이 연구는 국립 보건원 (National Institutes of Health)의 교내 연구 프로그램, 노화에 국립 연구소에 의해 지원되었다. 저자는 또한 비판적 원고를 읽기위한 노화 및 Kotb Abdelmohsen에 대해 많은 도움이 토론 미리암 고로스페 및 Kotb Abdelmohsen을 감사드립니다. 우리는 또한 비판적 원고를 읽기 위해, 특히 더글러스 Dluzen 우리의 실험실 구성원 감사합니다.

저자가 공개하는 게 없다.

여기에서는 인간의 배수체 섬유 아세포를 이용하여 복제 성 및 DNA 손상 - ​​유도 노화에 대한 방법을 설명 하였다. 또한, 다양한 단백질 및 노화 관련 단백질의 mRNA 수준을 정량화하기위한 기술이 포함될뿐만 아니라, 염색 SA-β-gal을위한 상기 DNA 손상 - ​​마커 γ-H2AX위한 것이다. 많은주의가 생체 (20)에 노화의 특성이 존재하지만,이 프로토콜은 널리 생체 외 및 생체 내에서 모두 노화 표현형을 평가하는 데 사용할 수 있습니다. 다른 세포들이 노화 된 세포없는 경우에도, 노화 마커를 표현할 수 있습니다. 예를 들면, 파골 세포 및 대 식세포와 같은 세포는 β-gal을 활성 (32, 33)보다 높은 수준을 갖는다. 또한, 많은 암 세포는 P16의 INK4A (34)을 상향 조절했다. 세포는 DNA 손상 (예를 들면, γ-H2AX의 초점) 및 노화하지를 축적 할 수있다. SASP 요인도에 의해 상향 조절 될 수있다각종 정상 생리 학적 또는 또는 노화 된 세포를 포함하지 않을 수있다 병적 상태. 생체의 노화를 평가할 때 특히 따라서 여러 노화 마커가 이용되어야한다. 노화 세포는 20 년 전 4 정상 노화 조직에서 증가하는 것으로 확인되었지만, 그것은 단지 지금 우리가 완전히 노화 된 세포가 모두 정상 조직의 항상성과 병적 인 상태에서 재생하는 것이 역할의 과다를 감상하는 것입니다. P16의 INK4A 양성 노화 세포를 제거하기 위해 마우스 모델의 최근 고용은 연구자 더 명확를 허용하고 정확하게 조직 및 기관 35, 36, 37에서 노화 세포의 역할에 감사하고있다. 이 모델은 노화 세포가 노화 관련 병리, 종양의 군중에 기여하는 것을 발견하고, 마우스 수명 35 한 &lt;/ SUP&gt;, 36, 37. 이러한 최근의 발견과 생리학에 노화 세포의 중요성의 검증을 감안할 때, 시간이 특정 세포에 대한 연구 익은이다. 예를 들어, 치료 적 연구는 세포 노화를 제거하거나 노화 모두 healthspan 및 수명 연구에 도움이 될 수있는 지연 전략을 채용. 최근, 우리 연구소는 메트포르민, 일반적으로 제 2 형 당뇨병을 치료하는 데 사용 약물, 세포 노화 (38)를 감소를 발견했다. 메트포르민은 현재 노화 방지 요법으로 제안 및 안티 - 암 속성 (39), (40)이되고,이 약 또는 다른 노화 개입, 세포 노화를 조절함으로써 건강 결과에 영향을 미치는 여부를 조사하기 위해 미래에 흥미로운 일이 될 것이다. 우리가 여기서 논의 프로토콜은 널리 일반적이고있다ccepted 기술은 노화 표현형을 평가합니다. 시험 관내에서 세포 성장을 위해, 상기 세포를 (도 1 및 2 참조) 노화 것을 보장하기 위해 편평한 형태로 스핀들 형으로부터 셀 변경을 모니터링하는 것이 중요하다. 세포는 SA-β-gal을 또는 여기에 설명 된 다른 마커 양성 아닌 경우 (복제 성 노화) 또는 DNA 손상 - ​​유도 노화 후 증가시의 PDL 높은 세포에서 노화를 평가한다. 또한, 이러한 프로토콜은 서로 다른 세포 유형에 맞게 최적화해야 할 수 있습니다. SASP 단백질 수준을 평가하기 위해,이는 ELISA 또는 단백질 어레이에서 높은 배경 수준의 원인이됩니다, 셀 매체로부터 혈청을 제거하는 것이 중요합니다. 실험을 설계 할 때 동시에 여러 마커를 평가하기에 적합하지 않을 수 있습니다 따라서,이 점을 명심. 여기에 기술 된 바와 같이 SA-β-gal을위한 염색, 그것은 세포의 고정을 필요로한다는 사실에 의해 제한된다.또한, 세포의 합류는 SA-β-gal을 활성에 영향을 미치는 것으로 밝혀졌다. 프로토콜 41, 42, 43를 사용하여 유세포 생균이 마커의 정량을 허용 β-gal을 작동하는 형광 기질을 사용하여 SA-β-갈 활성을 평가하기 위해 개발되어왔다. SA-β-gal을 활성은 또한 화학 발광 법 (44)을 사용하여 세포 용 해물에서 측정 할 수있다. 또한, γ-H2AX는 유동 세포 계측법 또는 세포 용 해물 (45)의 면역을 포함하는 다양한 다른 방법을 사용하여 측정 할 수있다. SAHF 형성이 세포주 의존적임을 주목해야한다 대체로과 연관된 종양 유전자 - 유도 노화 20, 30, 46. 따라서, SAHF 모든 노화의 모델에 존재하지 않을 수 있습니다. 의 유틸리티마우스 모델에서 노화 마커 SAHF SAHF 또한 일반적으로 마우스의 노화 세포를 30, 46, 47에서 관찰되지 않는다는 사실에 의해 제한 될 수있다. 여기서, H3K9Me2에 대한 항체가 사용되었지만 SAHF 다른 분자 마커 macroH2A 높은 이동성 그룹 A (HMGA) 단백질, 및 트라이 메틸화 라이신 9 히스톤 H3 (H3K9Me3)와 결합 HP1 단백질을 포함하여 사용될 수있다. 또한, 염색질 면역 침전 분석은 히스톤 마크 또는 E2F 표적 유전자에 결합 단백질 염색질의 관계를 평가하기 위해 사용될 수있다. 하나는 마커에 대한 이질성 이러한 마커 노화 세포에서만 발현되지 않는다는 사실을 포함하여, 노화의 특성에 대한 다양한 제한이 있다는 것을 알고 있어야합니다. 다수의 (일반적으로 1 - 2 3) 마커는 설명을 생략 마커를 포함하여 노화를 평가하기 위해 사용한다. 예를 들면, DNA-흉터 텔로미어손상 및 / 또는 DNA 손상 신호는 정량화 될 수있다. 또한, 노화 및, 특히, SASP 표현형 같이, 최근 노화 11, 12, 13 유도 특정 스트레스 나 손상 영향을받는 것으로 밝혀졌다, 각 실험 패러다임에서 여러 마커를 평가하는 것이 중요하다.

반 세기 이상 전 헤이 플릭와 동료들은 문화 확산 방법 변형되지 않은 세포를 설명하지만, 시간이 1 만 한정된 기간 동안. 인간의 섬유 아 세포의 장기 배양이 확산 막을 수있는 세포를 발생; 그러나, 그들은 대사 활동했고, 이것은 세포 노화라고했다. 노화 종양 억제에 도움이 될 수 있지만,이 에이징 (2, 3)에 발생하는 회생 용량의 감소에 기여하는 것으로 생각된다으로도 불리 할 수있다. 노화 세포는 4 세를 인간과 배아 발달, 상처 치료, 조직 복구 및 나이와 관련된 염증이 포함 생물학적 과정의 숫자에 연루되어있다으로 조직에 축적하는 것으로 나타났다. 문화에 세포의 지속적인 계대이 연결되었습니다 복제 성 노화를 유도마찰과 게놈의 불안정성을 텔로미어합니다. DNA 손상과 암 유전자를 포함한 다양한 세포 스트레스는 또한 노화 3가 발생할 수 있습니다. 텔로미어 (telomere)의 감소가 아닌 다른 요인에 의한 노화는 종종 스트레스 유발 또는 조기 노화라고 일반적으로 P16의 INK4A / Rb는 경로 (5)에 따라 결정된다. 증식 있지만, 형질 전환되지 않은 세포는 일반적으로 형상 스핀들 표시, 노화 세포는 특정 특성을 갖는 평평하고 넓은 형태 증가 노화 관련 β 갈 락토시다 제 활성 (SA-β-gal을) (도 1 및 2)를 포함하는 것으로 식별 될 수있다. 노화 세포는 γ-H2AX (도 3) (6), 및 잠재적으로 노화 관련 이질 병소 (SAHF) (도 4) (7)을 포함하여, DNA 손상 마커 축적된다. 노화 세포는 P를 포함하는 세포주기 규제의 높은 수준을 가지고<html> 16 (P16의 INK4A) 및 / 또는 (P21) 및 p53의 (도 5) (8, 9). 또한, 최근의 데이터는 노화 세포는 염증성 사이토 카인 및 케모카인 중 다수를 분비하여 비 - 자율적 인 영향을 미칠 수있는 노화 - 관련 분비 표현형 (SASP) 10이라고 나타났다. 이 SASP 현상이 셀 타입에 세포 유형에 따라 다를 수 있지만, 일반적으로는 인터류킨 -6 (IL-6), IL-8, 과립구 - 대 식세포 콜로니 자극 인자 (GM-CSF), 성장 -의 증가에 의해 증명된다 종양 유전자의 조절 α (GRO-α), 및 β-GRO, 그 중에서도 (도 6). 노화를 유도 특정 응력이나 손상도 분비 표현형 11, 12, 13에 영향을 미칠 수있다. SASP는 ELISA를 카인 / 단백질 어레이를 사용하는 분비 단백질의 수준을 측정함으로써 검출 될 수있다S = &quot;외부 참조&quot;&gt; 10, 14. 전사 후 메커니즘 SASP 단백질 농도 11 조절할 수 있지만, 15, 16, 17 mRNA 수준의 변화 또한 많은 경우에 검출 될 수있다. 이러한 변화는 일반적으로 더 민감하고 단백질 수준 측정보다 정량화하기 쉽다. 기타 노화 마커는 영속 DNA 손상 병소 핵 노화 (DNA-SCARS) (18)을 보강 염색질 변형 불려 DNA 세그먼트, 및 다양한 다른 마커 3, 19, 20을 포함하여 평가할 수있다. 여기서는 SA-β-갈, γ-H2AX, SAHF 포함한 노화 여러 마커를 측정하는 또 배양 세포에서 노화를 유도하고 공통 기술을 설명하고 senesce의 단백질 및 mRNA를NCE 분자가 회합.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>16% Tris-glycine gels</td>
			<td>Invitrogen</td>
			<td colspan="2">XP00160BOX</td>
		</tr>
		<tr>
			<td>Acid-Phenol ChCl3</td>
			<td>Ambion</td>
			<td>AM9720</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa-Fluor 568 goat anti-mouse antibody</td>
			<td>Invitrogen</td>
			<td>A11031</td>
			<td>1:300 dilution</td>
		</tr>
		<tr>
			<td>Cell lifters</td>
			<td>Corning Inc.</td>
			<td>3008</td>
			<td>Cell scraper</td>
		</tr>
		<tr>
			<td>ECL anti-mouse HRP linked antibody</td>
			<td>Amersham</td>
			<td>NA931V</td>
			<td></td>
		</tr>
		<tr>
			<td>ECL Plus Western Blotting Substrate</td>
			<td>Pierce</td>
			<td>32132</td>
			<td>ECL</td>
		</tr>
		<tr>
			<td>DAPI</td>
			<td>Molecular Probes</td>
			<td>MP01306</td>
			<td>stock 5 mg/ml in dH2O</td>
		</tr>
		<tr>
			<td>GAPDH antibody</td>
			<td>Santa Cruz</td>
			<td>sc-32233</td>
			<td>1:1,000-5,000 dilution</td>
		</tr>
		<tr>
			<td>GlycoBlue</td>
			<td>Ambion</td>
			<td>AM9515</td>
			<td></td>
		</tr>
		<tr>
			<td>Histone H3 dimethyl K9 monoclonal antibody</td>
			<td>Abcam</td>
			<td>1220</td>
			<td>1:500 dilution</td>
		</tr>
		<tr>
			<td>Human IL-6 Quantikine ELISA assay</td>
			<td>R&#38;D systems</td>
			<td>D6050</td>
			<td></td>
		</tr>
		<tr>
			<td>Human IL-8 Quantikine ELISA assay</td>
			<td>R&#38;D systems</td>
			<td>D8000C</td>
			<td></td>
		</tr>
		<tr>
			<td>Human GROa Quantikine ELISA assay</td>
			<td>R&#38;D systems</td>
			<td>DRG00</td>
			<td></td>
		</tr>
		<tr>
			<td>N-N-dimethylformamide&#160;</td>
			<td>Sigma</td>
			<td>D4551</td>
			<td>DMF</td>
		</tr>
		<tr>
			<td>p16 monoclonal antibody</td>
			<td>BD Biosciences</td>
			<td>51-1325gr</td>
			<td>1:500 dilution</td>
		</tr>
		<tr>
			<td>p21 monoclonal antibody</td>
			<td>Millipore</td>
			<td>05-345</td>
			<td>1:750 dilution</td>
		</tr>
		<tr>
			<td>p53 monoclonal antibody</td>
			<td>Santa Cruz</td>
			<td>sc-126</td>
			<td>1:500 dilution clone DO-1</td>
		</tr>
		<tr>
			<td>phospho-H2AX (Ser139) FITC conjugate antibody</td>
			<td>Cell Signaling</td>
			<td>9719</td>
			<td>1:2000 dilution</td>
		</tr>
		<tr>
			<td>POWER SYBR-green PCR master mix&#160;</td>
			<td>Applied Biosystems</td>
			<td>4367659</td>
			<td></td>
		</tr>
		<tr>
			<td>Pre-stained molecular weight markers</td>
			<td>Biorad</td>
			<td>161-0374</td>
			<td></td>
		</tr>
		<tr>
			<td>ProLong Gold Antifade&#160;</td>
			<td>Invitrogen</td>
			<td>P36930</td>
			<td></td>
		</tr>
		<tr>
			<td>PVDF membrane&#160;</td>
			<td>Thermo Scientific</td>
			<td>88518</td>
			<td></td>
		</tr>
		<tr>
			<td>Senescence b-Galactosidase Staining Kit</td>
			<td>Cell Signaling</td>
			<td>9860</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol</td>
			<td>Ambion/Life Tech</td>
			<td>10296028</td>
			<td></td>
		</tr>
	</tbody>
</table>

techniques to induce and quantify cellular senescence

세포 스트레스 또는 손상에 대한 응답으로 증식하는 세포는 세포 노화이라고 장기 세포주기 정지의 상태를 개시하는 특정 프로그램을 유도 할 수 있습니다. 노화 세포의 축적은 생명체의 노화와 체외에서 계속 배양을 통해 발생합니다. 노화 세포는 배아 발달, 조직 복구 및 재생, 종양 억제, 노화 등 많은 생물학적 과정을, 영향을 미친다. 노화 세포의 특징을 포함하지만, 증가 된 노화 - 관련 β 갈 락토시다 제 활성 (SA-β-gal을)에 한정되지 않는다; P16의 INK4A, p53의, 그리고 P21 수준; γ-H2AX을 포함하여 DNA 손상의 높은 수준; 노화 관련 이질 병소 (SAHF)의 형성; 및 노화 관련 분비 표현형 (SASP), 염증성 사이토 카인 시그널링 분자의 수 분비를 특징으로하는 현상 획득. 여기, 우리가 모두 복제 성을위한 프로토콜을 설명하고DNA의 배양 세포에 노화를 유발 손상. 또, SA-β-gal을, γ-H2AX 및 SAHF 얼룩 등 여러 노화 - 관련 마커를 이용한 노화의 표현형을 모니터링하고, 세포주기 조절제 및 SASP 인자 단백질의 mRNA 수준을 정량화하는 방법을 강조. 이 방법은 다양한 모델과 조직에서 노화의 평가에 적용 할 수 있습니다.

6 SA-β-gal을 염색에서 대표적인 결과를 보여준다 - 2도 γ-H2AX 및 SAHF위한 염색; P16의 INK4A, P21 및 p53의 단백질 수준의 평가; 및 mRNA의 노화와 관련된 분자의 단백질 수준. 증가 된 SA-β-gal을 염색 및 복제 성 DNA 손상 - ​​유도 노화 발생. 또한, 노화와 함께 일어나는 형태 학적 변화를 관찰한다. 세포는 섬유 아세포 증식 스핀들 외관에 비해 확대 된 평면이된다. 본 실험 패러다임, 세포를 염색하고, RNA / 단백질 IR 노광 후 7 (D)를 분리 하였다. 더 강력한 결과는 IR 노출 (예 : 10 D) 후 이상 대기에 의해 발생할 수 있습니다. 조건은 각 조건 및 실험 장치에 대해 결정해야합니다. 이들 결과는 대표적인 노화 및 다른 방법을 사용하여 유도 될 때 이러한 마커는 검출 할 수있다. 도 6 her.within 페이지 = &quot;1&quot;&gt; 유전자 이름을 나열하고 CXCL1 (GROα) CXCL2 (GROβ) 및 CSF2 (GM-CSF)에 해당된다. SASP 요인의 일부의 mRNA 수준의 상향 조절, 전부는 아니지만은, WI-38 세포에서 IR에 의한 노화 후 관찰되었다. CDKN1A (P21 인코딩) 및 CDKN2A (P16의 INK4A을 인코딩)을 포함하여 기타 노화 관련의 mRNA는 상향 조절했다. 기타의 mRNA (EDN1 및 ANKRD1)도 포함되어 있고 이미 노화 된 세포 15 높게 나타났다. 프라이머는 표 1에 나열되어 있습니다. <img alt="그림 1" src="/files/ftp_upload/55533/55533fig1.jpg" /> 그림 1 : 증식 및 노화 섬유 아세포. 증식 (왼쪽)과 노화 (오른쪽) 섬유 아세포의 개략도. 노화 유도제의 예로는 너희에 나타낸다llow 상자. 노화가 표시된 마커의 높은 수준과 연관되어 있습니다. SA-β-gal을 노화 관련 β 갈 락토시다 제 활성; SASP, 노화 관련 분비 표현형; SAHF, 노화 관련 이질 염색질의 초점; DDR, DNA-손상 응답. <a href="http://ecsource.jove.com/files/ftp_upload/55533/55533fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오</a> <img alt="그림 2" src="/files/ftp_upload/55533/55533fig2.jpg" /> 그림 2. 형태 학적 특성 및 노화 세포의 증가 SA-β-gal을 활동은. WI-38 세포, &quot;젊은&quot;(PDL 27), 복제 성 노화 (PDL 40), 또는 전리 방사선 (IR)에 노출 된 사람들, SA-β-gal을 활동을 위해 염색 확산 중. IMR-90 세포 증식 중 &quot;젊은&quot;(PDL 30), 복제 성 노화 (PDL 52) 또는 방사 (IR)를 이온화 방사선에 노출 것과 STA이었다SA-β-갤런 활동 이네. 섹션 (가) 1 - 2 및 복제 성 DNA 손상 - ​​유도 노화를 유도 기술 및 제 3 SA-β-gal을위한 염색을 설명한다. 세포 IR 후 7 일 이내를 염색 하였다. 콘, 제어 할 수 있습니다. 스케일 바는 50 μm의 =. <a href="http://ecsource.jove.com/files/ftp_upload/55533/55533fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/55533/55533fig3.jpg" /> 그림 3. 노화 세포에서 γ-H2AX 초점을 증가. WI-38 세포 증식 중 &quot;젊은&quot;(PDL 30) 또는 복제 성 노화 (PDL 53)와 고정 반 γ-H2AX 항체 및 DAPI 염색 하였다. 노화 세포에서 γ-H2AX의 병소의 수의 증가를합니다. 이미지는 공 초점 현미경을 얻었다. Z 섹션 촬영하고, 그 최대 강도 투영 모든 detec 시각화 단일 평면 화상을 얻기 위해 사용 된테이블 초점. 스케일 바는 20 μm의 =. <a href="http://ecsource.jove.com/files/ftp_upload/55533/55533fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 4" src="/files/ftp_upload/55533/55533fig4.jpg" /> 그림 노화 세포의 SAHF 4. 형광 염색. (A) 증식 WI-38 세포 (PDL 27) 미처리 또는 이온화 방사선 (IR)에 노출시켰다. 십일 후, 세포 SAHF (IR 처리 된 세포 밀도 / 점상 DAPI 염색 주) (B) IDH4는 덱사메타손의 존재하에 배양 하였다 (확산) 또는 노화를 유도하는 숯불 박탈 FBS하여 (시각화 DAPI 염색 하였다 늙은). 10 D 후, 세포 H3K9Me2 및 DAPI에 대한 항체로 염색 하였다. 이미지는 공 초점 현미경을 얻었다. Z 섹션 촬영하고, 최대 강도의 투영은 단일 평면을 수득 하였다영상. 노화 세포 DAPI 염색 반점이있는 반면 (A) 및 (B)에서 증식 세포 확산 DAPI 염색있다. H3K9Me2 염색보다 견고하고 노화 세포 DAPI 염색으로 초점 colocalizes 반면 (B)에서, 제어 셀들은 H3K9Me2 대한 확산, 매우 가벼운 오염을 갖는다. 스케일 바는 20 μm의 =. <a href="http://ecsource.jove.com/files/ftp_upload/55533/55533fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 5" src="/files/ftp_upload/55533/55533fig5.jpg" /> 노화 관련 단백질의 그림 5. 정량화. 전리 방사선의 10 Gy의 (IR)에 노출 또는 IMR-90 세포 (-) 단백질 확산 &quot;젊은&quot;(PDL 30) IMR-90 세포 하나에서 분리 하였다. 매체는 48 시간마다 변화시키고, 세포 IR 후 7 (D)을 용해시켰다. 샘플 안티 P16의 INK4A의 antibo와 immunoblotted, SDS-PAGE로 분석 하였다다이 안티 P21하고 항 p53의 항체로 재 프로빙. GAPDH는 단백질 로딩 대조군으로 사용 하였다. <a href="http://ecsource.jove.com/files/ftp_upload/55533/55533fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 6" src="/files/ftp_upload/55533/55533fig6.jpg" /> 노화와 관련된 mRNA를 SASP 단백질의 정량도 6. (-) 이온화 방사선 (IR)의 10 Gy의 노출되었다 또는 WI-38 세포 (A) RNA 중 하나 확산 &quot;젊은&quot;(PDL 27 또는 34) WI-38 세포에서 분리 하였다. 매체는 48 시간마다 변화시키고, RNA를 분리 한 후 IR 7 D를 실시 하였다. RT-qPCR에 표 1에 기재된 유전자 특이 적 프라이머를 사용하여 표시된 노화 관련의 mRNA 수준을 정량화 하였다. 18S 수준은 정상화를 위해 사용되었다. 히스토그램의 평균을 나타내는 정규화 t5 개 독립적 실험 O 미처리 ± SEM. (B) WI-38 세포 (PDL 26)의 IR 10 Gy를 노출시켰다; 10 D 후, 배지를 무 혈청 배지로 변경 함. 24 시간 후, 배양 상청을 회수하고, IL-6, IL-8, GROα 및 수준은 ELISA 어 세이를 사용하여 정량화 하였다. 히스토그램은 세 실험으로부터 평균 ± SEM을 나타낸다. * 학생의 t 검정에 의한 P &lt;0.05 *** P &lt;0.001. <a href="http://ecsource.jove.com/files/ftp_upload/55533/55533fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 인간 프라이머 </td><td> 앞으로 </td><td> 역 </td></tr><tr><td> 18S </td><td> CCCTATCAACTTTCGATGGTAGTCG </td><td> CCAATGGATCCTCGTTAAAGGATTT </td></tr><tr><td> ANKRD1 </td><td> AGT AGA GGA ACT GGT의 CACTGG </td><td> TGG GCT AGA AGT GTCTTC AGA T </td></tr><tr><td> CDKN1A (P21) </td><td> GAC ACCACT GGA GGG TGA CT </td><td> CAGGTC CAC ATG GTC TTC CT </td></tr><tr><td> CDKN2A (P16) </td><td> CCAACGCACCGAATAGTTACG </td><td> GCGCTGCCCATCATCATG </td></tr><tr><td> CSF2 (GM-CSF) </td><td> GGCCCCTTGACCATGATG </td><td> TCTGGGTTGCACAGGAAGTTT </td></tr><tr><td> CXCL1 </td><td> GAAAGCTTGCCTCAATCCTG </td><td> CACCAGTGAGCTTCCTCCTC </td></tr><tr><td> CXCL2 </td><td> AACTGCGCTGCCAGTGCT </td><td> CCCATTCTTGAGTGTGGCTA </td></tr><tr><td> EDN1 </td><td> CAG의 CAGTCT의 TAG GCG CTG AG </td><td> ACTCTT TAT CCA TCA GGG ACG AG </td></tr><tr><td> IL-6 </td><td> CCGGGAACGAAAGAGAAGCT </td><td> GCGCTTGTGGAGAAGGAGTT </td></tr><tr><td> IL7 </td><td> CTCCAGTTGCGGTCATCATG </td><td> GAGGAAGTCCAAAGATATACCTAAAAGAA </tD&gt; </tr><tr><td> IL8 </td><td> CTTTCCACCCCAAATTTATCAAAG </td><td> CAGACAGAGCTCTCTTCCATCAGA </td></tr></tbody></table> 표 1 : 노화 관련 mRNA에 대한 RT-qPCR에 프라이머. RT-qPCR에가 SYBR 녹색 기술을 사용하기위한 순방향 및 역방향 프라이머가 표시됩니다.

Watch this Scientific Journal Video about Techniques to Induce and Quantify Cellular Senescence at JoVE.com

Techniques to Induce and Quantify Cellular Senescence

세포 노화, 세포주기 정지의 비가역적인 상태는 다양한 세포 스트레스에 의해 유도 될 수있다. 여기, 우리는 노화의 마커를 평가하기 위해 세포 노화 및 방법을 유도 프로토콜을 설명합니다.

기술은 유도 및 정량화 세포 노화하기

In response to cellular stress or damage, proliferating cells can induce a specific program that initiates a state of long-term cell-cycle arrest, termed ...

techniques-to-induce-and-quantify-cellular-senescence

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Unit 2

Cell Proliferation

SCIENTISTS IN ACTION

32.9K 조회수.  National Institute on Aging, National Institutes of Health.  세포 노화, 세포주기 정지의 비가역적인 상태는 다양한 세포 스트레스에 의해 유도 될 수있다. 여기, 우리는 노화의 마커를 평가하기 위해 세포 노화 및 방법을 유도 프로토콜을 설명합니다. 

비디오: Techniques to Induce and Quantify Cellular Senescence

BioMEMS and Cellular Biology: Perspectives and Applications

The ability to culture cells has revolutionized hypothesis testing in basic cell and molecular biology research. It has become a standard methodology in drug screening, toxicology, and clinical assays, and is increasingly used in regenerative medicine. However, the traditional cell culture methodology   essentially consisting of the immersion of a large population of cells in a homogeneous fluid medium and on a homogeneous flat substrate   has become increasingly limiting both from a fundamental and practical perspective. Microfabrication technologies have enabled researchers to design, with micrometer control, the biochemical composition and topology of the substrate, and the medium composition, as well as the neighboring cell type in the surrounding cellular microenvironment. Additionally, microtechnology is conceptually well-suited for the development of fast, low-cost in vitro systems that allow for high-throughput culturing and analysis of cells under large numbers of conditions. In this interview, Albert Folch explains these limitations, how they can be overcome with soft lithography and microfluidics, and describes some relevant examples of research in his lab and future directions.

BioMEMS 및 세포 생물학 : 관점 및 응용 프로그램

The ability to culture cells has revolutionized hypothesis testing in basic cell and molecular biology research. It has become a standard methodology in ...

연구

생물학

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of the Drosophila melanogaster syncytial embryo for studying mitosis1. Drosophila has useful genetics with a sequenced genome, and it can be easily maintained and manipulated. Many mitotic mutants exist, and transgenic flies expressing functional fluorescently (e.g. GFP) - tagged mitotic proteins have been and are being generated. Targeted gene expression is possible using the GAL4/UAS system2. 

The Drosophila early embryo carries out multiple mitoses very rapidly (cell cycle duration, &asymp;10 min). It is well suited for imaging mitosis, because during cycles 10-13, nuclei divide rapidly and synchronously without intervening cytokinesis at the surface of the embryo in a single monolayer just underneath the cortex. These rapidly dividing nuclei probably use the same mitotic machinery as other cells, but they are optimized for speed; the checkpoint is generally believed to not be stringent, allowing the study of mitotic proteins whose absence would cause cell cycle arrest in cells with a strong checkpoint. Embryos expressing GFP labeled proteins or microinjected with fluorescently labeled proteins can be easily imaged to follow live dynamics (Fig. 1). In addition, embryos can be microinjected with function-blocking antibodies or inhibitors of specific proteins to study the effect of the loss or perturbation of their function3. These reagents can diffuse throughout the embryo, reaching many spindles to produce a gradient of concentration of inhibitor, which in turn results in a gradient of defects comparable to an allelic series of mutants. Ideally, if the target protein is fluorescently labeled, the gradient of inhibition can be directly visualized4. It is assumed that the strongest phenotype is comparable to the null phenotype, although it is hard to formally exclude the possibility that the antibodies may have dominant effects in rare instances, so rigorous controls and cautious interpretation must be applied. Further away from the injection site, protein function is only partially lost allowing other functions of the target protein to become evident.

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of microinjection and high resolution imaging in the Drosophila melanogaster syncytial embryo to study mitosis.

의 유사 분열 유학을위한 Microinjection 기법 Drosophila melanogaster Syncytial 엠브료

This protocol describes the use of the Drosophila melanogaster syncytial embryo  for studying mitosis1.  Drosophila has useful genetics with a sequenced ...

Imaging Mismatch Repair and Cellular Responses to DNA Damage in Bacillus subtilis

Both prokaryotes and eukaryotes respond to DNA damage through a complex set of physiological changes. Alterations in gene expression, the redistribution of existing proteins, and the assembly of new protein complexes can be stimulated by a variety of DNA lesions and mismatched DNA base pairs. Fluorescence microscopy has been used as a powerful experimental tool for visualizing and quantifying these and other responses to DNA lesions and to monitor DNA replication status within the complex subcellular architecture of a living cell. Translational fusions between fluorescent reporter proteins and components of the DNA replication and repair machinery have been used to determine the cues that target DNA repair proteins to their cognate lesions in vivo and to understand how these proteins are organized within bacterial cells. In addition, transcriptional and translational fusions linked to DNA damage inducible promoters have revealed which cells within a population have activated genotoxic stress responses. In this review, we provide a detailed protocol for using fluorescence microscopy to image the assembly of DNA repair and DNA replication complexes in single bacterial cells. In particular, this work focuses on imaging mismatch repair proteins, homologous recombination, DNA replication and an SOS-inducible protein in Bacillus subtilis. All of the procedures described here are easily amenable for imaging protein complexes in a variety of bacterial species.

Imaging Mismatch Repair and Cellular Responses to DNA Damage in Bacillus subtilis

A detailed protocol is described for imaging the real time formation of DNA repair complexes in Bacillus subtilis cells.

이미징 불일치 복구 및 DNA의 손상 세포 응답 바실러스 subtilis</em

Both prokaryotes and eukaryotes respond to DNA damage through a complex set of physiological changes. Alterations in gene expression, the redistribution ...

Aseptic Laboratory Techniques: Plating Methods

Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies on the ability of a scientist to sterilize work surfaces and equipment as well as prevent contact of sterile instruments and solutions with non-sterile surfaces. Here we present the steps for several plating methods routinely used in the laboratory to isolate, propagate, or enumerate microorganisms such as bacteria and phage. All five methods incorporate aseptic technique, or procedures that maintain the sterility of experimental materials. Procedures described include (1) streak-plating bacterial cultures to isolate single colonies, (2) pour-plating and (3) spread-plating to enumerate viable bacterial colonies, (4) soft agar overlays to isolate phage and enumerate plaques, and (5) replica-plating to transfer cells from one plate to another in an identical spatial pattern. These procedures can be performed at the laboratory bench, provided they involve non-pathogenic strains of microorganisms (Biosafety Level 1, BSL-1). If working with BSL-2 organisms, then these manipulations must take place in a biosafety cabinet. Consult the most current edition of the Biosafety in Microbiological and Biomedical Laboratories (BMBL) as well as Material Safety Data Sheets (MSDS) for Infectious Substances to determine the biohazard classification as well as the safety precautions and containment facilities required for the microorganism in question. Bacterial strains and phage stocks can be obtained from research investigators, companies, and collections maintained by particular organizations such as the American Type Culture Collection (ATCC). It is recommended that non-pathogenic strains be used when learning the various plating methods. By following the procedures described in this protocol, students should be able to: 
 
&#9679; Perform plating procedures without contaminating media. 
&#9679; Isolate single bacterial colonies by the streak-plating method. 
&#9679; Use pour-plating and spread-plating methods to determine the concentration of bacteria. 
&#9679; Perform soft agar overlays when working with phage. 
&#9679; Transfer bacterial cells from one plate to another using the replica-plating procedure. 
&#9679; Given an experimental task, select the appropriate plating method.

When working with media and reagents used to culture microorganisms, aseptic technique must be practiced to ensure contamination is minimized. A variety of plating methods are routinely used to isolate, propagate, or enumerate bacteria and phage, all of which incorporate procedures that maintain the sterility of experimental materials.

무균 실험실 기술 : 도금 방법

Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies ...

Telomere Length and Telomerase Activity; A Yin and Yang of Cell Senescence

Telomeres are repeating DNA sequences at the tip ends of the chromosomes that are diverse in length and in humans can reach a length of 15,000 base pairs. The telomere serves as a bioprotective mechanism of chromosome attrition at each cell division. At a certain length, telomeres become too short to allow replication, a process that may lead to chromosome instability or cell death. Telomere length is regulated by two opposing mechanisms: attrition and elongation. Attrition occurs as each cell divides. In contrast, elongation is partially modulated by the enzyme telomerase, which adds repeating sequences to the ends of the chromosomes. In this way, telomerase could possibly reverse an aging mechanism and rejuvenates cell viability. These are crucial elements in maintaining cell life and are used to assess cellular aging. In this manuscript we will describe an accurate, short, sophisticated and cheap method to assess telomere length in multiple tissues and species. This method takes advantage of two key elements, the tandem repeat of the telomere sequence and the sensitivity of the qRT-PCR to detect differential copy numbers of tested samples. In addition, we will describe a simple assay to assess telomerase activity as a complementary backbone test for telomere length.

An accurate, short, sophisticated and cheap method is described that assesses telomere length in multiple tissues and species using qRT-PCR. In addition, we will describe a simple assay to assess telomerase activity as a complementary backbone test for telomere length.

텔로미어의 길이와 텔로 머라 제 활성을 세포 노화의 음과 양

Telomeres  are repeating DNA sequences at the tip ends of the chromosomes that are diverse  in length and in humans can reach a length of 15,000 base ...

Simple and Effective Administration and Visualization of Microparticles in the Circulatory System of Small Fishes Using Kidney Injection

The systemic administration of micro-size particles into a living organism can be applied for vasculature visualization, drug and vaccine delivery, implantation of transgenic cells and tiny optical sensors. However, intravenous microinjections into small animals, which are mostly used in biological and veterinary laboratories, are very difficult and require trained personnel. Herein, we demonstrate a robust and efficient method for the introduction of microparticles into the circulatory system of adult zebrafish (Danio rerio) by injection into the fish kidney. To visualize the introduced microparticles in the vasculature, we propose a simple intravital imaging technique in fish gills. In vivo monitoring of the zebrafish blood pH was accomplished using an injected microencapsulated fluorescent probe, SNARF-1, to demonstrate one of the possible applications of the described technique. This article provides a detailed description of the encapsulation of pH-sensitive dye and demonstrates the principles of the quick injection and visualization of the obtained microcapsules for in vivo recording of the fluorescent signal. The proposed method of injection is characterized by a low mortality rate (0-20%) and high efficiency (70-90% success), and it is easy to institute using commonly available equipment. All described procedures can be performed on other small fish species, such as guppies and medaka.

This article demonstrates the principles of a quick, minimally invasive injection of fluorescent microparticles into the circulatory system of small fishes and the in vivo visualization of the microparticles in fish blood.

간단 하 고 효과적인 관리 및 신장 주입을 사용 하 여 작은 물고기의 순환 시스템에 미의 시각화

The systemic administration of micro-size particles into a living organism can be applied for vasculature visualization, drug and vaccine delivery, ...

Nasal Potential Difference to Quantify Trans-epithelial Ion Transport in Mice

The nasal potential difference test has been used for almost three decades to assist in the diagnosis of cystic fibrosis (CF). It has proven to be helpful in cases of attenuated, oligo- or mono-symptomatic forms of CF usually diagnosed later in life, and of CF-related disorders such as congenital bilateral absence of vas deferens, idiopathic chronic pancreatitis, allergic bronchopulmonary aspergillosis, and bronchiectasis. In both clinical and preclinical settings, the test has been used as a biomarker to quantify responses to targeted therapeutic strategies for CF. Adapting the test to a mouse is challenging and can entail an associated mortality. This paper describes the adequate depth of anesthesia required to maintain a nasal catheter in situ for continuous perfusion. It lists measures to avoid broncho-aspiration of solutions perfused in the nose. It also describes the animal care at the end of the test, including administration of a combination of antidotes of the anesthetic drugs, leading to rapidly reversing the anesthesia with full recovery of the animals. Representative data obtained from a CF and a wild-type mouse show that the test discriminates between CF and non-CF. Altogether, the protocol described here allows reliable measurements of the functional status of trans-epithelial chloride and sodium transporters in spontaneously breathing mice, as well as multiple tests in the same animal while reducing test-related mortality.

Here, we present a protocol to measure nasal potential difference in mice. The test quantifies the function of transmembrane ion transporters such as the cystic fibrosis transmembrane conductance regulator and the epithelial sodium channel. It is valuable to evaluate the efficacy of novel therapies for cystic fibrosis.

마우스에 트랜스 상피 이온 수송 계량 비 전위차

The nasal potential difference test has been used for almost three decades to assist in the diagnosis of cystic fibrosis (CF). It has proven to be helpful ...

Bovine Mammary Gland Biopsy Techniques

Bovine mammary gland biopsies allow researchers to collect tissue samples to study cell biology including gene expression, histological analysis, signaling pathways, and protein translation. This article describes two techniques for biopsy of the bovine mammary gland (MG). Three healthy Holstein dairy cows were the subjects. Before biopsies, cows were milked and subsequently restrained in a cattle chute. An analgesic (flunixin meglumine, 1.1 to 2.2 mg/kg of body weight) was administered via jugular intravenous [IV] injection 15-20 min prior to biopsy. For standing sedation, xylazine hydrochloride (0.01-0.05 mg/kg of body weight) was injected via the coccygeal vessels 5-10 min before the procedure. Once adequately sedated, the biopsy site was aseptically prepared and locally anaesthetized with 6 mL of 2% lidocaine hydrochloride via subcutaneous injection. Using aseptic technique, a 2 to 3 cm vertical incision was made using a number 10 scalpel. Core and needle biopsy tools were used. The core biopsy tool was attached to a cordless drill and inserted into the MG tissue through the incision using a clock-wise drill action. The needle biopsy tool was manually inserted into the incision site. Immediately after the procedure, an assistant applied pressure on the incision site for 20 to 25 min using a sterile towel to achieve hemostasis. Stainless steel surgical staples were used to oppose the skin incision. The staples were removed 10 days post-procedure. The main advantages of core and needle biopsies is that both approaches are minimally invasive procedures that can be safely performed in healthy cows. Milk yield following the biopsy was unaffected. These procedures require a short recovery time and result in fewer risks of complications. Specific limitations may include bleeding after the biopsy and infection on the biopsy site. Applications of these techniques include tissue collection for clinical diagnosis and research purposes, such as primary cell culture.

This article presents a bovine mammary gland biopsy using core and needle biopsy tools. Harvested tissue can be used for cell culture or to assess mammary physiology and metabolism including gene expression, protein expression, protein modifications, immunohistochemistry, and metabolite concentrations.

소 유선 생 검 기술

Bovine mammary gland biopsies allow researchers to collect tissue samples to study cell biology including gene expression, histological analysis, ...

Applications of Spatio-temporal Mapping and Particle Analysis Techniques to Quantify Intracellular Ca2+ Signaling In Situ

Ca2+ imaging of isolated cells or specific types of cells within intact tissues often reveals complex patterns of Ca2+ signaling. This activity requires careful and in-depth analyses and quantification to capture as much information about the underlying events as possible. Spatial, temporal and intensity parameters intrinsic to Ca2+ signals such as frequency, duration, propagation, velocity and amplitude may provide some biological information required for intracellular signalling. High-resolution Ca2+ imaging typically results in the acquisition of large data files that are time consuming to process in terms of translating the imaging information into quantifiable data, and this process can be susceptible to human error and bias. Analysis of Ca2+ signals from cells in situ typically relies on simple intensity measurements from arbitrarily selected regions of interest (ROI) within a field of view (FOV). This approach ignores much of the important signaling information contained in the FOV. Thus, in order to maximize recovery of information from such high-resolution recordings obtained with Ca2+dyes or optogenetic Ca2+ imaging, appropriate spatial and temporal analysis of the Ca2+ signals is required. The protocols outlined in this paper will describe how a high volume of data can be obtained from Ca2+ imaging recordings to facilitate more complete analysis and quantification of Ca2+ signals recorded from cells using a combination of spatiotemporal map (STM)-based analysis and particle-based analysis. The protocols also describe how different patterns of Ca2+ signaling observed in different cell populations in situ can be analyzed appropriately. For illustration, the method will examine Ca2+ signaling in a specialized population of cells in the small intestine, interstitial cells of Cajal (ICC), using GECIs.

Applications of Spatio-temporal Mapping and Particle Analysis Techniques to Quantify Intracellular Ca2+ Signaling In Situ

Genetically encoded Ca2+ indicators (GECIs) have radically changed how in situ Ca2+ imaging is performed. To maximize data recovery from such recordings, appropriate analysis of Ca2+ signals is required. The protocols in this paper facilitate the quantification of Ca2+ signals recorded in situ using spatiotemporal mapping and particle-based analysis.

세포내 캘리포니아2 + 제자리에서 신호 계량 Spatio 시간적 매핑 및 입자 분석 기법에의 응용

Ca2+ imaging of isolated cells or specific types of cells within intact tissues often reveals complex patterns of Ca2+ signaling. This activity requires ...

Immunohistochemistry Techniques to Analyze Cellular Proliferation and Neurogenesis in Rats Using the Thymidine Analog BrdU

One of the most important things in the field of adult hippocampal neurogenesis (AHN) is the identification of the newly generated cells. The immunodetection of thymidine analogs (such as 5-Bromo-2&#39;-deoxyuridine (BrdU)) is a standard technique used for visualizing these newly generated cells. Therefore, BrdU is usually injected in small animals intraperitoneally, so the thymidine analog gets incorporated into dividing cells during DNA synthesis. Detection is performed by immunohistochemical analysis of brain slices. Every research group that has been using this technique can appreciate that it requires special attention to minute details to achieve a successful stain. For instance, an important step is DNA denaturation with HCl, which allows it to reach the cell nucleus to stain it. However, the existing scientific reports describe very few of such steps in detail. Therefore, standardizing the technique is challenging for new laboratories as it can take several months to yield positive and successful outcomes. The purpose of this work is to describe and elaborate the steps to obtain positive and successful outcomes of the immunostaining technique in detail when working with the thymidine analog BrdU. The protocol includes the reagent preparation and setup, administration of thymidine analog in a rodent, transcardial perfusion, tissue preparation, peroxidase immunohistochemical reaction, use of avidin-biotin complex, immunofluorescence, counterstaining, microscopy imaging, and cell analysis.

This paper presents four of the most common techniques for visualizing BrdU positive cells to measure adult neurogenesis in rats. This work includes instructions for reagent preparation, thymidine analog administration, transcardial perfusion, tissue preparation, peroxidase immunohistochemical reaction, immunofluorescence, signal amplification, counterstaining, microscopy imaging, and cell analysis.