Research in Ansari lab was supported by the research grant (No. MCB 1020911) from National Science Foundation.

참고 :이 방법은 Medler, S 및 안사리, A. 2에보고 된 연구 문서에서 사용되었다. 1. 배양 및 수확 세포 <ol><li> 갓 줄무늬 사카로 마이 세스 세레 비지 판에서 YPD 배지 (10g / L의 효모 추출물, 20g / L 펩톤, 2 % 덱 스트로스)에있는 세포의 5 mL의 문화를 시작합니다. </li><li> 30 ° C, 250 rpm으로 궤도 통에 하룻밤 세포를 성장. </li><li> 250 ㎖의 배플 플라스크 내의 성장 밤새 배양을 YPD 배지 100 ㎖의 최종 부피는 100 배 희석. 참고 : 문화 100 ㎖의 총 TRO 반응에 따라 필요합니다; 여러 반응이 필요한 경우에, 배양의 더 큰 부피를 사용해야한다. </li><li> 0.8의 광학 밀도로 세포를 성장 - 1.0 600 nm에서 (A (600) ~ 0.8 - 1.0). </li><li> 멸균 50 ML 원뿔 튜브에 4 ° C에서 5 분 동안 820 XG에서 원심 분리하여 세포를 수확. </li><li> 차가운 얼음 TMN의 BU 10ml에 세포를 재현 탁ffer (10 mM 트리스 - 염산 pH를 7.5, 5 밀리미터의 MgCl 2, 100 mM의 염화나트륨)과 5 분 동안 얼음 위에서 배양한다. </li><li> 4 ° C에서 5 분 동안 820 XG에 원심 분리기 세포 펠렛합니다. 조심스럽게 흡인에 의해 뜨는을 제거합니다. </li></ol> 분석 실행 기능 2. Permeabilizing 및 준비 세포 <ol><li> 로 pipetting 아래로 부드럽게 절단 된 P 1000 팁을 사용하여 0.6 %의 sarkosyl 용액 1 ㎖의 세포를 재현 탁. 냉장 1.5 ML의 microcentrifuge 관에 세포 현탁액을 전송합니다. </li><li> 플랫폼 통에 25 분 동안 4 ° C에서 부드럽게 세포를 흔들어. 주 : 마이크로 원심 튜브는이 단계에서 발생하는 프로모터에서 새로운 개시 이벤트의 가능성을 피하기 위해, 차가운 온도를 유지하기 위해 얼음과 50 ㎖ 원뿔형 튜브에 충전한다. </li><li> 탁상 냉장 원심 분리기를 사용하여 4 ° C에서 6 분 동안 1,200 XG에서 세포를 원심 분리기. </li><li> 조심스럽게 당에서 초과 액체를 제거하기 위해 뜨는을 대기음meabilized 세포 펠렛. </li></ol> 3. 전사 런타임에 반응 <ol><li> 전사의 150 μL를 추가 실행에 버퍼 (50 mM 트리스 - 염산의 pH 7.5, 100 mM의 KCl을 10 mM의의 MgCl 2, 2 mM의 DTT (디티 오 트레이 톨), 0.75 mM의 ATP, CTP, GTP, 및 BrUTP, 200 U의 RNase 각 투과성이 세포 펠렛에 억제제). </li><li> 최대 피펫 팅에 의해 잘린 P 200 팁을 사용하여 아래로 부드럽게 섞는다. 참고 : 여러 샘플을 처리하는 경우, 모든 샘플이 준비가 될 때까지 얼음에 모든 것을 유지하고 다음 단계로 진행합니다. </li><li> 수욕에서 30 ℃에서 5 분 동안 인큐베이션. 참고 : 초기 RNA에 BrUTP의 최적의 통합을 보장하기 위해 1 ~ 5 분 사이의 배양 시간을 조정합니다. </li><li> 냉간 즉시 사용 RNA 분리 시약 500 μL를 첨가하여 반응을 정지. 실온에서 5 분 동안 인큐베이션. </li></ol> 4. RNA 추출 <ol><li> 셀 suspensi에 산 세척 유리 구슬 200 μL를 추가(34 단계)와, 볼텍스 믹서에 4 ° C에서 20 분 동안 격렬하게 진탕에. </li><li> 핫 22 G 바늘을 사용 microcentrifuge 관의 바닥에 구멍 및 15 mL의 멸균 원뿔 관의 상단에 배치. </li><li> 4 ° C에서 1 분 300 XG에 원심 분리기는 세포 용 해물을 수집합니다. 1.5 ML의 microcentrifuge 튜브에 세포 용 해물을 전송. </li><li> 차가운 RNA 분리 시약 500 μL와 세포 용 해물을 클로로포름 200 μL를 추가한다. 4 ° C에서 20 분 동안 16,168 XG에 소용돌이 믹서 및 원심 분리기에 대한 내용을 섞는다. </li><li> 새로운 microcentrifuge 관에 위 수성 위상을 전송합니다. </li><li> pH를 4-5 이소 아밀 알코올 / (: 24 1 125) 차가운 페놀 / 클로로포름의 동일한 볼륨을 추가합니다. 4 ℃에서 15 분 동안 16,168 XG에 소용돌이 믹서 및 원심 분리기에 적극적으로 흔들어. </li><li> 새로운 microcentrifuge 관에 위 수성 상을 포함하는 RNA를 전송합니다. 단계를 반복 4.6 두 번 더. </li><li> 최종 RNA 함유하는 수성 상에 5 M의 NaCl를 추가 STOCM. 0.3의 최종 농도는 RNA를 침전을 3 회 냉 에탄올의 양을 추가 얻을 케이. <ol><li> 1 시간 동안 또는 밤새 -20 ℃에서 인큐베이션. 참고 : - 안티 BrdU의 비드 (단계 5.3 참조) 차단 배양되는 동안 4.11 단계 4.9을 수행합니다. </li></ol></li><li> 4 ℃에서 20 분 동안 16,168 XG에 원심 분리기. 상층 액을 제거하고 DEPC (디 에틸 피로 카보) 물 100 μL의 RNA 펠렛을 재현 탁. </li><li> 통합되지 않은 BrUTP 뉴클레오티드에서 RNA를 분리하는 RNA 분리 미니 키트를 사용합니다. 의 RNase가없는 물 100 μL로 열로부터 RNA를 용출시킨다. </li><li> 5 분 동안 65 ° C의 물을 용기에 RNA를 부화 한 후, 적어도 2 분 동안 얼음으로 옮긴다. </li></ol> BrUTP 표지 RNA 5. 선호도 정화 <ol><li> 25 μL에 안티 BrdU의 추가, 구슬 해결 500 0.25 배씩 SSPE (나트륨 염 인산 EDTA) 결합 버퍼 (20 배 SSPE의 μL : 3 M의 NaCl, 0.2 M의 NaH 2 PO 4 </sub&gt; 0.02 M EDTA, pH 7.4의 1 mM의 EDTA, 0.05 % 트윈 (Tween), 37.5 mM의 염화나트륨). 4 ° C에서 30 초 동안 200 XG에 원심 분리기와 뜨는을 제거합니다. </li><li> 단계를 반복 5.1 세 번. </li><li> 구슬 (1 mg의 울트라 순수 소 혈청 알부민 (BSA) 버퍼, 0.1 %의 폴리 비닐 피 롤리 돈, 1 배 결합) 버퍼를 차단의 500 μL를 추가하고 부드럽게 1 흔들어 - 플랫폼 흔드는에 4 ° C에서 2 시간. </li><li> 단계 5.1에 기술 된 바와 같이, 결합 완충액 500 μL로 구슬을 두 번 더 씻는다. </li><li> 구슬에 버퍼를 바인딩의 400 μL를 추가합니다. </li><li> 구슬에 직접 (단계 4.11)에서 RNA의 100 μL를 전송합니다. 플랫폼 흔드는에 4 ° C에서 2 시간 - 부드러운가 1 진탕 품어. </li><li> 결합 완충액 500 μL, 낮은 소금 버퍼 500 μL (0.2 배씩 SSPE, 1 mM의 EDTA, 0.05 % 트윈), 높은 소금 버퍼 500 μL (0.25 배씩 SSPE, 1 mM의 EDTA, 0.05 % 트윈와 구슬 순차적으로 세척, 100 mM의 염화나트륨), 회 TET 완충액 500 μL (1X TE, 0.05 % 트윈)에서 회전하는각 세척 사이에 4 ° C에서 30 초 동안 200 XG. </li><li> 150 μL로 두 번 순차적으로 비드의 BrUTP 표지 된 RNA를 용출 번 용출 완충액 (20 mM의 DTT, 150 mM의 염화나트륨, 50mM 트리스 - 염산 pH를 7.5, 1 mM의 EDTA, 0.1 % SDS) 200 μL와 함께 배양하여 상층 액에서 구슬을 분리 짧은 스핀 다음 수욕에서 42 ° C에서 4 분. </li></ol> BrUTP 레이블 RNA의 6 강수량 <ol><li> 이소 아밀 알코올 / 차가운 페놀 / 클로로포름 500 μL를 추가 (: 24 : 125 1) pH가 4-5을 BrUTP 정제 선호도로는 RNA를 표시. 4 ° C에서 15 분 동안 16,168 XG에 소용돌이 믹서 및 원심 분리기에 섞는다. </li><li> 새로운 microcentrifuge 관에 위 수성 위상을 전송합니다. </li><li> RNA의 침전을 냉 에탄올, 0.3 M의 3 배 부피의 최종 농도를 얻기 위해 5 M NaCl을 주식을 추가한다. </li><li> -20 ° C에서 밤새 품어. </li><li> 4 ° C에서 30 분 동안 16,168 XG에서 원심 분리하여 침전 된 RNA를 수집합니다. &lt;/ 리&gt; <li> 상층 액을 제거하고 10 분 동안 공기 건조에 펠렛을 할 수 있습니다. </li><li> DEPC 물 26 μL의 RNA 펠렛을 재현 탁. </li><li> 분광 광도계를 사용하여 260 nm에서 흡광도를 측정하여 최종 RNA 농도를 결정한다. 또한, 280 분의 260 비율을 결정합니다. 비율 ~ 2 순수 RNA 시료를 나타낸다. </li><li> cDNA 합성에 필요한 때까지 -80 ° C에서 분취 량의 RNA 샘플을 저장합니다. </li></ol> BrUTP 표지 RNA의 7 역전사 <ol><li> 100 NG에 RNA 농도를 조정 / μL은 DEPC 물을 사용. 각 cDNA 합성 반응에 RNA 0.5 μg의를 사용합니다. 참고 : RNA 템플릿의 농도는 최적의 cDNA 합성을 달성하기 위해 0.5 ~ 1.0 μg의 다를 수 있습니다. </li><li> 도 3a에 도시 된 바와 같이 하류 폴리 (A)에 위치 (종료 위치)의 여러 설계 역방향 프라이머를 이용하여 RNA를 역 전사. </li><li> 각각 역전사 반응, RNA의 templat 5 μL를 추가E (0.5 μg의), 1 μL의의 dNTP 믹스 (10 mM의 각), 역방향 프라이머 C, D, E, F 또는 G 2 μL (50 μM 각) 및 클레아 자유 수 (도 3a 참조). 각 튜브의 최종 반응 부피가 13 μL이다. 주 : 역전사 반응의 수는 cDNA 합성에 사용되는 역방향 프라이머의 수에 의존 할 것이다. 예를 들어, ASC1 다섯 역방향 프라이머를 사용 하였다 따라서 오 역전사 반응을 설정 하였다. cDNA 합성에 사용되는 역방향 프라이머를 기초 C, D, E, F 및 G로 튜브 라벨. </li><li> 어떤 차 구조 형태를 제거하는 5 분 동안 65 ° C에서 열 순환기에 RNA 템플릿의 dNTP 믹스와 프라이머를 포함하는 튜브를 품어, 적어도 2 분 동안 4 ° C에 다음 차가운. </li><li> 1 μL는 효소 (200 U / μL)를 역 추가, 4 μL는 버퍼와 RNA 템플릿과 프라이머를 포함하는 각각의 튜브에 0.1 M DTT의 2 μL (7.4 단계). 위아래로 부드럽게 피펫 팅에 의해 섞는다. </li><li> 60 분 동안 42 ℃에서 열 순환기에서 반응 혼합물을 배양하여 역전사 반응을 수행한다. </li><li> 20 분 동안 65 ℃에서 역전사 효소를 불 활성화. </li><li> -20 ° C에서의 cDNA를 저장하거나 다음 단계로 진행합니다. </li></ol> cDNA를 8. 증폭 <ol><li> 단계 7.8, 1.0 μL 포워드 프라이머 B (10 μM), 1.0 μL의 3.0 μL의 cDNA 주형을 다음과 같이 단계 7.8에서 (ASC1위한 C, D, E, F 및 G 표시) 각각의 cDNA 제제의 증폭을위한 PCR 반응을 수행 역방향 프라이머 C 또는 D 또는 E 또는 F 또는 G (10 μM), 2.5 μL 10 배 중합 효소 PCR 버퍼, 0.5 μL의의 dNTP 믹스 (10 mM의 각), 1.0 μL의 MgCl 2 (2.5 mM)을 15.5 μL PCR 등급 물, 0.5 μL 열 안정성 중합 효소. 참고 : 5 1 : 1까지의 cDNA 템플릿의 다른 희석 (100)는 PCR 제품 수율을 최적화하기 위해 테스트해야합니다. 단일 프로모터 근위 정방향 프라이머는 cDNA를 증폭하기 위해 사용될다른 역방향 프라이머를 이용하여 얻어진. 예를 들어, 프로모터 근처에 위치한 하나의 전방 프라이머 B는 G에 대한 ASC1 C에서 5 역방향 프라이머와 조합하여 사용 하였다. BC는, BD는,도 3a에 도시 된 바와 같이, BF와 BG는 각각 C, D, E, F 및 G로 표시 튜브에 사용하여, 될 수있다. </li><li> 다음 열 사이클링 매개 변수를 사용하여 PCR을 실행하여 1주기를 2 분 동안 95 ° C (중합 효소의 활성화를위한 핫 스타트), 30-40 사이클 30 초 (변성), 15 초 동안 54 ° C 95 ° C (어닐링) 1 분 (연장), 1 사이클 5 분 동안 68 ° C (최종 확장) 68 ° C. 주 : 소둔 온도는 사용되는 특정 프라이머에 따라 달라질 것이며, 연기 시간이 예상되는 제품의 크기에 따라 달라진다. </li><li> 0.8 %, 1.5 %, 또는 제품의 예상 크기에 따라 2 % 아가로 오스 겔 전기 영동에 의해 PCR 생성물을 분리한다. </li><li> 엘 Kaderi 동부 등의 설명에 따라 PCR 생성물을 정량화. (20)12 11. 참고 : 다른 방법으로, 초기 성적의 양을 정량 실시간 RT-qPCR에 전략을 사용합니다. </li></ol>

<ol>
	<li>Birse, C. E., Minvielle-Sebastia, L., Lee, B. A., Keller, W., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coupling+termination+of+transcription+to+messenger+RNA+maturation+in+yeast.">Coupling termination of transcription to messenger RNA maturation in yeast.</a> Science. 280 (5361), 298-301 (1998).</li><li>Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+looping+facilitates+TFIIH+kinase-mediated+termination+of+transcription.">Gene looping facilitates TFIIH kinase-mediated termination of transcription.</a> Sci Rep. 5, 12586 (2015).</li><li>Richard, P., Manley, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+by+nuclear+RNA+polymerases.">Transcription termination by nuclear RNA polymerases.</a> Genes Dev. 23 (11), 1247-1269 (2009).</li><li>Mischo, H. E., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disengaging+polymerase:+terminating+RNA+polymerase+II+transcription+in+budding+yeast.">Disengaging polymerase: terminating RNA polymerase II transcription in budding yeast.</a> Biochim Biophys Acta. 1829 (1), 174-185 (2013).</li><li>Porrua, O., Libri, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+and+the+control+of+the+transcriptome:+why,+where+and+how+to+stop.">Transcription termination and the control of the transcriptome: why, where and how to stop.</a> Nat Rev Mol Cell Biol. 16 (3), 190-202 (2015).</li><li>Jacquier, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complex+eukaryotic+transcriptome:+unexpected+pervasive+transcription+and+novel+small+RNAs.">The complex eukaryotic transcriptome: unexpected pervasive transcription and novel small RNAs.</a> Nat Rev Genet. 10 (12), 833-844 (2009).</li><li>Xu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bidirectional+promoters+generate+pervasive+transcription+in+yeast.">Bidirectional promoters generate pervasive transcription in yeast.</a> Nature. 457 (7232), 1033-1037 (2009).</li><li>Neil, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+bidirectional+promoters+are+the+major+source+of+cryptic+transcripts+in+yeast.">Widespread bidirectional promoters are the major source of cryptic transcripts in yeast.</a> Nature. 457 (7232), 1038-1042 (2009).</li><li>Clark, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+reality+of+pervasive+transcription.">The reality of pervasive transcription.</a> PLoS Biol. 9 (7), e1000625 (2011).</li><li>Goodman, A. J., Daugharthy, E. R., Kim, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pervasive+antisense+transcription+is+evolutionarily+conserved+in+budding+yeast.">Pervasive antisense transcription is evolutionarily conserved in budding yeast.</a> Mol Biol Evol. 30 (2), 409-421 (2013).</li><li>El Kaderi, B., Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+interactions+between+genomic+loci+through+Chromosome+Conformation+Capture+(3C).">Analysis of interactions between genomic loci through Chromosome Conformation Capture (3C).</a> Curr Protoc Cell Biol. Chapter 22, Unit22 15 (2012).</li><li>Core, L. J., Waterfall, J. J., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nascent+RNA+sequencing+reveals+widespread+pausing+and+divergent+initiation+at+human+promoters.">Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters.</a> Science. 322 (5909), 1845-1848 (2008).</li></ol>

The authors have nothing to disclose.

여기서 사용 가닥 특이 TRO 프로토콜은 포유 동물 세포에서 12 GRO-SEQ (글로벌 도망 시퀀싱) 분석을 위해 사용 된 프로토콜에서 적응시켰다. 우리는 성공적으로 효모 신진에서 초기 전사를 연구하는 프로토콜을 수정했습니다. 특히 전사 종결 결함을 분석하기 위해, 우리는 RNA 가수 분해 공정 치우는하여 상기 프로토콜을 조정했다. 이것은 우리가 특히 프로모터 영역 근처의 전사 개...

진핵 전사 사이클은 세 가지 주요 단계로 구성; 개시, 신장 및 종료. RNA 중합 효소 II에 의한 전사의 종료는 두 가지, 상호 의존적 인 3 단계로 구성되어 있습니다. 첫 번째 단계는 템플릿에서 분열, 및 폴리아 데 닐화 mRNA를 분리를 포함하고, 바로 템플릿 폴리머의 결합 해제에 의해 표시된 두번째 단계로 이어진다. 적절한 종료와 RNA (4, 5)를 비 - 코딩 전반의 전사를 제한함으로써 점검 비정상적인 전사를 유지하는 하류 유전자의 전사와 간섭을 방지하기 위해, 전사 개시 / 재개시하는 동안 폴리머의 재활용을 위해 중요하다. 최근의 진보에도 불구하고, 종료는 RNA 중합 효소 II 전사주기까지 상기 단계에 의해 이해된다. 안정적인 종단 분석은 메커니즘 underlyin 연구를위한 필수적이다생체 내에서 RNA 중합 효소 II에 의한 전사의 g 종료. 실험적인 접근 방법은 생리 조건 하에서 활발히 유전자 전사 종결 결함을 검출하기 위해 사용된다. 이 북부 오 점, 종료 인자 칩 (염색질 면역 침전) 및 기존의 TRO 분석을 포함한다. 이들 기술은 각각 장단점을 갖는다. 사용되는 전통적인 TRO 분석은 생체 내 1에서 전사 종결 결함의 검출을위한 가장 신뢰할 수 있고 중요한 방법이 될 수 있습니다. 이 분석은 세포 내부 유전자의 상이한 영역의 전사적 활성 폴리머 분자 편재. 정상적인 조건에서 분석은 엄격히 유전자 (그림 1A)의 프로모터와 터미네이터 영역 사이에 분산 된 전사적으로 참여 중합 효소 분자를 보여줍니다. 결함 종료시 그러나, 폴리머는 종료 신호를 판독 할 수없는상기 유전자 (도 1b)의 3 &#39;말단의 하류 영역에서 검출된다. 전사 종결 결함이 프로모터 근위 영역으로부터 시작된 센스 속기 폴리머의 존재 하에서 적하하고, 종료 신호를 읽을 수 되,도에 도시 된 바와 같이, 유전자의 3 &#39;말단의 하류 영역을 전사 계속 2A. 진핵 게놈 및 유전자 6, 7, 8, 9, 약 10 압도적 보급 점에서 전사뿐만 아니라 안티센스 방향을 나타낸다 실현으로 곧 전통적인 TRO 분석 검출 할 수없는 것은 명백되었다 폴리머 IF 신호 유전자의 하류는 프로모터 시작 성적 증명서 (그림 2A) 또는 솜을 시작 탈선 RNA를 나타냅니다유전자 또는 종단 요소 (도 2b) 또는 유전자 (도 2c)의 3 &#39;말단에서 안티센스 방향의 폴리머 속기 하류의 중간 ewhere. 관찰 readthrough 중합 효소 신호가 프로모터 시작 확장 된 감각의 mRNA 또는 시험에서 유전자의 하류를 시작 안티 센스 성적표를 나타내는 경우 사용 BrUTP는 여기에 설명 된 가닥 특정 TRO 분석은 구별 할 수 있습니다. 우리는 성공적으로 효모 2 신진에서 전사 종료에 Kin28 키나제의 역할을 보여주기 위해이 방법을 사용하고 있습니다. 여기에 방법을 사용하는 우리는 같은 단백질이 효모 신진에서 ASC1의 전사의 종료를 위해 필요하다는 것을 보여준다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Phenol -chloroform-isoamyl alcohol mixture</td>
			<td>Sigma-Aldrich</td>
			<td>77619</td>
			<td>pH 4-5</td>
		</tr>
		<tr>
			<td>TRIzol reagent</td>
			<td>Life technologies</td>
			<td>15596-026</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase Inhibitor, human placenta</td>
			<td>New England Biolabs</td>
			<td>M0307S</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-BrdU beads</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-32323AC</td>
			<td></td>
		</tr>
		<tr>
			<td>Protoscript II</td>
			<td>New England Biolabs</td>
			<td>M03368L</td>
			<td>or an equivalent enzyme</td>
		</tr>
		<tr>
			<td>Advantage 2 polymerase Mix</td>
			<td>Clontech</td>
			<td>639201</td>
			<td>or an equivalent enzyme</td>
		</tr>
		<tr>
			<td>5-Bromouridine 5&#39; triphosphate sodium salt</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-214314A</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>ATP</td>
			<td>New England Biolabs</td>
			<td>N0451AA</td>
			<td></td>
		</tr>
		<tr>
			<td>CTP</td>
			<td></td>
			<td>N0454AA</td>
			<td></td>
		</tr>
		<tr>
			<td>GTP</td>
			<td></td>
			<td>N0452AA</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra-pure bovine serum albumin (BSA)</td>
			<td>MC Labs</td>
			<td>UBSA-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Asc1 B</td>
			<td></td>
			<td></td>
			<td>AGATTCGTCGGTCACAAGTCC</td>
		</tr>
		<tr>
			<td>Asc1 C</td>
			<td></td>
			<td></td>
			<td>GAACTTTATACATATTCTTAGTT 
			AGCAGTC</td>
		</tr>
		<tr>
			<td>Asc1 D</td>
			<td></td>
			<td></td>
			<td>TGTACATATGTATTTTCGCAGCA</td>
		</tr>
		<tr>
			<td>Asc1 E</td>
			<td></td>
			<td></td>
			<td>GCCAAGGAGACTGAATTTAATG</td>
		</tr>
		<tr>
			<td>Asc1 F</td>
			<td></td>
			<td></td>
			<td>CTATGGAATGGGGGTTTTAAG</td>
		</tr>
		<tr>
			<td>Asc1 G</td>
			<td></td>
			<td></td>
			<td>GGTTATGGCAGACATGCCAC</td>
		</tr>
		<tr>
			<td>5s cDNA</td>
			<td></td>
			<td></td>
			<td>AGATTGCAGCACCTGAGT</td>
		</tr>
		<tr>
			<td>5&#8217; 5s reverse</td>
			<td></td>
			<td></td>
			<td>GGTTGCGGCCATATCTAC</td>
		</tr>
		<tr>
			<td>3&#8217; 5s reverse</td>
			<td></td>
			<td></td>
			<td>TGAGTTTCGCGTATGGTC</td>
		</tr>
	</tbody>
</table>

analysis of termination of transcription using brutp-strand-specific transcription run-on (tro) approach

이 원고는 생체 내에서 전사 종결 결함을 검출하는 프로토콜을 설명한다. 사용 BrUTP 여기서 설명한 가닥 특이 TRO 프로토콜은 생리 학적 조건 하에서 전사 종결 결함 분석을위한 강력한 실험 방법이다. 전통적인 TRO 분석 마찬가지로 전사 종결 결함 하나의 지표로서 유전자의 3 &#39;말단을 넘어 전사적 활성 폴리머의 존재에 의존한다. 그것은 기존의 TRO 분석으로 발생하는 두 가지 주요 문제를 극복한다. 첫째, 종료 신호를 통해 판독 효소가 프로모터 근위 부위에서 전사를 개시 한 경우, 검출 또는 수 단순히 어딘가에 본문에서 비특이적 개시된 pervasively 전사 효소 또는 3 &#39;을 나타내는 경우 유전자의 끝. 둘째, 구별 할 수 있습니다 경우 넘어 전사적으로 활성 효소 신호터미네이터 영역은 진정으로 readthrough 감지 mRNA의 전사 중합 효소 또는 터미네이터 시작 비 코딩 안티센스 RNA 신호이다. 간략하게, 프로토콜, 기하 급수적으로 성장하는 효모 세포 permeabilizing 친화 방식으로 BrUTP 표지 RNA 정제의 BrUTP 염기의 존재 하에서 신장 생체 내에서 개시 사체 허용 수반 정제 초기 RNA를 전사하고 cDNA를 증폭하여 역방향 프로모터와 유전자 (2)의 종결 영역을 플 랭킹 가닥 특이 적 프라이머.

전사 종결 결함을 검출에 BrUTP 가닥 특정 TRO 절차의 적용을 설명하기 위해, 우리는 같은 단백질의 종료 불량, 온도에 민감한 돌연변이가 rna14-1라고 사용. RNA 중합 효소 II에 의한 전사 종료에 같은 단백질의 역할은 선택된 유전자 1 터미네이터 - 인접 지역에서 RNA를 검출 기존의 TRO 분석을 이용하여 증명되었다. 비 - 허용 온도에서 rna14-1...

Watch this Scientific Journal Video about Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach at JoVE.com

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes.

BrUTP 가닥 특정 전사 런타임에 (TRO) 접근 방식을 사용하여 전사의 종료의 분석

This manuscript describes a protocol for detecting transcription termination defect in vivo. The strand-specific TRO protocol using BrUTP described here ...

analysis-termination-transcription-using-brutp-strand-specific

Research

JoVE Journal

Genetics

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on (TRO) Approach

9.7K 조회수.  Wayne State University. We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes. 

비디오: Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

In Vitro Transcription Assays and Their Application in Drug Discovery

In vitro transcription assays have been developed and widely used for many years to study the molecular mechanisms involved in transcription. This process requires multi-subunit DNA-dependent RNA polymerase (RNAP) and a series of transcription factors that act to modulate the activity of RNAP during gene expression. Sequencing gel electrophoresis of radiolabeled transcripts is used to provide detailed mechanistic information on how transcription proceeds and what parameters can affect it. In this paper we describe the protocol to study how the essential elongation factor NusA regulates transcriptional pausing, as well as a method to identify an antibacterial agent targeting transcription initiation through inhibition of RNAP holoenzyme formation. These methods can be used a as platform for the development of additional approaches to explore the mechanism of action of the transcription factors which still remain unclear, as well as new antibacterial agents targeting transcription which is an underutilized drug target in antibiotic research and development.

In Vitro Transcription Assays and Their Application in Drug Discovery

In this manuscript, we describe a protocol to functionally examine transcription and the inhibitory activity of antibacterial agents targeting bacterial transcription.

시험 관내 전사 분석 실험 및 약물 발견에의 응용

In vitro transcription assays have been developed and widely used for many years to study the molecular mechanisms involved in transcription. This process ...

연구

유전학

Metagenomic Analysis of Silage

Metagenomics is defined as the direct analysis of deoxyribonucleic acid (DNA) purified from environmental samples and enables taxonomic identification of the microbial communities present within them. Two main metagenomic approaches exist; sequencing the 16S rRNA gene coding region, which exhibits sufficient variation between taxa for identification, and shotgun sequencing, in which genomes of the organisms that are present in the sample are analyzed and ascribed to "operational taxonomic units"; species, genera or families depending on the extent of sequencing coverage. 
In this study, shotgun sequencing was used to analyze the microbial community present in cattle silage and, coupled with a range of bioinformatics tools to quality check and filter the DNA sequence reads, perform taxonomic classification of the microbial populations present within the sampled silage, and achieve functional annotation of the sequences. These methods were employed to identify potentially harmful bacteria that existed within the silage, an indication of silage spoilage. If spoiled silage is not remediated, then upon ingestion it could be potentially fatal to the livestock.

Metagenomics was used to investigate the microbiome of silage cattle feed. Analysis was performed by shotgun sequencing. This approach was used to characterize the composition of the microbial community within the cattle feed.

목초의 군 유전체학 분석

Metagenomics is defined as the direct analysis of deoxyribonucleic acid (DNA) purified from environmental samples and enables taxonomic identification of ...

Analysis of the Ambient Particulate Matter-induced Chromosomal Aberrations Using an In Vitro System

Exposure to particulate matter (PM) is a major world health concern, which may damage various cellular components, including the nuclear genetic material. To assess the impact of PM on nuclear genetic integrity, structural chromosomal aberrations are scored in the metaphase spreads of mouse RAW264.7 macrophage cells. PM is collected from ambient air with a high volume total suspended particles sampler. The collected material is solubilized and filtered to retain the water-soluble, fine portion. The particles are characterized for chemical composition by nuclear magnetic resonance (NMR) spectroscopy. Different concentrations of particle suspension are added onto an in vitro culture of RAW264.7 mouse macrophages for a total exposure time of 72 hr, along with untreated control cells. At the end of exposure, the culture is treated with colcemid to arrest cells in metaphase. Cells are then harvested, treated with hypotonic solution, fixed in acetomethanol, dropped onto glass slides and finally stained with Giemsa solution. Slides are examined to assess the structural chromosomal aberrations (CAs) in metaphase spreads at 1,000X magnification using a bright-field microscope. 50 to 100 metaphase spread are scored for each treatment group. This technique is adapted for the detection of structural chromosomal aberrations (CAs), such as chromatid-type breaks, chromatid-type exchanges, acentric fragments, dicentric and ring chromosomes, double minutes, endoreduplication, and Robertsonian translocations in vitro after exposure to PM. It is a powerful method to associate a well-established cytogenetic endpoint to epigenetic alterations.

Analysis of the Ambient Particulate Matter-induced Chromosomal Aberrations Using an In Vitro System

This protocol describes techniques for the quantification and characterization of chromosomal aberrations in vitro in RAW264.7 mouse macrophages after treatment with ambient air particulate matter.

를 사용하여 주변 입자상 물질에 의한 염색체 수차 분석<em&gt; 체외</em&gt; 시스템

Exposure to particulate matter (PM) is a major world health concern, which may damage various cellular components, including the nuclear genetic material. ...

Analysis of the c-KIT Ligand Promoter Using Chromatin Immunoprecipitation

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. Therefore, DNA-protein interactions regulate multiple physiological, pathophysiological, and biological functions, such as cell differentiation, cell proliferation, cell cycle control, chromosome stability, epigenetic gene regulation, and cell transformation. In eukaryotic cells, the DNA interacts with histone and nonhistone proteins and is condensed into chromatin. Several technical tools can be used to analyze DNA-protein interactions, such as the Electrophoresis (gel) Mobility Shift Assay (EMSA) and DNase I footprinting. However, these techniques analyze the protein-DNA interaction in vitro, not within the cellular context. Chromatin immunoprecipitation (ChIP) is a technique that captures proteins at their specific DNA binding sites, thereby allowing for the identification of DNA-protein interactions within their chromatin context. It is done by fixation&#160;of the DNA-protein interaction, followed by&#160;immunoprecipitation of the protein of interest. Subsequently, the genomic site that the protein was bound to is characterized. Here, we describe and discuss ChIP and demonstrate its analytical value for the identification of the Transforming Growth Factor-&#946; (TGF-&#946;)-induced binding of the transcription factor SMAD2 to SMAD Binding Elements (SBE) within the promoter region of the tyrosine-protein kinase Kit (c-KIT) receptor ligand Stem Cell Factor (SCF).

DNA-protein interactions are essential for multiple biological processes. During the evaluation of cellular functions, the analysis of DNA-protein interactions is indispensable for understanding gene regulation. Chromatin immunoprecipitation (ChIP) is a powerful tool to analyze such interactions in vivo.

Chromatin Immunoprecipitation을 이용한 c-KIT 리간드 프로모터 분석

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. ...

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Here, the power of a transposon-mediated random insertion of a non-coding DNA element was used to resolve its optimal chromosomal position.

소설 Transposon 중재 방식을 사용 하 여 대장균 의 DNA 요소에 대 한 최적의 염색체 위치 결정

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In ...

Real-time Analysis of Transcription Factor Binding, Transcription, Translation, and Turnover to Display Global Events During Cellular Activation

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for example, during cellular differentiation, morphogenesis, and functional stimulation (such as activation of immune cells), or after exposure to drugs and other factors from the local environment. Depending on the stimulus and cell type, these changes occur rapidly and at any possible level of gene regulation. Displaying all molecular processes of a responding cell to a certain type of stimulus/drug is one of the hardest tasks in molecular biology. Here, we describe a protocol that enables the simultaneous analysis of multiple layers of gene regulation. We compare, in particular, transcription factor binding (Chromatin-immunoprecipitation-sequencing (ChIP-seq)), de novo transcription (4-thiouridine-sequencing (4sU-seq)), mRNA processing, and turnover as well as translation (ribosome profiling). By combining these methods, it is possible to display a detailed and genome-wide course of action.
Sequencing newly transcribed RNA is especially recommended when analyzing rapidly adapting or changing systems, since this depicts the transcriptional activity of all genes during the time of 4sU exposure (irrespective of whether they are up- or downregulated). The combinatorial use of total RNA-seq and ribosome profiling additionally allows the calculation of RNA turnover and translation rates. Bioinformatic analysis of high-throughput sequencing results allows for many means for analysis and interpretation of the data. The generated data also enables tracking co-transcriptional and alternative splicing, just to mention a few possible outcomes.
The combined approach described here can be applied for different model organisms or cell types, including primary cells. Furthermore, we provide detailed protocols for each method used, including quality controls, and discuss potential problems and pitfalls.

This protocol describes the combinatorial use of ChIP-seq, 4sU-seq, total RNA-seq, and ribosome profiling for cell lines and primary cells. It enables tracking changes in transcription-factor binding, de novo transcription, RNA processing, turnover and translation over time, and displaying the overall course of events in activated and/or rapidly changing cells.

바인딩, 전사, 번역, 및 회전율 세포 활성화 중 글로벌 이벤트를 표시 하는 녹음 방송 요인의 실시간 분석

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for ...

Genome-wide Surveillance of Transcription Errors in Eukaryotic Organisms

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that control the fidelity of transcription. To fill this gap in scientific knowledge, we recently optimized the circle-sequencing assay to detect transcription errors throughout the transcriptome of Saccharomyces cerevisiae, Drosophila melanogaster, and Caenorhabditis elegans. This protocol will provide researchers with a powerful new tool to map the landscape of transcription errors in eukaryotic cells so that the mechanisms that control the fidelity of transcription can be elucidated in unprecedented detail.

This protocol provides researchers with a new tool to monitor the fidelity of transcription in multiple model organisms.

진 핵 생물의 전사 오류의 게놈 넓은 감시

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that ...

A Novel Saturation Mutagenesis Approach: Single Step Characterization of Regulatory Protein Binding Sites in RNA Using Phosphorothioates

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to control gene expression. These regulatory proteins control gene expression either at the level of DNA (transcription) or at the level of RNA (pre-mRNA splicing, polyadenylation, mRNA transport, decay, and translation). Identification of regulatory sequences helps understand not only how a gene is switched on or off, but also which downstream genes are regulated by a particular regulatory protein. Here, we describe a one-step approach that allows saturation mutagenesis of a protein binding site in RNA. It involves doping DNA template with non-wild-type nucleotides within the binding site, synthesis of separate RNAs with each phosphorothioate nucleotide, and isolation of the bound fraction following incubation with protein. Interference from non-wild-type nucleotides results in their preferential exclusion from the protein-bound fraction. This is monitored by gel electrophoresis following selective chemical cleavage with iodine of phosphodiester bonds containing phosphorothioates (phosphorothioate mutagenesis or PTM). This single-step saturation mutagenesis approach is applicable to the characterization of any protein binding site in RNA.

Proteins that bind specific RNA sequences play critical roles in gene expression. Detailed characterization of these binding sites is crucial for our understanding of gene regulation. Here, a single-step approach for saturation mutagenesis of protein-binding sites in RNA is described. This approach is relevant for all protein-binding sites in RNA.

Phosphorothioates를 사용 하 여 RNA에서 사이트 바인딩 규제 단백질의 소설 포화 Mutagenesis 접근: 단일 단계 특성

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to ...

Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

Infection with Zika virus (ZIKV) can be asymptomatic in adults, however, infection during pregnancy can lead to miscarriage and severe neurological birth defects. The goal of this protocol is to quickly detect ZIKV in both human and mosquito samples. The current gold standard for ZIKV detection is quantitative reverse transcription PCR (qRT-PCR); reverse transcription loop-mediated isothermal amplification (RT-LAMP) may allow for a more efficient and low-cost testing without the need for expensive equipment. In this study, RT-LAMP is used for ZIKV detection in various biological samples within 30 min, without first isolating the RNA from the sample. This technique is demonstrated using ZIKV infected patient urine and serum, and infected mosquito samples. 18S ribosomal ribonucleic acid and actin are used as controls in human and mosquito samples, respectively.

Reverse Transcription-Loop-mediated Isothermal Amplification RT-LAMP Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

This protocol provides an efficient and low-cost method to detect Zika virus or control targets in human urine and serum samples or in mosquitoes by reverse transcription loop-mediated isothermal amplification (RT-LAMP). This method does not require RNA isolation and can be done within 30 min.

반대로 Zika 바이러스 및 내부 관리 유전자 소변, 혈 청, 그리고 모기 샘플에 대 한 분석 결과 전사 루프 중재 하는 등온 증폭 (RT-램프)

Infection with Zika virus (ZIKV) can be asymptomatic in adults, however, infection during pregnancy can lead to miscarriage and severe neurological birth ...

Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells

Monitoring of nucleic acid intermediates during virus replication provides insights into the effects and mechanisms of action of antiviral compounds and host cell proteins on viral DNA synthesis. Here we address the lack of a cell-based, high-coverage, and high-resolution assay that is capable of defining retroviral reverse transcription intermediates within the physiological context of virus infection. The described method captures the 3'-termini of nascent complementary DNA (cDNA) molecules within HIV-1 infected cells at single nucleotide resolution. The protocol involves harvesting of whole cell DNA, targeted enrichment of viral DNA via hybrid capture, adaptor ligation, size fractionation by gel purification, PCR amplification, deep sequencing, and data analysis. A key step is the efficient and unbiased ligation of adaptor molecules to open 3'-DNA termini. Application of the described method determines the abundance of reverse transcripts of each particular length in a given sample. It also provides information about the (internal) sequence variation in reverse transcripts and thereby any potential mutations. In general, the assay is suitable for any questions relating to DNA 3'-extension, provided that the template sequence is known.

Here we present a deep sequencing approach that provides an unbiased determination of nascent 3&#39;-termini as well as mutational profiles of single-stranded DNA molecules. The main application is the characterization of nascent retroviral complementary DNAs (cDNAs), the intermediates generated during the process of retroviral reverse transcription.

결정 3'-테르미니와 에이즈-1 중 초기 단일 가닥 바이러스 성 DNA 분자의 순서 반대로 감염 된 세포에서 전사

Monitoring of nucleic acid intermediates during virus replication provides insights into the effects and mechanisms of action of antiviral compounds and ...