암 예방 및 텍사스 연구소 (CPRIT, RP160169), 그리고 UT 사우스 웨스턴 의료 센터가 MHZ에게 주어진,이 작품은 크론과 미국의 대장염 재단 (3711 CCFA)에서 자금에 의해 지원되었다

여기에 설명 된 모든 실험 동물 자원 센터 (ARC), UT 사우스 웨스턴 의료 센터에서 특정 병원체 무료 (SPF) 시설 유지 6-8주 세 남자 야생형 (C57BL6 / J) 마우스를 사용하여 수행 하였다. 모든 연구는 기관 동물 관리 및 사용위원회 (IACUC)의 승인을하고, IACUC 지침 및 실험 동물의 관리 및 사용을위한 건강 가이드의 국립 연구소에 따라 실시 하였다. 1. 수집 및 결장의 준비 <ol><li> 자궁 경부 전위 다음 CO 2 질식와 쥐를 안락사. </li><li> 70 % 에탄올로 마우스 스프레이와 보드 아래로 마우스 등의 측면을 지키는 고정 보드에 사지를 고정. </li><li> 미리 멸균 해부 가위 집게를 사용하여 복부의 복막에 중심선을 절개한다. 집게로 복막을 접어 복부를 엽니 다. </li><li> 복강 위스콘신에서 장을 제거번째는 집게와 가위를 해부. 맹장 하단과 항문의 타단 절단함으로써 소장으로부터 대장 별개. </li><li> 얼음처럼 차가운 PBS를 포함하는 멸균 배양 접시에 콜론을 배치합니다. 결장 내강 내에서 대변이 완전히 제거 될 때까지 20 G 바늘 또는 경구 위관 영양법 바늘을 잡고 20 ㎖ 주사기를 사용하여 빙냉 PBS로 결장 내강의 내용이 플러시. </li><li> 세로로 가위로 결장을 잘라. 멸균 페트리 접시에 얼음처럼 차가운 PBS에 격렬하게 흔들어 콜론을 씻으십시오. </li><li> 약 1cm 긴 멸균 메스 나 가위를 사용하여 조각으로 결장 조직을 잘라. </li><li> 대장 조각의 무게를 기록한다. 참고 : 제 1의 모든 단계를 내부 또는 생물 안전 캐비닛의 외부에 수행 할 수 있습니다. 콜론 문화에 대한 준비가되면, 모든 단계는 무균 상태를 유지하기 위해 생물 안전 캐비닛 내부에서 수행해야합니다. </li></ol> 2. 콜론 조직문화 <ol><li> 6- 웰 세포 배양 접시에 세포 스트레이너 (100 μm의)을 놓는다. 셀 스트레이너에 하나의 마우스에서 수집 결장 조각을 모두 전송합니다. </li><li> 5 % FBS, 페니실린 - 스트렙토 마이신 (1 배) 및 겐타 마이신 (20 μg의 / ㎖)를 포함하는 5 mL의 DMEM / F12 매체를 추가합니다. 완전히 매체와 콜론 조각을 커버합니다. </li><li> 5 % CO 2 및 95 % 공기 인큐베이터에서 37 ℃에서 2 시간 동안 인큐베이션. </li><li> 셀 스트레이너를 들어 올리고 미디어를 대기음. </li><li> 다시 우물의 셀 스트레이너를 놓고 어떤 항생제없이 5 ml의에게 신선한 매체를 추가 할 수 있습니다. 셀 스트레이너를 들어 올리고 미디어를 대기음. </li><li> 잔류 항생 물질을 모두 제거하기 위해 위 세척 단계 (단계 2.5) 두 번 더 (총 3 회) 반복한다. </li><li> 멸균 12 웰 세포 배양 플레이트의 한 웰에 단일 셀 스트레이너에서 결장 부분을 전송. </li><li> (어떤 항생제 제외) 5 % FBS가 포함 된 DMEM / F12 매체를 추가합니다. weig와 매체의 볼륨을 조절할결장 조각 저항성, 예를 들어, 조직의 100 mg을 1 ml의 배지. 5 % CO 2 및 95 % 공기 주입 배양기에서 37 ℃에서 12 시간 동안 배양. </li><li> 멸균 1.5 ML 튜브에서 배양 상등액을 수집합니다. </li><li> 5 분 동안 4 ° C에서 12,000 XG에 원심 분리기. 분석 및 / 또는 기타 면역 분석을 죽이는 박테리아에 사용하기위한 새로운 1.5 mL의 튜브에 뜨는을 분리합니다. 상층 액을 분석 전까지 -80 ℃에서 저장 될 수있다. </li><li> RNA 분리 용 튜브에 콜론 조각을 수집합니다. </li></ol> 분석을 죽이는 3. 대장균 <ol><li> 15 ML 튜브에 5 mL의 루리아 - 베르 타니 (LB) 국물에 대장균을 접종하고 밤새 200 rpm으로 진탕 37 ° C에서 품어. 약간 느슨한 문화 튜브의 캡을 보관하십시오. </li><li> 4 ℃에서 10 분 동안 1,200 XG에서 세균 배양 튜브를 원심 분리기. 상층 액을 제거하고 5 ml의 얼음처럼 차가운 PBS로 세균 펠렛을 재현 탁. </li><li> BACT의 양도 1 mL의600 nm에서 큐벳 및 측정 OD에 erial 정지. 빈으로 PBS를 사용합니다. </li><li> 소정의 표준 곡선을 사용하여 콜로니 형성 유닛 (CFU)을 계산한다. 여기, 그 1 OD = 2 × 109 CFU / ㎖ (약)를 가정합니다. </li><li> 주식 서스펜션 1 × 105 CFU / mL로 세균 현탁액을 희석. </li><li> 24 웰 세포 배양 플레이트의 중복 웰에 2.10 수집 결장 기관 배양 상등액을 전송 (500 μL / 웰). </li><li> 하나 잘 포함 된 500 μL 대장 기관 배양 상청에 10 μL 대장균 문화 (1,000 CFU)를 추가합니다. 콜론 기관 배양 상청은 어떤 오염 물질을 포함하지 않는 것을 확인하는 대장균 접종하지 않고 다른 잘 둡니다. </li><li> 제어와 같은 항생제없이 배양 배지 (DMEM / F12 플러스 5 % FBS) 박테리아 동일한 수 (1000 CFU)를 부화. </li><li> 1 시간 동안 37 ℃에서 인큐베이션. </li><li> 각각의 샘플 드롭 위스콘신의 50 μL를 놓습니다맥 콘키 배지 플레이트에 자체. 하룻밤 37 ° C에서 맥 콘키 배지 판을 품어. </li><li> 콜로니의 수를 계산하고 CFU / ㎖을 계산합니다. </li></ol> 4. 대장 항균 호스트 방어 응답에 외부와 내장 요인의 효과 주 : 여기에서 설명 된 것처럼 미생물 사멸 분석은 장기 배양 상등액의 살균 활성에 대한 병원체 관련 분자 패턴 (PAMPs가) 및 사이토 카인의 효과를 조사하기 위해 채용 할 수있다. IL-1β 및 IL-18을 이용한 실험 예에 대하여 설명한다. <ol><li> 제 1 절에 설명 된대로 마우스의 콜론를 수집합니다. </li><li> 멸균 종이 타월에 콜론을 배치합니다. 가위를 사용하여 세 부분 (그림 2)에 길이 방향으로 결장을 잘라. </li><li> 제 1 항에 기재된 빙냉 PBS에서 결장의 각 부분을 세척한다. </li><li> 작은 조각으로 대장의 각 부분을 잘라 무균 무게. 각 파트의 부분을 전송6 웰 세포 배양 플레이트의 세 개의 웰 (도 2) 상에 배치 된 세 개의 셀 스트레이너 (100 μm의)으로 결장. </li><li> 5 % FBS, 페니실린 - 스트렙토 마이신 (1 배) 및 겐타 마이신 (20 μg의 / ㎖)를 포함하는 2 ml의 DMEM / F12 매체를 추가합니다. </li><li> 5 % CO 2 및 95 % 공기 주입 배양기에서 37 ℃에서 2 시간 동안 배양. </li><li> 2.4-2.6에 설명 된대로 대장 조각을 씻으십시오. 멸균 12 웰 세포 배양 플레이트의 한 웰에 단일 셀 스트레이너의 결장 부분을 전송. 하나의 마우스에서 결장의 세 부분을 포함하는 세 개의 우물 (그림 2) 치료, IL-1β로 지정하고, IL-18해야한다. </li><li> (어떤 항생제 제외) 5 % FBS가 포함 된 DMEM / F12 매체를 추가합니다. 결장 부분의 중량, 예를 들어, 조직의 100 mg을 1 mL의 매체를 상기 매체의 볼륨을 조정한다. </li><li> 12 시간 동안 IL-1β (20 NG / ㎖) 또는 IL-18 (20 NG / mL)로 콜론 기관 배양을 자극한다. 처리되지 않은 결장<html> 장기 문화는 제어 역할을합니다. </li><li> 5 % CO 2 및 95 % 공기를 주입 인큐베이터에서 37 ℃에서 12 시간 배양 한 후 멸균 된 1.5 ㎖의 튜브에 배양 상등액을 모은다. </li><li> 24 웰 플레이트의 중복 우물에 500 μL의 배양 상등액을 전송합니다. </li><li> 각 조건에 대해 제 3 절에서 설명한대로 하나의 웰에 대장균을 접종 대장 기관 배양 상등액 대장균 (1000 CFU)을 접종한다. 대장균이없는 다른 잘 포함하는 동일 장기 배양 상층 액은 세균 오염에 대한 제어 역할을합니다. </li><li> 제어와 같은 항생제없이 배양 배지에서 세균이 동일한 양의 인큐베이션. </li><li> 1 시간 동안 37 ℃에서 인큐베이션. </li><li> 드롭 현명한 맥 콘키 배지 플레이트에 각 샘플의 50 μL를 놓습니다. 하룻밤에 37 ° C의 맥 콘키 배지 판을 품어. </li><li> 콜로니의 수를 계산하고 CFU / ㎖ (그림 4)을 계산합니다. </li></ol>e_title &quot;&gt; 5. 항균 유전자의 발현 측정 <ol><li> 대장 기관 문화의 하룻밤 배양 (12 시간) 후 2 ml의 얼음처럼 차가운 PBS (2 배)와 콜론 조각을 씻고, 제 2 조 및 제 4에 설명 된대로. </li><li> 2 용액의 RNase / DNase의 무료 스크류 캡 튜브에 콜론 조각을 수집합니다. 얼음에 튜브를 놓습니다. </li><li> 튜브에 1 mL의에게 상업 트리 졸 시약 및 용균 매트릭스 구슬을 추가합니다. </li><li> 를 Lyse 자동화 조직 균질화기를 사용하여 조직. </li><li> 새로운 microcentrifuge 관에 조직 해물를 수집합니다. </li><li> 표준 프로토콜을 사용하여 RNA를 분리합니다. </li><li> RNA의 농도를 측정한다. </li><li> 탈 이온수로 적절 RNA를 희석하는 cDNA를 합성하기 위해 500 NG의 RNA를 사용합니다. </li><li> 대상 항균 유전자, 사이토 카인, 케모카인, 관심의 다른 유전자의 실시간 RT-PCR 분석을위한 cDNA를 사용합니다. </li></ol>

<ol>
	<li>Maloy, K. J., Powrie, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+homeostasis+and+its+breakdown+in+inflammatory+bowel+disease.">Intestinal homeostasis and its breakdown in inflammatory bowel disease.</a> Nature. 474, 298-306 (2011).</li><li>Hooper, L. V., Macpherson, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+adaptations+that+maintain+homeostasis+with+the+intestinal+microbiota.">Immune adaptations that maintain homeostasis with the intestinal microbiota.</a> Nat Rev Immunol. 10, 159-169 (2010).</li><li>Vaishnava, S., Behrendt, C. L., Ismail, A. S., Eckmann, L., Hooper, L. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Paneth+cells+directly+sense+gut+commensals+and+maintain+homeostasis+at+the+intestinal+host-microbial+interface.">Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal host-microbial interface.</a> Proc Natl Acad Sci U S A. 105, 20858-20863 (2008).</li><li>Kamada, N., Chen, G. Y., Inohara, N., Nunez, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+pathogens+and+pathobionts+by+the+gut+microbiota.">Control of pathogens and pathobionts by the gut microbiota.</a> Nat Immunol. 14, 685-690 (2013).</li><li>Wu, H. J., Wu, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+gut+microbiota+in+immune+homeostasis+and+autoimmunity.">The role of gut microbiota in immune homeostasis and autoimmunity.</a> Gut Microbes. 3, 4-14 (2012).</li><li>Zimmerman, N. P., Vongsa, R. A., Wendt, M. K., Dwinell, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemokines+and+chemokine+receptors+in+mucosal+homeostasis+at+the+intestinal+epithelial+barrier+in+inflammatory+bowel+disease.">Chemokines and chemokine receptors in mucosal homeostasis at the intestinal epithelial barrier in inflammatory bowel disease.</a> Inflamm Bowel Dis. 14, 1000-1011 (2008).</li><li>Elliott, D. E., Siddique, S. S., Weinstock, J. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+immunity+in+disease.">Innate immunity in disease.</a> Clin Gastroenterol Hepatol. 12, 749-755 (2014).</li><li>Chopra, D. P., Dombkowski, A. A., Stemmer, P. M., Parker, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+epithelial+cells+in+vitro.">Intestinal epithelial cells in vitro.</a> Stem Cells Dev. 19, 131-142 (2010).</li><li>Autrup, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Explant+culture+of+human+colon.">Explant culture of human colon.</a> Methods Cell Biol. 21, 385-401 (1980).</li><li>Qin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human+gut+microbial+gene+catalogue+established+by+metagenomic+sequencing.">A human gut microbial gene catalogue established by metagenomic sequencing.</a> Nature. 464, 59-65 (2010).</li><li>Wildenberg, M. E., vanden Brink, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+major+advance+in+ex+vivo+intestinal+organ+culture.">A major advance in ex vivo intestinal organ culture.</a> Gut. 61, 961-962 (2012).</li><li>Leushacke, M., Barker, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+vivo+culture+of+the+intestinal+epithelium:+strategies+and+applications.">Ex vivo culture of the intestinal epithelium: strategies and applications.</a> Gut. 63, 1345-1354 (2014).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459, 262-265 (2009).</li><li>Tsilingiri, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probiotic+and+postbiotic+activity+in+health+and+disease:+comparison+on+a+novel+polarised+ex-vivo+organ+culture+model.">Probiotic and postbiotic activity in health and disease: comparison on a novel polarised ex-vivo organ culture model.</a> Gut. 61, 1007-1015 (2012).</li><li>Haque, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+interactions+of+Salmonella+enterica+serovar+typhimurium+with+human+small+intestinal+epithelial+explants.">Early interactions of Salmonella enterica serovar typhimurium with human small intestinal epithelial explants.</a> Gut. 53, 1424-1430 (2004).</li><li>Hicks, S., Candy, D. C., Phillips, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adhesion+of+enteroaggregative+Escherichia+coli+to+pediatric+intestinal+mucosa+in+vitro.">Adhesion of enteroaggregative Escherichia coli to pediatric intestinal mucosa in vitro.</a> Infect Immun. 64, 4751-4760 (1996).</li><li>Knutton, S., Lloyd, D. R., Candy, D. C., McNeish, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+adhesion+of+enterotoxigenic+Escherichia+coli+to+human+intestinal+epithelial+cells+from+mucosal+biopsies.">In vitro adhesion of enterotoxigenic Escherichia coli to human intestinal epithelial cells from mucosal biopsies.</a> Infect Immun. 44, 514-518 (1984).</li><li>Senior, P. V., Pritchett, C. J., Sunter, J. P., Appleton, D. R., Watson, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crypt+regeneration+in+adult+human+colonic+mucosa+during+prolonged+organ+culture.">Crypt regeneration in adult human colonic mucosa during prolonged organ culture.</a> J Anat. 134, 459-469 (1982).</li><li>Smollett, K., Shaw, R. K., Garmendia, J., Knutton, S., Frankel, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Function+and+distribution+of+EspG2,+a+type+III+secretion+system+effector+of+enteropathogenic+Escherichia+coli.">Function and distribution of EspG2, a type III secretion system effector of enteropathogenic Escherichia coli.</a> Microbes Infect. 8, 2220-2227 (2006).</li><li>Bareiss, P. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organotypical+tissue+cultures+from+adult+murine+colon+as+an+in+vitro+model+of+intestinal+mucosa.">Organotypical tissue cultures from adult murine colon as an in vitro model of intestinal mucosa.</a> Histochem Cell Biol. 129, 795-804 (2008).</li><li>Tsilingiri, K., Sonzogni, A., Caprioli, F., Rescigno, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+method+for+the+culture+and+polarized+stimulation+of+human+intestinal+mucosa+explants.">A novel method for the culture and polarized stimulation of human intestinal mucosa explants.</a> J Vis Exp. , e4368 (2013).</li><li>Hu, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA+Sensor+AIM2+Maintains+Intestinal+Homeostasis+via+Regulation+of+Epithelial+Antimicrobial+Host+Defense.">The DNA Sensor AIM2 Maintains Intestinal Homeostasis via Regulation of Epithelial Antimicrobial Host Defense.</a> Cell Rep. 13, 1922-1936 (2015).</li><li>Moorghen, M., Chapman, M., Appleton, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+organ-culture+method+for+human+colorectal+mucosa+using+serum-free+medium.">An organ-culture method for human colorectal mucosa using serum-free medium.</a> J Pathol. 180, 102-105 (1996).</li><li>Dame, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+colon+tissue+in+organ+culture:+preservation+of+normal+and+neoplastic+characteristics.">Human colon tissue in organ culture: preservation of normal and neoplastic characteristics.</a> In Vitro Cell Dev Biol Anim. 46, 114-122 (2010).</li><li>Grant, A. J., Woodward, J., Maskell, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+an+ex+vivo+organ+culture+model+using+human+gastro-intestinal+tissue+and+Campylobacter+jejuni.">Development of an ex vivo organ culture model using human gastro-intestinal tissue and Campylobacter jejuni.</a> FEMS Microbiol Lett. 263, 240-243 (2006).</li></ol>

The authors have no competing financial interests.

장 상피 세포 성장 요구 사항의 관점에서 매우 민감하고 문화에 따라서 어렵다. EDTA 처리에 의해 고립 된 상피 세포는 DMEM (8)과 같은 기존의 세포 배양 배지에서 생존하지 않습니다. 따라서, 고립 된 지하실 또는 기본 상피 세포를 사용하여 호스트 병원체 상호 작용 연구는 매우 도전이다. 최근, 사토 등. 장 병태 생리 (13)에 관한 연구에 매우 유망하고 유용한 토굴 organoid 문화 시스템을 설명했다. organoids이 장 지하실의 많은 기능을 나타내는 반면, 같은 무균 환경에서 재배되고있는 organoid 세포의 면역 반응이 생체 내에서 장 상피 세포의 반응을 요점을 되풀이할지 여부에 관심이 있습니다. 상피 줄기 세포와 organoids의 문화 비싼 시약의 요구 사항의 분리 및 배양에 필요한 정확한 기술은 엄마를 방지이 시스템의 이점을 취하는 NY 연구소. 생체 장기 문화의 사용이 organoid 문화에 대한 대안은 아니지만,이 시스템은 장 상피 세포의 항균 반응을 연구 할 수있는 쉽고 저렴한 방법을 제공합니다. 이 기술의 주요 장점은 접시에 배양하면서 부위의 조직 구조가 유지된다는 점이다. 우리는 대장 조직이 그들의 문화 후 최소 24 시간 동안 생리 활성되어 있음을 관찰 할 수 있었다. 사이토 카인과 항균 펩타이드의 발현에 의해 측정 된 결장의 배양 동안, 대장 상피 세포는 외인성 자극에 반응한다. 손상되지 않은 조직의 상피 세포의 생존 능력은 상기 배양 배지에 적절한 성장 인자 및 세포 사멸 억제제의 첨가에 의해 향상 될 수있다. 이전 보고서는 정상적인 인간 결장 조직 기관 며칠 8 생체 유지 될 수 있음을 시사 </SUP&gt; 23, 24. 마우스 결장 기관의 체외 배양을위한 프로토콜은 장 상피 세포의 항균 면역 반응에 관한 연구에 많은 응용 프로그램을 가질 수있다. 병원균과 PAMPs가 그러한 수신자 같은 수용체 (TLR들)과 상피와 면역 세포에 존재하는 NOD 같은 수용체 (NLRs)와 같은 PRRS에 의해 인식됩니다. 결함이있는 표현과 많은 TLR들과 NLRs의 기능은 IBD에 대한 감수성, 대장 종양 및 세균 감염과 연관되어 있습니다. 불멸화 상피 세포주 장내 틈새의 모든 기능을 나타내지 않기 때문에 상기 생체 결장 기관 배양 물은 매우 유용한 실험 도구이다. 이 시스템을 사용하여, 우리는 장 상피 세포에서 항균 이펙터 분자의 유도에 다양 PAMPs가하거나 자극의 효과를 조사 할 수있다. 대표 실험에서는 사이토 카인이 좋아하는 것으로 나타났다IL-1β 및 IL-18 트리거 항균 펩타이드의 발현 (도 3). 우리는 또한 대장 조직에 의해 생성 된 항균 펩타이드를 효과적으로 대장균 (그림 4)을 죽일 수 있다는 것을 여기에 표시됩니다. 이러한 기술은 장내 미생물 숙주 방어 반응에 리포 폴리 사카 라이드의 영향 (LPS), 펩티도 글리 칸 (PGN) muramyldipeptide (MDP) 및 다른 PAMPs가 테스트에 적용될 수있다. 우리는 이전에 약간의 12, 16, 20, 25 바와 같이 결장 기관 배양 프로토콜을 수정했다. 우리는 두 단계로 콜론을 배양. 첫째, 우리는 2 시간 동안 매체를 포함하는 항생제 결장 조직을 배양 하였다. 우리는 그 다음 항생제 무료 매체와 배양 다음에 콜론 조각의 반복 세탁으로 항생제를 제거했습니다. 따라서, 배양 상층 액의 하룻밤 배양 물로부터 얻은대장을 나타낸다 대장균 배양 분비 항균 펩타이드의 효과. 이 방법은 관심있는 박테리아에 결장 부위 유래 항균 펩타이드의 살균 효과를 확인하기 위해 이용 될 수있다. 적절한 선택 한천 미디어 문화에 박테리아를 사용해야합니다. 대부분의 기술과 마찬가지로, 생체 기관 배양 물 시스템의 한계가있다. 첫째, 세포 배양 또는 organoid 문화와는 달리, 장기 성장하고 증식하기 때문에 확장 할 수 없습니다하지 않습니다. 둘째, 장 상피 세포는 매우 민감하고는 토굴 organoid 문화에 사용되는 추가 성장 인자 및 세포 사멸 억제제없이 비교적 빨리 죽는다. 셋째, 장기 배양에서 관찰 된 면역 반응은 세포 집단의 다른 종류의 집합 적 응답이다. 따라서, 항균성 및 효과기 유전자 발현의 개별 세포 유형의 역할을 평가 될 수 없다. Additionally, 세포주 및 organoid 문화와는 달리, 항균 펩타이드와 콜론의 다른 이펙터 분자의 발현 마우스에서 동일한 유전 적 배경 마우스 다를 수 있습니다. 요약하면, 우리는 장 항균 면역 반응을 연구하는데 매우 유용 생체 대장 기관 배양을위한 간단한 프로토콜은 여기에 대해 설명합니다. 이 접근법은 관심의 유전자 변이 생쥐 콜론 배양하여 항균 펩타이드의 발현에서 다양한 선천성 면역 유전자의 역할을 테스트하기 위해 사용될 수있다. 또한,이 프로토콜은 결장 생체 검사 샘플을 기관 배양 물을 실시하여 IBD 환자의 장내 미생물 반응을 조사하는 임상 연구에 사용하기 위해 구성 될 수있다.

소장은 공생 미생물에 대한 장벽 역할을하는 동적 시스템을 나타냅니다 침입하는 병원균에 대한 싸움, 그리고 미생물 조성물 1을 조절한다. 장 상피 세포, 장 세포, 술잔 세포 Paneth 세포 및 장 내분비 세포로 이루어진 장내 미생물 대 숙주 방어 반응을 제공하는 주요 세포 집단이다. 술잔 세포는 상피 층 (2)의 상단에 완충 영역을 작성 뮤신 생산. Paneth 세포 및 장 세포 항균 펩티드, 사이토 카인과 항균 숙주 방어 반응을 구성하고 장내 미생물 조성물 (3, 4)를 형성에 기여하는 활성 산소 및 질소 종을 생산한다. 상피 세포뿐만 아니라, 대 식세포, 수지상 세포, 호중구, 자연 살해 세포, 림프구 및 인나 포함한 면역 세포<html> - 7 점막 고유 층과 점막하에 테 림프 세포를 생산하는 사이토 카인, 케모카인, 기타 매개체 5 장 항균 호스트 방어 반응에 중요한 역할을한다. 점막 면역계는 미생물을 조절하고 미생물 감염에 대한 보호를 제공하는 방법을 이해하기 위해, 장내의 이종 세포 집단의 복잡한 상호 작용을 고려하는 것이 중요하다. 그러나, 소장의 기능을 모두 포함 체외 모델을 사용할 수 없습니다. 따라서, 소장에서 호스트 병원체 상호 작용에 대한 분자 연구는 매우 도전이다. 지난 몇 년 동안, 장 점막의 양상을 모방 여러 모델 시스템은 염증성 장 질환 (IBD) 등의 위장 장애 (8)과 관련된 병리 생리 학적 과정을 연구 개발되어왔다 -= &quot;외부 참조&quot;&gt; 14. 불후의 장 상피 세포 라인은 종종 상피 세포의 특정 반응을 연구하는 데 사용됩니다. 그러나, 차등 유전자 발현 및 불멸화 세포 기능, 데이터는 주로 생체 내 연구에서 관찰 된 것과 일치하지 않는 세포를 사용하여 얻은. 최근에 다른 자극 13 장 상피 세포의 반응을 평가하기위한 잠재적 인 도구로 떠오르고있다 organoid 문화 장 토굴. 이 시스템에서, 굴 줄기 세포 성장 및 3D organoid 구조를 개발할 수있다. organoid 배양 시스템은 장 상피 세포의 여러 측면을 연구하는데 매우 유용하지만, 면역 세포, 상피 세포 및 미생물 제품의 복잡한 상호 작용을 모방하지 않는다. 장 조직의 생체 문화는 생체 내 숙주 방어 반응을 더 잘 표현을 제공합니다. 이 방법에서, 상기 부위의 일부는 세포 배양 용 접시에서 배양 재치장내 세포 집단의 다른 유형을 허용 시간 적절한 미디어는 최소 48 시간 동안 대사 활성화합니다. 따라서, 장기의 생체 외 배양 미생물 유전자의 발현하고 특정 자극에 창자 숙주 방어 반응을 측정 할 수있다. 21 - 수사는 소장 (15)에 미생물 감염에 대한 숙주 방어 반응을 연구하기 위해 생체 장기 배양 시스템을 사용하고있다. 우리는 최근 마우스 콜론 (22)의 항균 호스트 방어 반응의 inflammasome을의 역할을 연구하기 위해 장기 배양 시스템을 채택했다. inflammasome을 성숙 IL-1β 및 IL-18의 생산을 위해 필요한 카스파 제 1의 활성화를위한 분자 플랫폼이다. 우리는 IL-1β 및 IL-18은 대장균 효과적으로 공생 pathobionts을 죽이는 항균 펩티드를 유도 것으로 나타났다 </em&gt;. 이러한 관찰 inflammasome을 결손 마우스 결장 22 증가 대장균 부담과 일치했다. 이 시스템은 따라서, 그러한 염증성 장 질환 (IBD)과 결장암 (CRC)와 같은 장 질환의 장내 미생물 숙주 방어 반응에 패턴 인식 수용체 (PRRS)와 기타 선천성 면역 분자의 역할뿐만 아니라 기전을 연구하기 위해 이용 될 수있다. 이들 유전자의 대부분이 장내에서 변형 된 미생물 조성과 관련된 200 개 이상의 IBD 감수성 유전자, 돌연변이가있다. 그것은 IBD - 감수성 유전자가 장내 미생물 규제되는 정확한 메커니즘을 결정하는 큰 임상 적 의의이다. 이 방법의 전반적인 목표는 생체 대장 기관 배양의 기본 프로토콜을 소개하고,이 배양 방법은 대장의 항균 호스트 방어 반응을 연구하는 데 사용할 수있는 방법을 설명하는 것입니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Advanced DMEM/ F12</td>
			<td>Life Technologies</td>
			<td>12634-010</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s phosphate buffered saline, modified, w/o Calcium chloride &#38; Magnesium chloride</td>
			<td>Sigma</td>
			<td>5634</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS, heat inactivated</td>
			<td>Sigma</td>
			<td>F4135</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin</td>
			<td>Life Technologies</td>
			<td>15070063</td>
			<td></td>
		</tr>
		<tr>
			<td>Gentamicin solution</td>
			<td>Sigma</td>
			<td>G1272</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse IL-1b recombinan</td>
			<td>Reprokine</td>
			<td>RKP10749</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse IL-18 recombinant</td>
			<td>Reprokine</td>
			<td>RKP70380</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>Difco Luria-Bertani Broth&#160;</td>
			<td>BD Bioscience</td>
			<td>244620</td>
			<td></td>
		</tr>
		<tr>
			<td>BD&#160;Difco Dehydrated Culture Media: MacConkey Agar</td>
			<td>Fisher Scientific</td>
			<td>DF0075-17-1</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop 1000 Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td></td>
			<td>Uded to measure RNA concentration</td>
		</tr>
		<tr>
			<td>UV/Vis Spectrophotometer</td>
			<td>BECKMAN</td>
			<td>DU 530</td>
			<td>Used to determine E. coli count</td>
		</tr>
		<tr>
			<td>iScript RT Supermix, 100 rxns</td>
			<td>Bio-Rad</td>
			<td>1708841</td>
			<td></td>
		</tr>
		<tr>
			<td>iTaq Univer SYBR Green Supermix&#160;</td>
			<td>Bio-Rad</td>
			<td>1725125&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Lysing Matrix S (1/8&#34;), 2 mL Tube</td>
			<td>MP Biomedicals</td>
			<td>116925500</td>
			<td>Used to homgenize colon organ for RNA isolation</td>
		</tr>
		<tr>
			<td>FastPrep-24 5G System</td>
			<td>Bio-Rad</td>
			<td>116005500</td>
			<td></td>
		</tr>
		<tr>
			<td>100x15 Petri Dish</td>
			<td>Falcon</td>
			<td>5687</td>
			<td></td>
		</tr>
		<tr>
			<td>Plate 6well ps TC CS100, Cellstar, 6w, tc, F-bottom (Flat), w/lid, sterile</td>
			<td>Cellstar</td>
			<td>5085</td>
			<td></td>
		</tr>
		<tr>
			<td>100 micron cell strainer</td>
			<td>Falcon</td>
			<td>5698</td>
			<td></td>
		</tr>
		<tr>
			<td>Sorvall Legend Micro 21R Centrifuge</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Sorvall ST40R Centrifuge</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Forma Scientific orbital shaker</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

the ex vivo colon organ culture and its use in antimicrobial host defense studies

장 상피 세포의 종류, 점막 면역 세포를 포함 propia 및 간질로 이루어진 반복 토굴 구조체의 구조를 표시한다. 이러한 이종 세포 모두 장내 항상성에 기여 항균 호스트 방어에 참여한다. 따라서, 생체 외 환경에서 면역 반응과 소장의 항균 활성을 연구 대리 모델을 식별하는 것은 매우 어렵습니다. 시험관 연구에서 정상 소장과 미세 환경의 정확한 생리를 대변하지 않습니다 organoid 문화 불후의 장 상피 세포 라인 또는 기본 토굴을 사용. 여기서, 우리는 배양 접시와 어떻게 생체 기관 배양 물 시스템은 미생물 숙주 방어 반응에 관한 연구에서 구현 될 수있다에서 배양 마우스 결장암 조직의 방법을 논의한다. 대표 실험에서, 우리는 장기 문화에 콜론이 RESP에 항균 펩티드를 표현하는 것으로 나타났다외인성 IL-1β 및 IL-18 온세. 또한, 기관 배양 물에서의 결장 조직에 의해 생성 된 미생물 이펙터 분자가 효율적으로 시험 관내 대장균 죽인다. 이 방법은, 따라서, 장내 선천적 면역 반응과 미생물 숙주 방어 반응을 조절하는 pathogen- 및 위험 - 관련 분자 패턴 및 세포 수용체의 역할을 절개하는 데에 이용 될 수있다.

기관 배양에서 콜론의 대표적인 그림은 그림 1과 같다. 문화의 대장 조각 대사 및 생리 활성 남아있다. 그들은 배지에 첨가 외인성 자극에 효율적으로 반응한다. 생체 외 배양과 외인성 자극 자극, 예를 들어, IL-1β 및 IL-18에 대한 결장 조직의 제조 방법의 개략적 인 작업 흐름은,도 2에 도시되어있다. 기관 배양에서 콜론과 같은 항균 펩티드를 표현하는 그림 3 쇼 대표 데이터 β-디펜 신 2 (BD2), Reg3γ, S100a8, S100a9 및 iNOS의 IL-1β 및 IL-18에 대응한다. 장기 배양 상등액과 함께 배양 된 대장균의 성장 상당히 감소 있듯이 결장 임플란트에 의해 방출 된 매개체는 미생물 사멸 효과를 나타낸다 ( <st룽&gt;)도 4a 및도 4b에 도시한다. 대장균 죽이는 활성은 상기 IL-1β 및 IL-18 (도 4a 및도 4b)의 자극 potentiated된다. 대장균없이 배양 콜론 기관 배양 상층 액은 맥 콘키 배지 (도 4C와 4D)에 문화 다음 어떤 박테리아의 성장을 표시하지 않습니다. 이러한 결과는 상기 inflammasome을가 장내 미생물 숙주 방어에 중요한 역할을한다는 것을 제안한다. 전반적으로, 여기에 제시된 데이터는 생체 대장 기관 문화가 체외에서 장 항균 면역 반응을 연구하는 매우 유용한 기술이다하는 것이 좋습니다. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> GAPDH_F </td><td> TGGCAAAGTGGAGATTGTTGCC </td></tr><tr><td> GAPDH_R </td><td> AAGATGGTGATGGGCTTCCC지 </td></tr><tr><td> 2 (BD2) _F을 β-디펜 신 </td><td> TGACCACTGCCACACCAATG </td></tr><tr><td> 2 (BD2) _R을 β-디펜 신 </td><td> CCTGGCAGAAGGAGGACAAA </td></tr><tr><td> Reg3γ_F </td><td> CAAGGTGAAGTTGCCAAGAA </td></tr><tr><td> Reg3γ_R </td><td> CCTCTGTTGGGTTCATAGCC </td></tr><tr><td> S100a8_F </td><td> TGTCCTCAGTTTGTGCAGAATATAAA </td></tr><tr><td> S100a8_R </td><td> TCACCATCGCAAGGAACTCC </td></tr><tr><td> S100a9_F </td><td> GGTGGAAGCACAGTTGGCA </td></tr><tr><td> S100a9_R </td><td> GTGTCCAGGTCCTCCATGATG </td></tr><tr><td> iNOS_F </td><td> TGTGACACACAGCGCTACAACA </td></tr><tr><td> iNOS_R </td><td> GAAACTATGGAGCACAGCCACAT </td></tr></tbody></table> 표 1 : 실시간 PCR 용 마우스 프라이머의 목록입니다. 그림 1 : 문화의 마우스 대장 조각의 대표적인 사진입니다. 6- 웰 플레이트 상에 배치 된 셀 스트레이너 (100 μm의)의 대장 편 (A) 인큐베이션. 콜론 조각은 항생제로 보충 2 mL의 문화 미디어에 빠져들 수 있습니다. 2 시간 배양 후 (B)는, 대장 편 항생제 배지를 함유하는 새로운 12 웰 세포 배양 플레이트의 웰에 전달된다. <a href="http://ecsource.jove.com/files/ftp_upload/55347/55347fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/55347/55347fig2.jpg" /> 그림 2 : IL-1β 및 IL-18과 대장 조직의 준비 및 생체 자극에 대한 단계의 도식 표현. 하나의 마우스에서 콜론은 longi입니다<html> tudinally 세 부분으로 해부. 각 부분은 작은 조각으로 절단하고 칭량 하였다. 대장의 각 섹션에서 콜론 조각 2 ml의 DMEM / F12 배지 플러스 5 % FBS와 항생제를 포함하는 6 웰 플레이트의 우물에 배치 셀 스트레이너에 전송됩니다. 2 시간 배양 한 후, 단일 셀 스트레이너에서 콜론 조각 12 웰 세포 배양 플레이트의 한 웰에 전송된다. 조직의 중량 (1 mL의 배지 100 mg의 조직을위한)에있어서 DMEM / F12 플러스 5 % FBS (항생제)을 각 웰에 첨가하고, 배지의 부피가 조절된다. 결장 조직을 12 시간 동안 IL-1β (20 ng의 / ml) 및 IL-18 (20 ng의 / ㎖)로 자극한다. 배양 상청액은 원심 분리하여 대장균 사망 분석 및 / 또는 다른 면역 분석에 사용된다. 결장 조직은 RNA 분리 및 실시간 PCR에 의한 항균 유전자 발현의 연속 분석 상용 트립신 시약으로 수집된다..JPG &quot;대상 =&quot;_ 빈 &quot;&gt;이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. <img alt="그림 3" src="/files/ftp_upload/55347/55347fig3.jpg" /> 그림 3 : 마우스 대장 조직을 체외 배양시 IL-1β 또는 IL-18에 대한 응답으로 사이토 카인 및 항균 펩티드를 표현한다. 결장 기관 배양 12 시간 동안 IL-1β (20 ng의 / ㎖) 또는 IL-18 (20 ng의 / ml)로 자극 하였다. BD2, Reg3γ, S100a8, S100a9 및 iNOS의 발현을 실시간 RT-PCR (표 1)에 의해 측정 하였다. 데이터는 SD ± 수단을 나타냅니다; * P &lt;0.05, ** p &lt;0.01. <a href="http://ecsource.jove.com/files/ftp_upload/55347/55347fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 4" src="/files/ftp_upload/55347/55347fig4.jpg" /> 그림 4 : 마우스 콜론 기관 숭배의 상층URE는 살균 작용을 나타낸다. 콜론 조각 12 시간 동안 IL-1β (20 ng의 / ㎖) 또는 IL-18 (20 ng의 / ㎖)의 존재 또는 부재 생체 전 배양 하였다. 배양 상청액 500 μL를 37 ℃에서 1 시간 동안 대장균 (1000 CFU)와 함께 배양 하였다. E. 콜라이없이 결장 기관 배양 상등액은 대조군으로 배양 하였다. 1 시간 배양 한 후, 각 시료 50 μL는 맥 콘키 배지 플레이트 상에 적하하여 넣고, 37 ℃에서 하룻밤 배양 하였다. E.의 (A) 사진 대장 기관 문화의 항균 활성을 나타내는 맥 콘키 배지에 식민지를 대장균. (B) 대장균 수는 IL-1β- 및 IL-18 처리 된 결장 기관 배양 상청 효율을 죽이는 도시. 대장균없이 배양 대장 기관 배양에는 세균의 성장을 보여주는 맥 콘키 배지 플레이트 (C) 사진. (D) 없음 대장균 콜로니 결장 기관 C에서 식별 된ulture 샘플에있는 박테리아 오염의 부재를 나타내는, E. 콜라이 않고 배양 하였다. 데이터는 SD ± 수단을 나타냅니다; ** p &lt;0.01, *** p &lt;0.001. <a href="http://ecsource.jove.com/files/ftp_upload/55347/55347fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies at JoVE.com

The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies

The ex vivo organ culture allows investigation of biological processes in the context of the intact tissue architecture. Here, we introduce a method of ex vivo culture of the mouse colon, which can be used to study innate immunity and antimicrobial host defense in the intestine.

그만큼<em&gt; 전의 VIVO</em항균 호스트 방어 연구에&gt; 콜론 오르간 문화와 그것의 사용

The intestine displays an architecture of repetitive crypt structures consisting of different types of epithelial cells, lamina propia containing immune ...

the-ex-vivo-colon-organ-culture-its-use-antimicrobial-host-defense

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies

13.9K 조회수.  UT Southwestern Medical Center. The ex vivo organ culture allows investigation of biological processes in the context of the intact tissue architecture. Here, we introduce a method of ex vivo culture of the mouse colon, which can be used to study innate immunity and antimicrobial host defense in the intestine. 

비디오: The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies

In vivo Imaging of Transgenic Leishmania Parasites in a Live Host

Distinct species of Leishmania, a protozoan parasite of the family Trypanosomatidae, typically cause different human disease manifestations. The most common forms of disease are visceral leishmaniasis (VL) and cutaneous leishmaniasis (CL). Mouse models of leishmaniasis are widely used, but quantification of parasite burdens during murine disease requires mice to be euthanized at various times after infection. Parasite loads are then measured either by microscopy, limiting dilution assay, or qPCR amplification of parasite DNA. The in vivo imaging system (IVIS) has an integrated software package that allows the detection of a bioluminescent signal associated with cells in living organisms. Both to minimize animal usage and to follow infection longitudinally in individuals, in vivo models for imaging Leishmania spp. causing VL or CL were established. Parasites were engineered to express luciferase, and these were introduced into mice either intradermally or intravenously. Quantitative measurements of the luciferase driving bioluminescence of the transgenic Leishmania parasites within the mouse were made using IVIS. Individual mice can be imaged multiple times during longitudinal studies, allowing us to assess the inter-animal variation in the initial experimental parasite inocula, and to assess the multiplication of parasites in mouse tissues. Parasites are detected with high sensitivity in cutaneous locations. Although it is very likely that the signal (photons/second/parasite) is lower in deeper visceral organs than the skin, but quantitative comparisons of signals in superficial versus deep sites have not been done. It is possible that parasite numbers between body sites cannot be directly compared, although parasite loads in the same tissues can be compared between mice. Examples of one visceralizing species (L. infantum chagasi) and one species causing cutaneous leishmaniasis (L. mexicana) are shown. The IVIS procedure can be used for monitoring and analyzing small animal models of a wide variety of Leishmania species causing the different forms of human leishmaniasis.

In vivo Imaging of Transgenic Leishmania Parasites in a Live Host

An in vivo imaging system is used to generate quantitative measurements of murine infection with the Trypanosomatid protozoan Leishmania. This is a non-invasive and non-lethal method for detecting parasites expressing luciferase within many tissues throughout the course of chronic Leishmania spp. infection.

라이브 호스트에 트렌스 제닉 Leishmania의 기생충의 생체내 이미징에서

Distinct species of Leishmania, a protozoan parasite of the family Trypanosomatidae, typically cause different human disease manifestations. The most ...

연구

면역학 및 감염병학

Use of the EpiAirway Model for Characterizing Long-term Host-pathogen Interactions

Nontypeable Haemophilus influenzae (NTHi) are human-adapted Gram-negative bacteria that can cause recurrent and chronic infections of the respiratory mucosa 1; 2. To study the mechanisms by which these organisms survive on and inside respiratory tissues, a model in which successful long-term co-culture of bacteria and human cells can be performed is required. We use primary human respiratory epithelial tissues raised to the air-liquid interface, the EpiAirway model (MatTek, Ashland, MA). These are non-immortalized, well-differentiated, 3-dimensional tissues that contain tight junctions, ciliated and nonciliated cells, goblet cells that produce mucin, and retain the ability to produce cytokines in response to infection. 
This biologically relevant in vitro model of the human upper airway can be used in a number of ways; the overall goal of this method is to perform long-term co-culture of EpiAirway tissues with NTHi and quantitate cell-associated and internalized bacteria over time. As well, mucin production and the cytokine profile of the infected co-cultures can be determined. This approach improves upon existing methods in that many current protocols use submerged monolayer or Transwell cultures of human cells, which are not capable of supporting bacterial infections over extended periods3. For example, if an organism can replicate in the overlying media, this can result in unacceptable levels of cytotoxicity and loss of host cells, arresting the experiment. The EpiAirway model allows characterization of long-term host-pathogen interactions. Further, since the source for the EpiAirway is normal human tracheo-bronchial cells rather than an immortalized line, each is an excellent representation of actual human upper respiratory tract tissue, both in structure and in function4.
For this method, the EpiAirway tissues are weaned off of anti-microbial and anti-fungal compounds for 2 days prior to delivery, and all procedures are performed under antibiotic-free conditions. This necessitates special considerations, since both bacteria and primary human tissues are used in the same biosafety cabinet, and are co-cultured for extended periods.

This method allows characterization of extended bacterial co-culture with EpiAirways, primary human respiratory epithelial tissue grown at the air-liquid interface, a biologically relevant in vitro model. The approach can be used with any microbe that is amenable to long-term co-culture.

장기 호스트 병원체 상호 작용을 특성화에 대한 EpiAirway 모델의 사용

Nontypeable Haemophilus influenzae  (NTHi) are human-adapted Gram-negative bacteria that can cause recurrent and chronic infections of the respiratory ...

The Ex Vivo Culture and Pattern Recognition Receptor Stimulation of Mouse Intestinal Organoids

Primary intestinal organoids are a valuable model system that has the potential to significantly impact the field of mucosal immunology. However, the complexities of the organoid growth characteristics carry significant caveats for the investigator. Specifically, the growth patterns of each individual organoid are highly variable and create a heterogeneous population of epithelial cells in culture. With such caveats, common tissue culture practices cannot be simply applied to the organoid system due to the complexity of the cellular structure. Counting and plating based solely on cell number, which is common for individually separated cells, such as cell lines, is not a reliable method for organoids unless some normalization technique is applied. Normalizing to total protein content is made complex due to the resident protein matrix. These characteristics in terms of cell number, shape and cell type should be taken into consideration when evaluating secreted contents from the organoid mass. This protocol has been generated to outline a simple procedure to culture and treat small intestinal organoids with microbial pathogens and pathogen associated molecular patterns (PAMPs). It also emphasizes the normalization techniques that should be applied when protein analysis are conducted after such a challenge.

The Ex Vivo Culture and Pattern Recognition Receptor Stimulation of Mouse Intestinal Organoids

Here, a protocol to harvest, maintain, and treat mouse small intestinal organoids with pathogen associated molecular patterns (PAMPs) and Listeria monocytogenes is described, as well as emphasis on gene expression and proper normalization techniques for protein.

그만큼<em&gt; 전의 VIVO</em마우스 소장 Organoids의&gt; 문화 및 패턴 인식 수용체 자극

Primary intestinal organoids are a valuable model system that has the potential to significantly impact the field of mucosal immunology. However, the ...

Human Placental and Decidual Organ Cultures to Study Infections at the Maternal-fetal Interface

The placenta shows a large degree of interspecies anatomic variability. To best understand biology and pathophysiology of the human placenta, it is imperative to design experiments using human cells and tissues. An advantage of organ culture is maintenance of three-dimensional (3D) structural organization and extracellular matrix. The goal of the method described here is successful establishment of ex vivo human gestational tissue organ cultures and their healthy culture maintenance for 72-96 hr. The protocol details the immediate processing of research-consented, placental and decidual specimens fresh from the operating suite. These are abundant specimens that would otherwise be discarded. Detailed instructions on the sterile collection of these samples, including morphologic details on how to select appropriate tissues to establish 3D organ cultures, is provided. Placental villous and decidual tissues are microdissected into 2-3 mm3 pieces and placed separately on matrix-lined transwell filters and cultured for several days. Villous and decidual organ cultures are well suited for the study of human host-pathogen interaction. As compared to other model organisms, these human cultures are particularly advantageous to examine mechanism of infection for pathogens that demonstrate variable patterns of host specificity. As an example, we demonstrate infection of placental and decidual organ cultures with the clinically relevant, facultative intracellular bacterial pathogen Listeria monocytogenes.

A simple method to establish primary human placental (villous) and decidual organ cultures is described. Villous and decidual organ cultures are invaluable tools for studying pathogenesis at the human maternal-fetal interface. Infection with the facultative intracellular bacterium Listeria monocytogenes is demonstrated.

인간의 태반과 탈락 오르간 문화는 산모 - 태아 인터페이스에서 감염을 연구하는

The placenta shows a large degree of interspecies anatomic variability. To best understand biology and pathophysiology of the human placenta, it is ...

Noninvasive Sampling of Mucosal Lining Fluid for the Quantification of In Vivo Upper Airway Immune-mediator Levels

This protocol describes noninvasive sampling of undisturbed upper airway mucosal lining fluid. It also details the extraction procedure used prior to the analysis of immune mediators in fluid eluates for the study of the airway topical immune signature, without the need for stimulation procedures (often used by other techniques). The mucosal lining fluid is sampled on a strip of filter paper placed at the anterior part of the inferior turbinate and left for 2 min of absorption. Analytes are eluted from the filter papers, and the extracted protein-based eluates are analyzed by an electrochemiluminescence-based immunoassay, allowing for the high-sensitivity quantification of low- and high-level analytes in the same sample. We measured the in vivo levels of 20 preselected immune mediators related to specific immune signaling pathways in the upper airway mucosa, but the technique is not limited to that specific panel or sampling site. The technique was first implemented in 7-year-old children from the Copenhagen Prospective Studies on Asthma in Childhood2000 (COPSAC2000) cohort with allergic rhinitis. It was thereafter used in the longitudinal COPSAC2010 birth cohort, sampled at 1 month, 2 years, and 6 years of age and at instances of acute respiratory symptoms. We successfully obtained and analyzed samples from 620 (89%) of 700 1-month-old children; a few samples were below the assay detection limit (reported as the median (Inter-Quartile Range (IQR)). The number of samples below the detection limit (i.e.&#160;from 0 to the set point for the lower limit of detection) for each mediator was 29 (7.25 - 119.5). This technique enables the quantification of the in vivo airway mucosal immune profile from birth, can be applied longitudinally, and can be applied to studies on the effect of genetics and early-life environmental exposures, pathophysiology, endotyping, and monitoring of respiratory diseases, and development and evaluation of novel therapeutics.

Noninvasive Sampling of Mucosal Lining Fluid for the Quantification of In Vivo Upper Airway Immune-mediator Levels

This protocol describes a noninvasive technique for the sampling of undisturbed mucosal lining fluid from the upper airways. It can be used to perform the quantification of in vivo levels of protein mediators, such as cytokines and chemokines, in subjects of all ages.

상부 기도 면역 중재자 수준 Vivo에서 의 정량화에 대 한 점 막 안 대기의 비 침범 성 샘플링

This protocol describes noninvasive sampling of undisturbed upper airway mucosal lining fluid. It also details the extraction procedure used prior to the ...

An Ex Vivo Chicken Primary Bursal-cell Culture Model to Study Infectious Bursal Disease Virus Pathogenesis

Infectious bursal disease virus (IBDV) is a birnavirus of economic importance to the poultry industry. The virus infects B cells, causing morbidity, mortality, and immunosuppression in infected birds. In this study, we describe the isolation of chicken primary bursal cells from the bursa of Fabricius, the culture and infection of the cells with IBDV, and the quantification of viral replication. The addition of chicken CD40 ligand significantly increased cell proliferation fourfold over six days of culture and significantly enhanced cell viability. Two strains of IBDV, a cell-culture adapted strain, D78, and a very virulent strain, UK661, replicated well in the ex vivo cell cultures. This model will be of use in determining how cells respond to IBDV infection and will permit a reduction in the number of infected birds used in IBDV pathogenesis studies. The model can also be expanded to include other viruses and could be applied to different species of birds.

An Ex Vivo Chicken Primary Bursal-cell Culture Model to Study Infectious Bursal Disease Virus Pathogenesis

Here we describe the isolation of chicken primary bursal cells from the bursa of Fabricius, the culture and infection of the cells with infectious bursal disease virus, and the quantification of viral replication.

Bursal 전염병 바이러스 병 인을 공부 하는 Ex Vivo 닭 기본 Bursal 세포 배양 모델

Infectious bursal disease virus (IBDV) is a birnavirus of economic importance to the poultry industry. The virus infects B cells, causing morbidity, ...

Optimization of the Cuff Technique for Murine Heart Transplantation

Murine cardiac transplantation has been performed for more than 40 years. With advancements in microsurgery, certain new techniques have been used to improve surgical efficiency. In our lab, we have optimized the cuff technique with two major steps. First, we used the inner tube technique to insert a temporary inner tube into the external jugular vein and carotid artery blood vessel to facilitate eversion of the vessel over the cuff. Second, we performed complete heterotopic cardiac transplantation through the collaboration of two experienced surgeons. These modifications effectively reduced the operation time to 25 minutes, with a success rate of 95%. In this report, we describe these procedures in detail and provide a supplemental video. We believe that this report on the improved cuff technique will offer practical guidance for murine heterotopic heart transplantation and will enhance the utility of this mouse model for basic research.

We introduce an inner tube approach to the cuff technique for mouse cervical heterotopic heart transplantation to help evert the vessel over the cuff. We found that cooperation between two experienced surgeons markedly shortens the operation time.

뮤린 심장 이식을 위한 커프 기술의 최적화

Murine cardiac transplantation has been performed for more than 40 years. With advancements in microsurgery, certain new techniques have been used to ...

Establishing a Porcine Ex Vivo Cornea Model for Studying Drug Treatments against Bacterial Keratitis

When developing novel antimicrobials, the success of animal trials is dependent on accurate extrapolation of antimicrobial efficacy from in vitro tests to animal infections in vivo. The existing in vitro tests typically overestimate antimicrobial efficacy as the presence of host tissue as a diffusion barrier is not accounted for. To overcome this bottleneck, we have developed an ex vivo porcine corneal model of bacterial keratitis using Pseudomonas aeruginosa as a prototypic organism. This article describes the preparation of the porcine cornea and protocol for establishment of the infection. Bespoke glass molds enable straightforward setup of the cornea for infection studies. The model mimics in vivo infection as bacterial proliferation is dependent on the ability of the bacterium to damage corneal tissue. Establishment of infection is verified as an increase in the number of colony forming units assessed via viable plate counts. The results demonstrate that infection can be established in a highly reproducible fashion in the ex vivo corneas using the method described here. The model can be extended in the future to mimic keratitis caused by microorganisms other than P. aeruginosa. The ultimate aim of the model is to investigate the effect of antimicrobial chemotherapy on the progress of bacterial infection in a scenario more representative of in vivo infections. In so doing, the model described here will reduce the use of animals for testing, improve success rates in clinical trials and ultimately enable rapid translation of novel antimicrobials to the clinic.

This article describes a step-by-step protocol to set up an ex vivo porcine model of bacterial keratitis. Pseudomonas aeruginosa is used as a prototypic organism. This innovative model mimics in vivo infection as bacterial proliferation is dependent on the ability of the bacterium to damage corneal tissue.

세균성 각막염에 대하여 약 처리를 공부하기 위한 돼지 Ex Vivo Cornea 모형 을 설치합니다

When developing novel antimicrobials, the success of animal trials is dependent on accurate extrapolation of antimicrobial efficacy from in vitro tests to ...

An Ex vivo Assay to Study Candida albicans Hyphal Morphogenesis in the Gastrointestinal Tract

Candida albicans hyphal morphogenesis in the gastrointestinal (GI) tract is tightly controlled by various environmental signals, and plays an important role in the dissemination and pathogenesis of this opportunistic fungal pathogen. However, methods to visualize fungal hyphae in the GI tract in vivo are challenging which limits the understanding of environmental signals in controlling this morphogenesis process. The protocol described here demonstrates a novel ex vivo method for visualization of hyphal morphogenesis in gut homogenate extracts. Using an ex vivo assay, this study demonstrates that cecal contents from antibiotic treated mice, but not from untreated control mice, promote C. albicans hyphal morphogenesis in the gut content. Further, adding back specific groups of gut metabolites to the cecal contents from antibiotic-treated mice differentially regulates hyphal morphogenesis ex vivo. Taken together, this protocol represents a novel method to identify and investigate the environmental signals that control C. albicans hyphal morphogenesis in the GI tract.

An Ex vivo Assay to Study Candida albicans Hyphal Morphogenesis in the Gastrointestinal Tract

The ex vivo assay described in this study using gut homogenate extracts and immunofluorescence staining represents a novel method to examine the hyphal morphogenesis of Candida albicans in the GI tract. This method can be utilized to investigate the environmental signals regulating morphogenetic transition in the gut.

칸디다 알비칸스 위장관에서 최면 모포 발생을 연구하는 Ex vivo 분석

Candida albicans hyphal morphogenesis in the gastrointestinal (GI) tract is tightly controlled by various environmental signals, and plays an important ...

Antibiotic Efficacy Testing in an Ex vivo Model of Pseudomonas aeruginosa and Staphylococcus aureus Biofilms in the Cystic Fibrosis Lung

The effective prescription of antibiotics for the bacterial biofilms present within the lungs of individuals with cystic fibrosis (CF) is limited by a poor correlation between antibiotic susceptibility testing (AST) results using standard diagnostic methods (e.g., broth microdilution, disk diffusion, or Etest) and clinical outcomes after antibiotic treatment. Attempts to improve AST by the use of off-the-shelf biofilm growth platforms show little improvement in results. The limited ability of in vitro biofilm systems to mimic the physicochemical environment of the CF lung and, therefore bacterial physiology and biofilm architecture, also acts as a brake on the discovery of novel therapies for CF infection. Here, we present a protocol to perform AST of CF pathogens grown as mature, in vivo-like biofilms in an ex vivo CF lung model comprised of pig bronchiolar tissue and synthetic CF sputum (ex vivo&#160;pig lung, EVPL).
Several in vitro&#160;assays exist for biofilm susceptibility testing, using either standard laboratory medium or various formulations of synthetic CF sputum in microtiter plates. Both growth medium and biofilm substrate (polystyrene plate vs. bronchiolar tissue) are likely to affect biofilm antibiotic tolerance. We show enhanced tolerance of clinical Pseudomonas aeruginosa and Staphylococcus aureus isolates in the ex vivo model; the effects of antibiotic treatment of biofilms is not correlated with the minimum inhibitory concentration (MIC) in standard microdilution assays or a sensitive/resistant classification in disk diffusion assays.
The ex vivo platform could be used for bespoke biofilm AST of patient samples and as an enhanced testing platform for potential antibiofilm agents during pharmaceutical research and development. Improving the prescription or acceleration of antibiofilm drug discovery through the use of more in vivo-like testing platforms could drastically improve health outcomes for individuals with CF, as well as reduce the costs of clinical treatment and discovery research.

Antibiotic Efficacy Testing in an Ex vivo Model of Pseudomonas aeruginosa and Staphylococcus aureus Biofilms in the Cystic Fibrosis Lung

This workflow can be used to perform antibiotic susceptibility testing using an established&#160;ex vivo model of bacterial biofilm in the lungs of individuals with cystic fibrosis. Use of this model could enhance the clinical validity of MBEC (minimal biofilm eradication concentration) assays.

낭포성 섬유증 폐에 있는 슈도모나스 아에루기노사 및 황색포도상구균 생물막의 Ex vivo 모형에 있는 항생제 효능 시험

The effective prescription of antibiotics for the bacterial biofilms present within the lungs of individuals with cystic fibrosis (CF) is limited by a ...

그만큼

요약

더 많은 비디오 탐색

이 비디오의 챕터