (24)를 포함 그들의 네이티브 환경에서 관심의 GFP - 태그 유전자를 표현하는 박테리아 인공 염색체를 이용하는 BAC TransgenOmics 접근 방식을 포함한다. 최근 CAS9 / 단일 가이드 RNA (sgRNA) 리보 핵산 단백질 복합체 (RNP들)을 종료하는 데 사용 된ogenously 자신의 내인성 유전자 좌위 (25)로부터 GFP - 태그 유전자의 발현을 허용하는 분할 GFP 시스템과 관심의 유전자를 태그. 이러한 접근 방식 모두 여기에 설명 된 LAP 태그 프로토콜에 비해 내생 조건에서 태그 단백질의 발현을 활성화하지만, 그들이 관심있는 태그 유전자의 유도 및 조정 가능한 표현을 허용하지 않습니다. 또한, 그들은 TAP에 대해 태깅 탠덤 에피토프에 적용될 아직. 다른 태그 시스템은 또한 유도 성 에피토프 태그 안정된 세포주를 생성하기위한 여기에 설명 된 시스템과 호환되기 위해 변형 될 수있다라는 점이다. 예를 들면, 근접성 - 의존성 비오틴 식별 (BioID)의 상호 작용으로 인해 단백질 (26) 사이에 공간 및 시간 관계를 정의하는 능력에 상당한 관심을 얻고있다. 이 기술은 대장균 비오틴 리가 피라의 난잡한 균주 오티 닐에 융합 단백질을 이용효소의 ~ 10 nm의 반경 내에있는 단백질이야. 바이오틴이 단백질은 친 화성 비오틴 화성 캡처를 사용하여 정제 및 질량 분석에 의한 조성 분석이다. 피라 복잡한 (27) 내에 강한 상호 작용 파트너를 검출하기에 특히 적합하게되는, 심지어 일시적 밀접 어떤 단백질 오티 것이다. 또한, 정제 기법은 내인성 단백질 - 단백질 상호 작용은 그대로 유지되므로 위양성의 비율을 줄이고, 변성 조건 하에서 수행 될 수 있다는 것을 필요로하지 않는다. 현재 프로토콜 내에서, 피라 태그 벡터에 의해 pGLAP1 벡터의 대체 근접성에 기반을 검출에 친 화성을 기반으로 단백질 - 단백질 상호 작용을 식별에서이 시스템을 변환 할 수 있습니다. 다양한 효소 - 기질 상호 작용 사이의 시공간 단백질 - 단백질 INTE을 매핑하는 경우와 같이 이러한 시스템은 과도 단백질 상호 작용을 검출하는 매우 유리할 것이다중심체과 섬모 (26, 28)에 대해 수행 된 정의 구조 내에서 ractions.

To investigate the cellular function of an uncharacterized protein it is important to determine its in vivo spatiotemporal subcellular localization and its interacting protein partners. Traditionally, single and tandem epitope tags fused to the N or C-terminus of a protein of interest have been used to facilitate protein localization and protein interaction studies. For example, the tandem affinity purification (TAP) technology has enabled the isolation of native protein complexes, even those that are in low abundance, in both yeast and mammalian cell lines1,2. The localization and affinity purification (LAP) technology, is a more recent development that modifies the TAP procedure to include a localization component through the introduction of the green fluorescent protein (GFP) as one of the epitope tags3. This approach has given researchers a deeper understanding of a protein's subcellular localization in living cells while also retaining the ability to perform TAP complex purifications to map protein-protein interaction networks. 
However, there are many issues associated with the use of TAP/LAP technologies that has hampered their widespread use in mammalian cells. For example, the length of time that is necessary to generate a stable cell line expressing a TAP/LAP tagged protein of interest; which typically relies on cloning the gene of interest into a viral vector and selecting single cell stable integrants with the desired expression level. Additionally, many cellular pathways are sensitive to constitutive protein overexpression (even at low levels) and can arrest cells or trigger cell death over time making the generation of a TAP/LAP stable cell line impossible. These and other constraints have impeded LAP/TAP methodologies from becoming high-throughput systems for protein localization and protein complex elucidation. Therefore, there has been considerable interest in the development of an inducible high-throughput LAP-tagging system for mammalian cells that takes advantage of current innovations in cloning and cell line technologies. 
Here we present a protocol for generating stable cell lines with Doxycycline/Tetracycline (Dox/Tet) inducible LAP-tagged proteins of interest that applies advances in both cloning and mammalian cell line technologies. This approach streamlines the acquisition of data with regards to LAP-tagged protein subcellular localization, protein complex purification and identification of interacting proteins4. Although affinity proteomics utilizes a wide range of techniques for protein complex elucidation5, our approach is beneficial for expediting the identification of these complexes and their native interaction networks and is amenable to high-throughput protein tagging that is necessary to investigate complex biological pathways that contain a multitude of protein constituents. Key to this approach are advancements in cloning strategies that enable high fidelity and expedited cloning of target genes into an array of vectors for gene expression in vitro, in various organisms like bacteria and baculovirus, and in mammalian cells6,7. Additionally, the ORFeome collaboration has cloned thousands of sequence validated open reading frames in vectors that incorporate these advances in cloning, which are available to the scientific community8-11. In our system, the pGLAP1 LAP-tagging vector enables the simultaneous cloning of a large number of clones, which facilitates high-throughput LAP-tagging. This expedited cloning procedure is coupled to a streamlined approach for generating cell lines with LAP-tagged genes of interest inserted at a single pre-determined genomic locus. This makes use of cell lines that contain a single flippase recognition target (FRT) site within their genome, which is the site of integration for LAP-tagged genes. These cell lines also express the tetracycline repressor (TetR) that binds to Tet operators (TetO2) upstream of the LAP-tagged genes and silences their expression in the absence of Dox/Tet. This allows for Dox/Tet inducible expression of the LAP-tagged protein at any given time. Having the capability of inducible LAP-tagged protein expression is critical, since many cellular pathways are sensitive to the levels of critical proteins governing the pathway and can arrest cell growth or trigger cell death when these proteins are constitutively overexpressed, even at low levels, making the generation of non-inducible LAP-tagged stable cell lines impossible12.

<table><tbody><tr><td>Flp-In T-REx Core Kit</td><td>Invitrogen</td><td>K6500-01</td><td>Kit for generating cell lines that contain an FRT site and TrtR expression</td></tr><tr><td>PETG, 5x</td><td>Nunc, Inc.&amp;nbsp;</td><td>73520-734</td><td>Roller bottle for growing cells</td></tr><tr><td>PETG, 2.5x</td><td>Nunc, Inc.&amp;nbsp;</td><td>73520-420</td><td>Roller bottle for growing cells</td></tr><tr><td>Cell stackers</td><td>Corning CellSTACK</td><td>3271</td><td>Cell stacker for growing cells</td></tr><tr><td>500 ml conical centrifuge tubes</td><td>Corning&amp;nbsp;</td><td>431123</td><td>Tubes for harvesting cells</td></tr><tr><td>Anti-GFP antibody</td><td>Invitrogen</td><td>A11122</td><td>Rabbit anti GFP antibody</td></tr><tr><td>Affiprep Protein A beads</td><td>Biorad</td><td>156-0006</td><td>Used as a matrix for conjugating anti-GFP antibodies</td></tr><tr><td>Dimethylpimelimidate (DMP)</td><td>ThermoFisher Scientific</td><td>21667</td><td>Used for conjugating anti-GFP antibodies to Protein A beads</td></tr><tr><td>TLA100.3 tubes</td><td>Beckman</td><td>349622</td><td>Tubes for centrifuging protein lysates during the clearing step</td></tr><tr><td>TEV protease</td><td>Invitrogen</td><td>12575-015</td><td>Used for cleaving the GFP tag off of N-terminal LAP-tagged proteins</td></tr><tr><td>Precession Protease</td><td>GE Healthcare</td><td>27-0843-01</td><td>Used for cleaving the GFP tag off of C-terminal LAP-tagged proteins</td></tr><tr><td>S-protein agarose</td><td>Novagen</td><td>69704</td><td>Used as a second affinity matrix during the purification of LAP-tagged protein complexes</td></tr><tr><td>QIAquick DNA gel extraction kit</td><td>Qiagen</td><td>28704/28706</td><td>For use in purifying PCR products from an agarose gel</td></tr><tr><td>BP clonase II</td><td>Invitrogen</td><td>11789020</td><td>Used for cloning ORF PCR products into the pDONR221 shuttle vector</td></tr><tr><td>LR clonase II</td><td>Invitrogen</td><td>11791020</td><td>Used for cloning the ORF of the gene of interest into the pGLAP1 LAP-tagging vector</td></tr><tr><td>&lt;em&gt;ccdB&lt;/em&gt; Survival 2 T1&lt;sup&gt;R&lt;/sup&gt; &lt;em&gt;E. coli&lt;/em&gt;</td><td>Invitrogen</td><td>A10460</td><td>Used for propgating shuttle vectors and pGLAP empty vectors</td></tr><tr><td>Fugene 6</td><td>Promega</td><td>E2691</td><td>Transfection reagent for transfecting vectors into human cells</td></tr><tr><td>Tetracycline</td><td>Invitrogen</td><td>Q100-19</td><td>Drug for inducing Dox/Tet inducible protein expression&amp;nbsp;</td></tr><tr><td>Doxycycline</td><td>Clontech</td><td>631311</td><td>Drug for inducing Dox/Tet inducible protein expression&amp;nbsp;</td></tr><tr><td>Hygromycin B</td><td>Invitrogen</td><td>10687010</td><td>Drug for selecting stable LAP-tagged integrants</td></tr><tr><td>Kanamycin</td><td>Corning</td><td>61-176-RG</td><td>Drug for selecting Kanamycin resistant bacterial colonies</td></tr><tr><td>Ampicillin</td><td>Fisher</td><td>BP1760-5</td><td>Drug for selecting Ampicillin resistant bacterial colonies</td></tr><tr><td>4-20% Tris Glycine SDS-PAGE gels</td><td>Biorad</td><td>4561094</td><td>Used for separating protein samples and final LAP-tag purification eluates</td></tr><tr><td>Silver Stain Plus Kit</td><td>Biorad</td><td>1610449</td><td>Used for silver staining the eluates of LAP-tagged pufications and samples collected throughout the purification process&amp;nbsp;</td></tr><tr><td>Coomassie Blue stain</td><td>Invitrogen</td><td>LC6060</td><td>Used for staining SDS-PAGE gels to visulize LAP-tagged purifications and cutting out protein bands, mass spectrometry compatible</td></tr><tr><td>Shuttle vector pDONR221</td><td>Invitrogen</td><td>12536017</td><td>Shuttle vector for cloning the ORFs of genes of interest</td></tr><tr><td>Flippase expressing vector pOG44</td><td>Invitrogen</td><td>V600520</td><td>Vector that expresses the Flippase recombinase for integrating LAP-tagged genes into the genome of FRT site containing cell lines</td></tr><tr><td>Platinum Taq DNA Polymerase</td><td>ThermoFisher Scientific</td><td>10966018</td><td>Used for PCR amplification of the ORFs of genes of interest</td></tr><tr><td>4x Laemmli sample buffer</td><td>Biorad</td><td>1610747</td><td>Sample buffer for eluting purified LAP-tagged protein complexes from the bead matrix</td></tr><tr><td>Luria broth (LB) media</td><td>Fisher</td><td>BP9723-2</td><td>Used for growing DH5&amp;alpha; bacteria</td></tr><tr><td>DNA miniprep kit</td><td>Promega</td><td>A1222</td><td>Used for making DNA plasmid minipreps</td></tr><tr><td>DMEM/F12 media</td><td>Hyclone</td><td>SH30023.01</td><td>For growing Hek293 human cells</td></tr><tr><td>FBS lacking Tet</td><td>Altanta Biologicals</td><td>S10350</td><td>Used for making -Tet DMEM/F12 media for generating and growing inducible LAP-tagged stable cell lines</td></tr><tr><td>Trypsin</td><td>Hyclone</td><td>SH30042.01</td><td>For lifting Hek293 cell foci from plates</td></tr><tr><td>Protease inhibitor tablets</td><td>Roche</td><td>11836170001</td><td>Used for making protocol buffers, EDTA-free</td></tr><tr><td>10% nonyl phenoxypolyethoxylethanol&amp;nbsp;</td><td>Roche</td><td>11332473001</td><td>Used for making protocol buffers</td></tr><tr><td>PBS</td><td>Corning</td><td>21-040-CM</td><td>Used for making protocol buffers</td></tr><tr><td>Tween-20</td><td>Fisher</td><td>BP337-500</td><td>Used for making protocol buffers</td></tr><tr><td>Sodium Borate</td><td>Fisher</td><td>S249-500</td><td>Used for making protocol buffers</td></tr><tr><td>Boric Acid</td><td>Fisher</td><td>A78-500</td><td>Used for making protocol buffers</td></tr><tr><td>Ethanolamine</td><td>Calbiochem</td><td>34115</td><td>Used for making protocol buffers</td></tr><tr><td>NaCl</td><td>Fisher</td><td>P217-3</td><td>Used for making protocol buffers</td></tr><tr><td>KCl</td><td>Fisher</td><td>BP358-10</td><td>Used for making protocol buffers</td></tr><tr><td>Dithiothreitol (DTT)</td><td>Fisher</td><td>BP172-25</td><td>Used for making protocol buffers</td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Fisher</td><td>M33-500</td><td>Used for making protocol buffers</td></tr><tr><td>Tris base</td><td>Fisher</td><td>BP152-5</td><td>Used for making protocol buffers</td></tr></tbody></table>

inducible lap-tagged stable cell lines for investigating protein function, spatiotemporal localization and protein interaction networks

Multi-protein complexes, rather than single proteins acting in isolation, often govern molecular pathways regulating cellular homeostasis. Based on this principle, the purification of critical proteins required for the functioning of these pathways along with their native interacting partners has not only allowed the mapping of the protein constituents of these pathways, but has also provided a deeper understanding of how these proteins coordinate to regulate these pathways. Within this context, understanding a protein's spatiotemporal localization and its protein-protein interaction network can aid in defining its role within a pathway, as well as how its misregulation may lead to disease pathogenesis. To address this need, several approaches for protein purification such as tandem affinity purification (TAP) and localization and affinity purification (LAP) have been designed and used successfully. Nevertheless, in order to apply these approaches to pathway-scale proteomic analyses, these strategies must be supplemented with modern technological developments in cloning and mammalian stable cell line generation. Here, we describe a method for generating LAP-tagged human inducible stable cell lines for investigating protein subcellular localization and protein-protein interaction networks. This approach has been successfully applied to the dissection of multiple cellular pathways including cell division and is compatible with high-throughput proteomic analyses.

이 시스템의 유용성을 강조하기 위해, 타우 미소 관 결합 단백질의 오픈 리딩 프레임 (ORF)을 갖는 PCR 제품 attB1과 attB2 사이트를 함유하는 프라이머 타우 ORF 증폭 (표 1)과 배양하여 셔틀 벡터 내로 클로닝 셔틀 벡터 및 셔틀 벡터 내로 PCR 산물의 삽입을 매개 재조합 효소. 반응 생성물 타우 삽입을 위해 서열화 된 카나마이신 내성 콜로니로부터 DH5α 박테리아 13 및 플라스미드 DNA를 형질 전환 하였다. 시퀀스 검증 셔틀 타우 벡터는 다음의 pGLAP1 벡터로 셔틀 - 타우 벡터를 배양하여 LAP (EGFP-TEV-S-단백질) 태그로 프레임에 타우를 융합 pGLAP1 벡터로 타우 ORF를 전송하는 데 사용되었다 및 pGLAP1에 셔틀 벡터에서 ORF의 전달을 매개 재조합 효소. 반응 생성물을 DH5α 균을 형질 전환했다암피실린 내성 콜로니에서 13 플라스미드 DNA는 LAP-타우 융합 프레임 있다는 보장하기 위해 염기 서열했다. 순서 pGLAP1-LAP-타우 후 단일 flippase 인식 대상 LAP-태그 유전자 통합 사이트가 그들의 게놈 내에서 (FRT) 사이트를 포함 HEK293 세포에 flippase 재조합 효소를 발현하는 벡터로 형질 공동 된 검증 14. 이 세포주는 또한 LAP-태그 유전자의 상류 구정 운영에 결합 테트 / Dox가의 부재에서 발현을 침묵 TetR를 표명했다. 안정적인 통합 체 5 일 동안 100 μg의 / ㎖ 하이 그로 마이신과 -Tet DMEM / F12 매체로 선정되었다. 개별 하이 그로 마이신 내성 세포의 초점은 상단에 트립신 20 μl를 추가하고 아래로 2 회를 ​​피펫 팅에 의해 수거 하였다. 세포를 24 웰 플레이트에 넣고 -Tet DMEM / F12 배지에서 연속 성장에 의해 팽창되었다. 하이 그로 마이신 내성 세포 있는지 확인하려면LAP (S)는 타우를 발현 할 수 있었다 HEK293 LAP 타우 세포는 15 시간 단백질 추출물 0.1 μg의 / ㎖의 Dox를로 유도 하였다는 유도되지 않은 및 유도 Dox를 세포로부터 제조 하였다. 이 추출물을 PVDF 막으로 전달, SDS-PAGE에 의해 분리하고, 로딩 대조군으로 튜 블린에 대한 GFP 및 immunoblotted 하였다. 도 4a, LAP 타우에서 보듯 (항 GFP 항체로 가시화) 만 존재 Dox를 표현 하였다. 이전 내생 타우 (18)에 대해 표시했다으로 LAP-타우 제대로, 유사 분열시 유사 분열 미세 소관 스핀들에 현지화 된 것을 확인하려면, HEK293 LAP-타우 세포는 15 시간 동안 0.1 μg의 / ㎖ Dox가로 유도하고, 세포를 4 %로 고정 하였다 파라 포름 알데히드와 공동 스테인드 DNA (훽스트 33342) 및 미세 소관 (안티 - 튜 불린 항체)를 참조하십시오. 지속적으로, LAP-타우는 유사 분열의 중기 (그림 4B) 동안 유사 분열 스핀들에 현지화했다. 그 LAP-타우와 상호 작용하는 단백질을 확인하려면이 SYS로 정제 할 수있다TEM, HEK293 LAP 타우 세포는 교반 수확 15 시간 동안 0.1 μg의 / ㎖의 Dox를로 유도 롤러 병으로 ~ 70 % 전면 생장 성장 LAP300 완충액으로 용해하고, LAP 타우은 상기 프로토콜을 사용하여 정제 하였다. LAP-타우 정화의 용출액은 SDS-PAGE에 의해 해결하고, 젤은 스테인드했다. 도 4c는 별표 (*)로 표시된 LAP-타우 정제, LAP-타우와 타우 상호 작용하는 단백질을 나타내는이 볼 수있는 여러 가지 다른 밴드 보여줍니다. <img alt="그림 1" src="/files/ftp_upload/54870/54870fig1.jpg" /> 그림 1 : 관심의 단백질에 대한 LAP-태그 유도 성 안정 세포 라인의 세대의 개요. 관심 유전자의 오픈 리딩 프레임 (ORF)은 attB1과 attB2 사이트를 각각 5 &#39;및 3&#39;말단 서열을 플 랭킹으로 증폭 (프라이머 서열에 나타내 표 1) 내로 클로닝<html> 셔틀 벡터. 관심의 유전자 서열 확인 셔틀 벡터는 다음 pGLAP1 벡터에 목적 유전자를 전달하기 위해 사용된다. 관심의 유전자 pGLAP1 벡터 확인 시퀀스는 단일 flippase 인식 대상 LAP에 대한 통합 사이트가 자신의 게놈 내에서 (FRT) 사이트를 포함하여 원하는 세포주에 flippase 재조합 효소를 함유하는 벡터로 공동 - 형질 -tagged 유전자. 이 세포주는 또한 LAP-태그 유전자의 상류 구정 리프레 구정 운영에 결합 (TetR) (TETO 2)를 표현하고 구정 / Dox가의 부재에서 발현을 침묵. 관심의 LAP-태그 유전자는 다음 FRT 사이트에 재결합하고 안정적인 통합 체는 하이 그로 마이신으로 선택됩니다. <a href="http://ecsource.jove.com/files/ftp_upload/54870/54870fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <html> 2 &quot;SRC =&quot;/ 파일 / ftp_upload / 54870 / 54870fig2.jpg &quot;/&gt; 그림 2 : LAP-태그 안정 세포주에 대한 응용 프로그램의 개요. LAP 태깅 유도 안정한 세포주 Dox를 첨가하여 관심 LAP 표지 된 단백질을 발현하도록 유도하고 세포주기의 여러 단계에서 동기화 될 수도 있고 임의의 신호 전달 경로를 활성화하는 화학 물질 또는 리간드로 자극 될 수있다. 관심있는 LAP-태그 단백질의 세포 내 현지화 라이브 셀 또는 고정 된 세포 이미징에 의해 분석 될 수있다. LAP 표지 된 단백질은 탠덤 친화 정제와 그들의 상호 작용 단백질 액체 크로마토 그래피 탠덤 질량 분석법 (LC-MS / MS)에 의해 확인 될 수있을 수있다. 마지막 Cytoscape 미끼 단백질의 단백질 - 단백질 상호 작용 네트워크를 생성하는데 사용될 수있다. DOX는 TEV는 TEV 단백질 분해 효소 절단 부위를 나타내고, EGFP가 녹색 형광 단백질을 강화 나타냅니다, IP는 면역 침전을 나타내고, 독시사이클린을 나타내고, S는 S-태그를 나타냅니다.http://ecsource.jove.com/files/ftp_upload/54870/54870fig2large.jpg &quot;대상 =&quot;_ 빈 &quot;&gt;이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. <img alt="그림 3" src="/files/ftp_upload/54870/54870fig3.jpg" /> 그림 3 : 질량 분석에 대한 LAP-태그 단백질 발현, 정제 및 제조의 개요. LAP-태그 단백질 발현의 1) 성장과 유도 해물의, 2) 세포 수확 및 용해, 3) 준비, 4) 항 GFP 구슬에 해물의 결합, 5) TEV 단백질 분해 효소 절단 : 프로토콜은 9 단계가 있습니다 GFP의 태그가, 6) S 단백질 비드 해물 결합 7) 미끼 단백질 및 상호 작용 단백질, 및 8-9) 질량 분석 기반 프로테옴 분석을위한 시료의 준비의 용출. <a href="http://ecsource.jove.com/files/ftp_upload/54870/54870fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> </p&gt; <img alt="그림 4" src="/files/ftp_upload/54870/54870fig4.jpg" /> 그림 4 : LAP-타우 식의 검증. (A) 웨스턴 블롯 (WB) 각각 LAP 태깅 된 타우 단백질과 튜 불린로드 제어를 검출 안티 GFP 및 안티 튜 불린 항체로 프로빙 유도 유도 비와 Dox를 LAP 타우 HEK293 세포로부터 단백질 샘플 분석. 세포가 Dox가로 유도하는 경우 그 LAP-타우 만 표현되어 있습니다. LAP-타우를 표현 (B) 유사 분열 세포를 고정하고 공동 스테인드 안티 - 튜 불린 항체 및 LAP 타우의 세포 내 현지화와 DNA (훽스트 33342) 및 튜 불린 (욕조)에 대한이 형광 축소 복사하여 분석 하였다. 그 LAP-타우가 유사 분열시 유사 분열 스핀들과 스핀들 극에 지역화합니다. (C) 실버는 LAP-타우 정화의 젤 스테인드. MW는 분자량을 나타내고, CL은 삭제 해물, 그리고 E의 인도어를 나타냅니다ATES 최종 용출액. 샘플은 4-20 % SDS-PAGE에서 실행하고, 겔 실버 정제 된 단백질을 시각화하기 위해 염색했다. LAP-타우에 해당하는 대역은 별표와 볼 수있는 단백질을 정화 공동 대응 여러 가지 다른 밴드로 표시되어 있습니다. <a href="http://ecsource.jove.com/files/ftp_upload/54870/54870fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> N- 말단 융합 </td><td></td></tr><tr><td> 앞으로 </td><td> 5&#39; GGGGACAAGT TTGTACAAAAAAGCAGGCT TCATG - (&gt; 18gsn) -3 &#39; </td></tr><tr><td> 역 </td><td> 5&#39; GGGGACCACTTTGTACAAGAAAGCTGGGT T TTATCA - (&gt; 18gsn) -3 &#39; </td></tr><tr><td> C 말단 융합 </td><td></td></tr><tr><td> 앞으로 </td><td> 5&#39; GGGGACAAGTTTGTACAAAAAAGCAGGCT TCACC - (&gt; 18gsn) -3 &#39; </td></tr><tr><td> 역 </td><td> 5&#39; GGGGACCACTTTGTACAAGAAAGCTGGGT G - (&gt; 18gsn) -3 &#39; </td></tr></tbody></table> 표 1 : 정 및 셔틀 벡터에 삽입하는 ORF 또는 관심을 증폭하기위한 프라이머 역. attB 사이트는 굵은 글씨로 강조되어 있으며, GSN은 18 개 이상의 유전자 특정 뉴클레오티드 프라이머에 추가되는 것을 의미한다. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td colspan="2"> 단계 </td><td> 온도 </td><td> 시각 </td></tr><tr><td colspan="2"> 초기 변성 </td><td> 94 ° C </td><td> 2 분 </td></tr><tr><td rowspan="3"> PCR 증폭 사이클 (35) </td><td> 변성하다 </td><td> 94 ° C </td><td> 30 초 </td></tr><tr><td> 어닐링 </td><td> 55 ° C (프라이머 Tm은에 따라 다름) </td><td> 30 초 </td></tr><tr><td> 넓히다 </td><td> 72 ° C </td><td> 1 분 / 킬로바이트 </td></tr><tr><td colspan="2"> 보류 </td><td> 4 ° C </td><td> 무기한 </td></tr></tbody></table> 표 2 : 관심의 개의 ORF의 증폭을위한 PCR 조건. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 벡터 </td><td> 앞으로 시퀀싱 프라이머 </td><td> 시퀀싱 프라이머 역 </td></tr><tr><td> 셔틀 벡터 </td><td> 5&#39;-TGTAAAACGACGGCCAGT-3 &#39; </td><td> 5&#39;-CAGGAAACAGCTATGAC-3 &#39; </td></tr></tbody></table> 표 3 : 셔틀 벡터에 대한 순방향 및 역방향 시퀀싱 프라이머. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 신분증 </td><td> 구조 </td><td> 부모의 </td><td> 발기인 </td><td> 혈중 알코올 농도가 해상도 </td><td> 엄만 해상도 </td><td> 구정 등록? </td></tr><tr><td> pGLAP1 </td><td> N-용어 EGFP-TEV-S 펩티드 </td><td> pcDNA5 / FRT / TO </td><td> CMV </td><td> 앰프 </td><td> HYG </td><td> 예 </td></tr><tr><td> pGLAP2 </td><td> N-용어 국기-TEV-S 펩티드 </td><td> pcDNA5 / FRT / TO </td><td> CMV </td><td> 앰프 </td><td> HYG </td><td> 예 </td></tr><tr><td> pGLAP3 </td><td> N-용어 EGFP-TEV-S 펩타이드; C-용어 V5 </td><td> pEF5 / FRT-V5 </td><td> EF1a </td><td> 앰프 </td><td> HYG </td><td> 아니 </td></tr><tr><td> pGLAP4 </td><td> N-용어 국기-TEV-S 펩타이드; ; C-용어 V5 </td><td> pEF5 / FRT-V5 </td><td> EF1a </td><td&gt; 앰프 </td><td> HYG </td><td> 아니 </td></tr><tr><td> pGLAP5 </td><td> C-용어 S 펩타이드 - PreProt X2-EGFP </td><td> pEF5 / FRT-V5 </td><td> EF1a </td><td> 앰프 </td><td> HYG </td><td> 아니 </td></tr></tbody></table> 표 4 : 변수 발기인, 에피토프 - 태그 및 N에 대한 Dox를 유도 성 표현 기능 또는 C 말단 단백질 태그와 함께 사용 가능 LAP / TAP 일러스트의 목록입니다. 벡터가 시판되고있다. 혈중 알코올 농도가 해상도가 세균의 내성 마커를 표시, 엄만 해상도는 포유 동물 세포 저항 마커, 구정의 등록 번호를 표시? 식 구정 / Dox가의 조절 성 여부를 나타냅니다. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 벡터 </td><td> 앞으로 시퀀싱 프라이머 </td><td> 시퀀싱 프라이머 역 </td></tr><tr><td> pGLAP1 </td><td> 5&#39;-ATCACTCTCGGCATGGACGAGCTGTACAAG-3 &#39; </td><td> 5&#39;-TGGCTGGCAACTAGAAGGCACAGTCGAGGC-3 &#39; </td></tr><tr><td> pGLAP2 </td><td> 5&#39;-CGAACGCCAGCACATGGACAGGG-3 &#39; </td><td> 5&#39;-TGGCTGGCAACTAGAAGGCACAGTCGAGGC-3 &#39; </td></tr><tr><td> pGLAP3 </td><td> 5&#39;-AGAAACCGCTGCTGCTAA-3 &#39; </td><td> 5&#39;-TAGAAGGCACAGTCGAGG-3 &#39; </td></tr><tr><td> pGLAP4 </td><td> 5&#39;-AGACCCAAGCTGGCTAGGTAAGC-3 &#39; </td><td> 5&#39;-TAGAAGGCACAGTCGAGG-3 &#39; </td></tr><tr><td> pGLAP5 </td><td> 5&#39;-CGTAATACGACTCACTATAG-3 &#39; </td><td> 5&#39;-TCCAGGGTCAAGGAAGGCACGG-3 &#39; </td></tr></tbody></table> 표 5 : pGLAP 벡터에 대한 순방향 및 역방향 시퀀싱 프라이머.

Watch this Scientific Journal Video about Inducible LAP-tagged Stable Cell Lines for Investigating Protein Function, Spatiotemporal Localization and Protein Interaction Networks at JoVE.com

Inducible LAP-tagged Stable Cell Lines for Investigating Protein Function, Spatiotemporal Localization and Protein Interaction Networks

We describe a method for generating localization and affinity purification (LAP)-tagged inducible stable cell lines for investigating protein function, spatiotemporal subcellular localization and protein-protein interaction networks.

조사 단백질 기능, 시공간 현지화 및 단백질 상호 작용 네트워크를위한 유도 LAP-태그 안정 세포주

Multi-protein complexes, rather than single proteins acting in isolation, often govern molecular pathways regulating cellular homeostasis. Based on this ...

inducible-lap-tagged-stable-cell-lines-for-investigating-protein

Research

JoVE Journal

Biology

9.8K 조회수.  University of California, Los Angeles. We describe a method for generating localization and affinity purification (LAP)-tagged inducible stable cell lines for investigating protein function, spatiotemporal subcellular localization and protein-protein interaction networks. 

비디오: Inducible LAP-tagged Stable Cell Lines for Investigating Protein Function, Spatiotemporal Localization and Protein Interaction Networks

Split-BioID &#8212; Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment

To complement existing affinity purification (AP) approaches for the identification of protein-protein interactions (PPI), enzymes have been introduced that allow the proximity-dependent labeling of proteins in living cells. One such enzyme, BirA* (used in the BioID approach), mediates the biotinylation of proteins within a range of approximately 10 nm. Hence, when fused to a protein of interest and expressed in cells, it allows the labeling of proximal proteins in their native environment. As opposed to AP that relies on the purification of assembled protein complexes, BioID detects proteins that have been marked within cells no matter whether they are still interacting with the protein of interest when they are isolated. Since it biotinylates proximal proteins, one can moreover capitalize on the exceptional affinity of streptavidin for biotin to very efficiently isolate them. While BioID performs better than AP for identifying transient or weak interactions, both AP- and BioID-mass spectrometry approaches provide an overview of all possible interactions a given protein may have. However, they do not provide information on the context of each identified PPI. Indeed, most proteins are typically part of several complexes, corresponding to distinct maturation steps or different functional units. To address this common limitation of both methods, we have engineered a protein-fragments complementation assay based on the BirA* enzyme. In this assay, two inactive fragments of BirA* can reassemble into an active enzyme when brought in close proximity by two interacting proteins to which they are fused. The resulting split-BioID assay thus allows the labeling of proteins that assemble around a pair of interacting proteins. Provided these two only interact in a given context, split-BioID then allows the analysis of specific context-dependent functional units in their native cellular environment. Here, we provide a step-by-step protocol to test and apply split-BioID to a pair of interacting proteins.

We provide a step-by-step protocol for split-BioID, a protein fragments-complementation assay based on the proximity-labeling technique BioID. Activated on the interaction of two given proteins, it allows the proteomics analysis of context-dependent protein complexes in their native cellular environment. The method is simple, cost-effective and only requires standard laboratory equipment.

그들의 네이티브 셀룰러 환경에서 상황에 맞는 단백질 복합물의 분할-BioID-Proteomic 분석

To complement existing affinity purification (AP) approaches for the identification of protein-protein interactions (PPI), enzymes have been introduced ...

연구

생화학

Endogenous Protein Tagging in Human Induced Pluripotent Stem Cells Using CRISPR/Cas9

A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame&#160;N- or C-terminal fluorescent tags. The prokaryotic CRISPR/Cas9 system (clustered regularly interspaced short palindromic repeats/CRISPR-associated 9) may be used to introduce large exogenous sequences into genomic loci via homology directed repair (HDR). To achieve the desired knock-in, this protocol employs the ribonucleoprotein (RNP)-based approach where wild type Streptococcus pyogenes Cas9 protein, synthetic 2-part guide RNA (gRNA), and a donor template plasmid are delivered to the cells via electroporation. Putatively edited cells expressing the fluorescently tagged proteins are enriched by fluorescence activated cell sorting (FACS). Clonal lines are then generated and can be analyzed for precise editing outcomes. By introducing the fluorescent tag at the genomic locus of the gene of interest, the resulting subcellular localization and dynamics of the fusion protein can be studied under endogenous regulatory control, a key improvement over conventional overexpression systems. The use of hiPSCs as a model system for gene tagging provides the opportunity to study the tagged proteins in diploid, nontransformed cells. Since hiPSCs can be differentiated into multiple cell types, this approach provides the opportunity to create and study tagged proteins in a variety of isogenic cellular contexts.

Described here is a protocol for tagging endogenously expressed proteins with fluorescent tags in human induced pluripotent stem cells using CRISPR/Cas9. Putatively edited cells are enriched by fluorescence activated cell sorting and clonal cell lines are generated.

인간에서 태그 생 단백질 유도 만능 줄기 세포를 사용 하 여 CRISPR/Cas9

A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame&#160;N- or ...

유전학

Transcriptome-Wide Profiling of Protein-RNA Interactions by Cross-Linking and Immunoprecipitation Mediated by FLAG-Biotin Tandem Purification

RNA and RNA-binding proteins (RBPs) control multiple biological processes. The spatial and temporal arrangement of RNAs and RBPs underlies the delicate regulation of these processes. A strategy called CLIP-seq (cross-linking and immunoprecipitation) has been developed to capture endogenous protein-RNA interactions with UV cross-linking followed by immunoprecipitation. Despite the wide use of conventional CLIP-seq method in RBP study, the CLIP method is limited by the availability of high-quality antibodies, potential contaminants from the copurified RBPs, requirement of isotope manipulation, and potential loss of information during a tedious experimental procedure. Here we describe a modified CLIP-seq method called FbioCLIP-seq using the FLAG-biotin tag tandem purification. Through tandem purification and stringent wash conditions, almost all the interacting RNA-binding proteins are removed. Thus, the RNAs interacting indirectly mediated by these copurified RBPs are also reduced. Our FbioCLIP-seq method allows efficient detection of direct protein-bound RNAs without SDS-PAGE and membrane transfer procedures in an isotope-free and protein-specific antibody-free manner.

Here we present a modified CLIP-seq protocol called FbioCLIP-seq with FLAG-biotin tandem purification to determine the RNA targets of RNA-binding proteins (RBPs) in mammalian cells.

플래그-비오틴 탠덤 정화에 의해 중재된 상호 연결 및 면역 침전을 통해 단백질-RNA 상호 작용의 전사-전체 프로파일링

RNA and RNA-binding proteins (RBPs) control multiple biological processes. The spatial and temporal arrangement of RNAs and RBPs underlies the delicate ...

Single-Cell Quantification of Protein Degradation Rates by Time-Lapse Fluorescence Microscopy in Adherent Cell Culture

Proteins are in a dynamic state of synthesis and degradation and their half-lives can be adjusted under various circumstances. However, most commonly used approaches to determine protein half-life are either limited to population averages from lysed cells or require the use of protein synthesis inhibitors. This protocol describes a method to measure protein half-lives in single living adherent cells, using SNAP-tag fusion proteins in combination with fluorescence time-lapse microscopy. Any protein of interest fused to a SNAP-tag can be covalently bound by a fluorescent, cell permeable dye that is coupled to a benzylguanine derivative, and the decay of the labeled protein population can be monitored after washout of the residual dye. Subsequent cell tracking and quantification of the integrated fluorescence intensity over time results in an exponential decay curve for each tracked cell, allowing for determining protein degradation rates in single cells by curve fitting. This method provides an estimate for the heterogeneity of half-lives in a population of cultured cells, which cannot easily be assessed by other methods. The approach presented here is applicable to any type of cultured adherent cells expressing a protein of interest fused to a SNAP-tag. Here we use mouse embryonic stem (ES) cells grown on E-cadherin-coated cell culture plates to illustrate how single cell degradation rates of proteins with a broad range of half-lives can be determined.

This protocol describes a method to determine protein half-lives in single living adherent cells, using pulse labeling and fluorescence time-lapse imaging of SNAP-tag fusion proteins.

부착 세포 배양에서 시간 경과 형광 현미경 검사 법에 의해 단백질 저하의 단일 셀 정량화

Proteins are in a dynamic state of synthesis and degradation and their half-lives can be adjusted under various circumstances. However, most commonly used ...

발생학

Applying an Inducible Expression System to Study Interference of Bacterial Virulence Factors with Intracellular Signaling

The technique presented here allows one to analyze at which step a target protein, or alternatively a small molecule, interacts with the components of a signaling pathway. The method is based, on the one hand, on the inducible expression of a specific protein to initiate a signaling event at a defined and predetermined step in the selected signaling cascade. Concomitant expression, on the other hand, of the gene of interest then allows the investigator to evaluate if the activity of the expressed target protein is located upstream or downstream of the initiated signaling event, depending on the readout of the signaling pathway that is obtained. Here, the apoptotic cascade was selected as a defined signaling pathway to demonstrate protocol functionality. Pathogenic bacteria, such as Coxiella burnetii, translocate effector proteins that interfere with host cell death induction in the host cell to ensure bacterial survival in the cell and to promote their dissemination in the organism. The C. burnetii effector protein CaeB effectively inhibits host cell death after induction of apoptosis with UV-light or with staurosporine. To narrow down at which step CaeB interferes with the propagation of the apoptotic signal, selected proteins with well-characterized pro-apoptotic activity were expressed transiently in a doxycycline-inducible manner. If CaeB acts upstream of these proteins, apoptosis will proceed unhindered. If CaeB acts downstream, cell death will be inhibited. The test proteins selected were Bax, which acts at the level of the mitochondria, and caspase 3, which is the major executioner protease. CaeB interferes with cell death induced by Bax expression, but not by caspase 3 expression. CaeB, thus, interacts with the apoptotic cascade between these two proteins.

The method described here is used to induce the apoptotic signaling cascade at defined steps in order to dissect the activity of an anti-apoptotic bacterial effector protein. This method can also be used for inducible expression of pro-apoptotic or toxic proteins, or for dissecting interference with other signaling pathways.

유도 발현 시스템을 적용하면 세포 내 신호와 세균 독성 요인의 간섭을 연구하기 위해

The technique presented here allows one to analyze at which step a target protein, or alternatively a small molecule, interacts with the components of a ...

면역학 및 감염병학

Fluorescent Labeling of COS-7 Expressing SNAP-tag Fusion Proteins for Live Cell Imaging

SNAP-tag and CLIP-tag protein labeling systems enable the specific, covalent attachment of molecules, including fluorescent dyes, to a protein of interest in live cells. These systems offer a broad selection of fluorescent substrates optimized for a range of imaging instrumentation. Once cloned and expressed, the tagged protein can be used with a variety of substrates for numerous downstream applications without having to clone again. There are two steps to using this system: cloning and expression of the protein of interest as a SNAP-tag fusion, and labeling of the fusion with the SNAP-tag substrate of choice. The SNAP-tag is a small protein based on human O6-alkylguanine-DNA-alkyltransferase (hAGT), a DNA repair protein. SNAP-tag labels are dyes conjugated to guanine or chloropyrimidine leaving groups via a benzyl linker. In the labeling reaction, the substituted benzyl group of the substrate is covalently attached to the SNAP-tag. CLIP-tag is a modified version of SNAP-tag, engineered to react with benzylcytosine rather than benzylguanine derivatives. When used in conjunction with SNAP-tag, CLIP-tag enables the orthogonal and complementary labeling of two proteins simultaneously in the same cells.

SNAP-tag and CLIP-tag protein labeling systems enable the specific, covalent attachment of molecules, including fluorescent dyes, to a protein of interest in live cells. Once cloned and expressed, the tagged protein can be used with a variety of substrates for numerous downstream applications without having to clone again.

COS - 7 형광 라벨링는 라이브 셀 이미징에 대한 SNAP - 태그 퓨전 단백질 표현

SNAP-tag and CLIP-tag protein labeling systems enable the specific, covalent attachment of molecules, including fluorescent dyes, to a protein of interest ...

생물학

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Phenotypes are determined by a complex series of physical (e.g. protein-protein) and functional (e.g. gene-gene or genetic) interactions (GI)1. While physical interactions can indicate which bacterial proteins are associated as complexes, they do not necessarily reveal pathway-level functional relationships1. GI screens, in which the growth of double mutants bearing two deleted or inactivated genes is measured and compared to the corresponding single mutants, can illuminate epistatic dependencies between loci and hence provide a means to query and discover novel functional relationships2. Large-scale GI maps have been reported for eukaryotic organisms like yeast3-7, but GI information remains sparse for prokaryotes8, which hinders the functional annotation of bacterial genomes. To this end, we and others have developed high-throughput quantitative bacterial GI screening methods9, 10.
Here, we present the key steps required to perform quantitative E. coli Synthetic Genetic Array (eSGA) screening procedure on a genome-scale9, using natural bacterial conjugation and homologous recombination to systemically generate and measure the fitness of large numbers of double mutants in a colony array format. Briefly, a robot is used to transfer, through conjugation, chloramphenicol (Cm) - marked mutant alleles from engineered Hfr (High frequency of recombination) 'donor strains' into an ordered array of kanamycin (Kan) - marked F- recipient strains. Typically, we use loss-of-function single mutants bearing non-essential gene deletions (e.g. the 'Keio' collection11) and essential gene hypomorphic mutations (i.e. alleles conferring reduced protein expression, stability, or activity9, 12, 13) to query the functional associations of non-essential and essential genes, respectively. After conjugation and ensuing genetic exchange mediated by homologous recombination, the resulting double mutants are selected on solid medium containing both antibiotics. After outgrowth, the plates are digitally imaged and colony sizes are quantitatively scored using an in-house automated image processing system14. GIs are revealed when the growth rate of a double mutant is either significantly better or worse than expected9. Aggravating (or negative) GIs often result between loss-of-function mutations in pairs of genes from compensatory pathways that impinge on the same essential process2. Here, the loss of a single gene is buffered, such that either single mutant is viable. However, the loss of both pathways is deleterious and results in synthetic lethality or sickness (i.e. slow growth). Conversely, alleviating (or positive) interactions can occur between genes in the same pathway or protein complex2 as the deletion of either gene alone is often sufficient to perturb the normal function of the pathway or complex such that additional perturbations do not reduce activity, and hence growth, further. Overall, systematically identifying and analyzing GI networks can provide unbiased, global maps of the functional relationships between large numbers of genes, from which pathway-level information missed by other approaches can be inferred9.

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Systematic, large-scale synthetic genetic (gene-gene or epistasis) interaction screens can be used to explore genetic redundancy and pathway cross-talk. Here, we describe a high-throughput quantitative synthetic genetic array screening technology, termed eSGA that we developed for elucidating epistatic relationships and exploring genetic interaction networks in Escherichia coli.

에 박테리아 기능 네트워크 및 경로를 매핑<em&gt; 대장균</em&gt; 합성 유전자 배열을 사용하여

Phenotypes  are determined by a complex series of physical (e.g. protein-protein) and  functional (e.g. gene-gene or genetic) interactions (GI)1. While ...

TurboID-Based Proximity Labeling for In Planta Identification of Protein-Protein Interaction Networks

Proximity labeling (PL) techniques using engineered ascorbate peroxidase (APEX) or Escherichia coli biotin ligase BirA (known as BioID) have been successfully used for identification of protein-protein interactions (PPIs) in mammalian cells. However, requirements of toxic hydrogen peroxide (H2O2) in APEX-based PL, longer incubation time with biotin (16&#8211;24 h), and higher incubation temperature (37 &#176;C) in BioID-based PL severely limit their applications in plants. The recently described TurboID-based PL addresses many limitations of BioID and APEX. TurboID allows rapid proximity labeling of proteins in just 10&#8201;min under room temperature (RT) conditions. Although the utility of TurboID has been demonstrated in animal models, we recently showed that TurboID-based PL performs better in plants compared to BioID for labeling of proteins that are proximal to a protein of interest. Provided here is a step-by-step protocol for the identification of protein interaction partners using the N-terminal Toll/interleukin-1 receptor (TIR) domain of the nucleotide-binding leucine-rich repeat (NLR) protein family as a model. The method describes vector construction, agroinfiltration of protein expression constructs, biotin treatment, protein extraction and desalting, quantification, and enrichment of the biotinylated proteins by affinity purification. The protocol described here can be easily adapted to study other proteins of interest in Nicotiana and other plant species.

Described here is a proximity labeling method for identification of interaction partners of the TIR domain of the NLR immune receptor in Nicotiana benthamiana leaf tissue. Also provided is a detailed protocol for the identification of interactions between other proteins of interest using this technique in Nicotiana and other plant species.

단백질-단백질 상호 작용 네트워크의 질라 식별을 위한 터보ID 기반 근접 라벨링

Proximity labeling (PL) techniques using engineered ascorbate peroxidase (APEX) or Escherichia coli biotin ligase BirA (known as BioID) have been ...

Identification of Protein Interaction Partners in Mammalian Cells Using SILAC-immunoprecipitation Quantitative Proteomics

Quantitative proteomics combined with immuno-affinity purification, SILAC immunoprecipitation, represent a powerful means for the discovery of novel protein:protein interactions. By allowing the accurate relative quantification of protein abundance in both control and test samples, true interactions may be easily distinguished from experimental contaminants. Low affinity interactions can be preserved through the use of less-stringent buffer conditions and remain readily identifiable. This protocol discusses the labeling of tissue culture cells with stable isotope labeled amino acids, transfection and immunoprecipitation of an affinity tagged protein of interest, followed by the preparation for submission to a mass spectrometry facility. This protocol then discusses how to analyze and interpret the data returned from the mass spectrometer in order to identify cellular partners interacting with a protein of interest. As an example this technique is applied to identify proteins binding to the eukaryotic translation initiation factors: eIF4AI and eIF4AII.

SILAC immunoprecipitation experiments represent a powerful means for discovering novel protein:protein interactions. By allowing the accurate relative quantification of protein abundance in both control and test samples, true interactions may be easily distinguished from experimental contaminants, and low affinity interactions preserved through use of less-stringent buffer conditions.

SILAC - 면역 정량 프로테오믹스를 사용하여 포유 동물 세포에있는 단백질 상호 작용 파트너의 식별

Quantitative proteomics combined with immuno-affinity purification, SILAC immunoprecipitation, represent a powerful means for the discovery of novel ...

Cell-Type Specific Protein Purification and Identification from Complex Tissues Using a Mutant Methionine tRNA Synthetase Mouse Line

Understanding protein homeostasis in vivo is key to knowing how the cells work in both physiological and disease conditions. The present protocol describes in vivo labeling and subsequent purification of newly synthesized proteins using an engineered mouse line to direct protein labeling to specific cellular populations. It is an inducible line by Cre recombinase expression of L274G-Methionine tRNA synthetase (MetRS*), enabling azidonorleucine (ANL) incorporation to the proteins, which otherwise will not occur. Using the method described here, it is possible to purify cell-type-specific proteomes labeled in vivo and detect subtle changes in protein content due to sample complexity reduction.

This protocol describes how to perform cell-type-specific protein labeling with azidonorleucine (ANL) using a mouse line expressing a mutant L274G-Methionine tRNA synthetase (MetRS*) and the necessary steps for labeled cell-type-specific proteins isolation. We outline two possible ANL administration routes in live mice by (1) drinking water and (2) intraperitoneal injections.