CD31 항 체 사용 박사 카 렌 탄, 에든버러 대학에서에서 관대 한 선물 했다. 이 연구는 생명 공학 및 생물 과학 연구 위원회 (BBSRC)는 연구소 전략적 프로그램 그랜트 (BB/J004316/1;의 형태로 자금에 의해 지원 되었다 BBS/E/D/20221657) (누구와 CF)는 연구소 경력 경로 친목 BB/F023928/1 (누구), 그리고 재학 BBSRC 경우 재학 BB/K011618/1 (LC)를 통해 자금.

모든 동물 실험 위원회 사용자는로 슬 린 연구소의 동물에 의해 승인 했다 및 동물 치료 동물의 사용에 대 한 홈 오피스 (영국) 지침에 따라 유지 되었다. 아래에 설명 된 프로토콜에 대 한 5 주 오래 된, 남성 Sprague Dawley 쥐 사용 되었다.
1. 시 약 조리법
<ol><li>Dulbecco의 수정이 글 중간 (DMEM)과 영양소 혼합 F-12 (DMEM/F12)를 사용 하 여 문화 매체 를 준비 합니다. 10% 소독 열 비활성화 태아 둔감 한 혈 청 (FBS)와 1 %gentamicin 추가 합니다.</li>
	<li>석 회화 매체 문화 매체와 2.7 m m Ca/2.5 m m 파이 사용 하 여 준비 합니다.<ol>
<li>555 mg CaCl2 개 무게와 1m CaCl2의 5 mL을 증류수 5 mL 물에 용 해 하 여 1 M 칼슘 염화 물 (CaCl2)를 준비 합니다. 솔루션 솔루션 소독 0.22 μ m 주사기 필터를 통해 필터링.</li>
		<li>710 mg 무수 염기 나트륨 인산 염 (Na2HPO4)과 각각 별도로 증류수 5 mL에 용 해의 무수 이수소 나트륨 인산 염 (NaH2포4), 600 밀리 그램 무게 1 M 나트륨 인산 염 을 준비합니다 물입니다. 솔루션을 소독 하는 0.22 μ m 주사기 필터를 통해 나2HPO4 의 3,870 µ L와 1130 µ L NaH2포4, 및 필터를 결합 합니다.</li>
	</ol>
</li>
	<li>버퍼를 세척 포함 하는 행 크의 균형 소금 솔루션 (HBSS) 및 1 %gentamicin 준비.</li>
</ol>2입니다. 절 개 후드의 준비
<ol><li>모든 해 통풍 후드, 이전 샘플 및 시 약의 무 균을 보장 하기 위해 70% 에탄올으로 소독을 실시 합니다.</li>
	<li>압력가 마로 소독 그들 뒤에 70% 에탄올 이전 사용에 들어 있는 비 커에 도구 팁을 immersing에 의해 해 부 도구를 소독.</li>
	<li>워시 버퍼를 포함 하는 비 커를 준비 하 고 해 부 도구 동물 또는 조직 접촉으로 오기 전에 워시 버퍼에 담근 다. 모든 시간에 얼음에 워시 버퍼를 유지.</li>
</ol>3입니다. 기본 쥐 피해자의 추출
참고: 아래에서 설명 하는 프로토콜에 대 한 5 주 오래 된, 남성 Sprague Dawley 쥐 사용 되었다.
<ol><li>쥐를 추려 (~ 100 g) 영국 본사 지침에 따라 자 궁 경부 전위에 의해.</li>
	<li>각 쥐의 심장 밖으로 해 부하는 동물 부정사 유리 해 부 보드에 놓고 70% 에탄올을 분사 하 여 피부를 소독 합니다.</li>
	<li>해 부가 위, 복 부 구멍을 노출 하 고 흉 곽과 폐, 심장 폭로 조심 스럽게 제거의 도움으로 쥐의 중간에 4 cm 절 개를 확인 합니다.</li>
	<li>샤 프의 쌍을 가진 심 혼을 제거 하 고 곡선된가 위, 봄은 쥐의 모든 총 해 완료 될 때까지 해 부 심장 얼음 차가운 워시 버퍼에 저장.</li>
	<li>마이크로 해 부 각 심장, 페 트리 접시에 후자 전송 워시 버퍼에 덮여. 오름차순 대동맥 및 대동맥 루트 작은 지역으로 남아 있을 봄 연속가 위 (6 m m 블레이드)와 심장 근육을 잘라.</li>
	<li>동일을 사용 하 여 직선 위 (6 m m 블레이드) 봄, 신중 하 게 자르면 오름차순 대동맥 좌 심 실 쪽으로 고 노출 대동맥 밸브 전단지.</li>
	<li>신선 하 고, 멸 균 페 트리 접시에 전송 열린된 대동맥 HBSS 가득합니다. 대동맥 밸브 전단지, 욕실이 형 capsulotomy 마이크로-가 위 (3 m m 블레이드)와 대동맥의 기지에서 그들의 독특한 'U' 모양으로 표시를 해 부.</li>
	<li>1.5 mL microcentrifuge 튜브 모든 해 완료 될 때까지 얼음 차가운 워시 버퍼의 1 mL에 모든 전단지를 저장 합니다.</li>
	<li>일단 모든 전단지 수확 되어, 워시 버퍼를 제거 하 4 ° C에서 1 분 x 100g에 그들을 원심.</li>
	<li>살 균을 위해 셀 문화 후드에서 다음 단계를 수행 합니다. 100 µ L 425 U/mL 콜라 II 37 ° c.에 5 분에 전단지 소화에 VECs를 제거 하려면 부드럽게 200 µ L 피 펫 팁을 사용 하 여 위아래로 pipetting으로 소화를 방해.</li>
	<li>30 100 x g에서 원심 분리기 전단지, 펠 렛은 상쾌한을 신중 하 게 삭제 하는 s. 500 µ L 워시 버퍼와 두 번 세척 하 고 다시 30 100 x g에서 원심 분리 하 여 세포를 작은 s.</li>
	<li>전단지에서 피해자를 수확, 2 h, 425 U/mL 콜라 II의 100 µ L를 소화 하 고 200 µ L 피 펫 팁을 사용 하 여 위아래로 부드럽게 pipetting으로 피해자를 놓습니다.</li>
	<li>문화 매체 및 작은 피해 자들은 고 나머지 밸브 전단지 파편을 5 분 동안 670 x g에서 원심 분리기의 19 ml에서 콜라 II 희석. 상쾌한, 취소 및 전단지 피해 자들은 문화 접시/플라스 크에 따라 전송 (표 1).</li>
	<li>문화 문화 매체, confluency 37 ° C, 5% (이산화탄소) CO2, 존재에 도달할 때까지 5-7 일에 대 한 피해 자들은 후 72 h 매체를 변경. 생체 외에서 실험에 사용에 대 한 통행 최대 5 배까지 일단 confluency에 도달 100% 합니다.</li>
</ol>4입니다. 쥐 피해자의 석 회화의 유도
참고: 모든 실험, 세포는 hemocytometer 포함.
<ol><li>시드 및 오염을 방지 하기 위해 소독된 후드에 뿌리고 모든 1 차 셀을 수행 합니다. 기본 쥐 피해 자들은 실험 체 외에 석 회화를 준비 하려면 셀 150, 000 셀/잘 6-잘 접시의 조밀도에 씨. ≥ 90 %confluency (일반적으로 72 h)까지 문화 매체에 유지 합니다.</li>
	<li>제어 매체 대 석 회화와 피해자를 취급 하 고 37 ° C, 5% CO2, 추가 72 h에 대 한 존재에서 품 어.</li>
	<li>석 회화 기본 쥐 피해 자들은 후속 다운스트림 분석에 대 한 연구, 석 회화/제어 매체를 제거 하 고 세척 비 바운드 Ca 및 Pi 이온 제거에 워시 버퍼와 monolayers.</li>
</ol>5. 쥐 빅 특성화
<ol><li>Immunostaining vimentin와 α-SMA, 씨앗 150, 000 셀/잘 6 잘 플레이트의 밀도에 쥐 피해 자들은 같은 phenotypic 표식에 대 한 모니터링에 대 한 커버 전표 (셀 커버 전표의 표면에 성장할 것입니다)를 포함 하 고 50 %confluency 성장.</li>
	<li>문화 매체를 발음 하 고 수정 셀 monolayers 4 %paraformaldehyde (PFA)와 10 분 동안 그들 버퍼링 하는 인산 염 (PBS), 3 시간을 세척 하기 전에 5 분 각 시간에 대 한. 주의: PFA 독성 이며 신중 하 게 처리 해야 합니다.</li>
	<li>차단 하 고 permeabilization 버퍼와 셀 단층을 품 어 (1 x PBS, 2 차 항 체로 동일한 종에서 정상적인 혈 청의 5%, 0.3% 트라이 톤 X-100) 실 온에서 1 h.</li>
	<li>마우스 안티 vimentin 및 토끼 안티-α-SMA 항 체 항 체 희석 버퍼에 희석 된 셀 monolayers를 품 어 (1% 소 혈 청 알 부 민 + 0.3 %PBS Triton X-100) 하룻밤 4 ° C에서 부드럽게 흔들어 로커에. 주: 부정적인 컨트롤 비 활용 된 마우스 IgG와 토끼 IgG, 같은 희석을 사용 하 여 테스트 샘플으로 구성 되어 있습니다.</li>
	<li>다음 날, 3 번 5 분 때마다 PBS로 1 차 항 체를 씻어.</li>
	<li>부드럽게 로커에 떨고 실 온에서 1 h에 대 한 2 차 항 체 fluorophore 활용으로 셀 monolayers를 품 어.</li>
	<li>PBS, 3 번 세척 하 고 부드럽게 핀셋 (쥐 피해 자들은 포함)는 coverslips에 밖으로 한 쌍의 집게와 coverslip 포함 4', 6-diamidino-2-phenylindole (DAPI)에와. 4 ° C에서 24 시간 이상 형광 현미경으로 시각화 하기 전에 치료 하는 슬라이드를 둡니다.</li>
	<li>서쪽 오 점 분석에 대 한 150, 000의 밀도에서 피해 자들은 셀/6 잘 플레이트에 잘하고 confluent 100%까지 문화 매체에 성장에 두고 쥐 씨.</li>
	<li>단백질의 8 µ g를 사용 하 여 실행 CD31 표현을 측정 하 여 VEC 오염을 배제 서쪽 오 점. 참고: 앞에서 설명한9표준 서쪽 오 점 프로토콜 미행 했다.</li>
	<li>유전자 연구에 대 한 제조업체의 지침에 따라 상업 키트를 사용 하 여 ribonucleic 산 (RNA)을 추출 합니다.</li>
	<li>반전 녹음 방송을 사용 하 여 대상 유전자 식 연쇄 반응 (PCR)를 사용 하 여 측정 하는 cDNA를 취득 및 실시간 PCR (RT-PCR; 일컬어 정량) 녹색 fluorophore 감지 Gapdh 이전 참조 유전자로 사용 하 여 설명된10.<ol>
<li>다음 프로그램을 사용 하 여 PCR 분석: 30 94 ° C의 30 주기 3 분, 94 ° C의 1 주기 s, 63 ° C 30에 대 한 s, 72 ° C 35 s, 그리고 5 분 동안 72 ° C의 마지막으로 1 사이클.</li>
		<li>다음 프로그램을 사용 하 여 정량 분석: 95의 40 주기 10 분 동안 95 ° C의 1 주기 30 s, 및 95 ° C 30에 대 한 15 초, 1 분, 1 분, 55 ° C 95 ° C의 추가 주기 위한 60 ° C에 ° C s.</li>
	</ol>
</li>
	<li>트리 스/Borate/EDTA (TBE) 버퍼에는 2 %agarose 젤을 사용 하 여 PCR 제품 분석을 젤 전기 이동 법을 실행 합니다.</li>
</ol>6. 쥐 빅 석 회화 연구
<ol><li>알리자린 레드 S 및 생 화 확 적인 석 회화 연구, 4 섹션에 설명 된 시드 및 석 회화 지침을 따르시기 바랍니다.</li>
	<li>5% 붉은 알리자린 S 솔루션, 부드럽게 20 분 통에 락 셀 monolayers 얼룩. 이후 5 분 때마다 증류수 3 번 씻어. 각 잘의 이미지를 취득 합니다.</li>
	<li>생화학 Ca 분석 결과 키트를 사용 하 여 계량 Ca 증 착. 캘리포니아2 + 이온 0.6 M 염 산 (HCl)를 사용 하 여 부드러운 동요와 4 ° C에서 24 h에 대 한 거.</li>
	<li>수확은 상쾌한 측정 분석 결과 Ca를 사용 하 여 Ca 농도 키트 ( 재료의 표참조) 제조 업체의 지침에 따라.</li>
	<li>총 세포질 단백질의 일부분으로 칼슘 농도 계산 합니다. 0.1 M 수산화 나트륨 (NaOH) + 0.1% 나트륨 라우릴 황산 염 (SDS) 세포 monolayers에서 세포질 단백질 변성 제조업체의 지침에 따라 세제 호환 (DC) 단백질 분석을 사용 하 여 총 단백질 농도 결정 합니다.</li>
</ol>

<ol><li>Dweck, M. R., Boon, N. a, Newby, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Calcific+aortic+stenosis%3A+a+disease+of+the+valve+and+the+myocardium%5BTitle%5D)+AND+%22J+Am+Coll+Cardiol%22%5BJournal%5D)">Calcific aortic stenosis: a disease of the valve and the myocardium.</a> J Am Coll Cardiol. 60 (19), 1854-1863 (2012).</li>
<li>Freeman, R. V., Otto, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Spectrum+of+calcific+aortic+valve+disease%3A+Pathogenesis%2C+disease+progression%2C+and+treatment+strategies%5BTitle%5D)+AND+%22Circulation%22%5BJournal%5D)">Spectrum of calcific aortic valve disease: Pathogenesis, disease progression, and treatment strategies.</a> Circulation. 111, 3316-3326 (2005).</li>
<li>Mohler, E. R., Gannon, F., Reynolds, C., Zimmerman, R., Keane, M. G., Kaplan, F. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Bone+formation+and+inflammation+in+cardiac+valves%5BTitle%5D)+AND+%22Circulation%22%5BJournal%5D)">Bone formation and inflammation in cardiac valves.</a> Circulation. 103 (11), 1522-1528 (2001).</li>
<li>Monzack, E. L., Masters, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Can+valvular+interstitial+cells+become+true+osteoblasts%3F+A+side-by-side+comparison%5BTitle%5D)+AND+%22J+Heart+Valve+Dis%22%5BJournal%5D)">Can valvular interstitial cells become true osteoblasts? A side-by-side comparison.</a> J Heart Valve Dis. 20 (4), 449-463 (2011).</li>
<li>Osman, L., Yacoub, M. H., Latif, N., Amrani, M., Chester, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Role+of+human+valve+interstitial+cells+in+valve+calcification+and+their+response+to+atorvastatin%5BTitle%5D)+AND+%22Circulation%22%5BJournal%5D)">Role of human valve interstitial cells in valve calcification and their response to atorvastatin.</a> Circulation. 114 (Suppl 1), (2006).</li>
<li>Gu, X., Masters, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Role+of+the+Rho+pathway+in+regulating+valvular+interstitial+cell+phenotype+and+nodule+formation%5BTitle%5D)+AND+%22Am+J+Physiol+Heart+Circ+Physiol%22%5BJournal%5D)">Role of the Rho pathway in regulating valvular interstitial cell phenotype and nodule formation.</a> Am J Physiol Heart Circ Physiol. 300 (2), H448-H458 (2011).</li>
<li>Rodriguez, K. J., Masters, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Regulation+of+valvular+interstitial+cell+calcification+by+components+of+the+extracellular+matrix%5BTitle%5D)+AND+%22J+Biomed+Mater+Res+A%22%5BJournal%5D)">Regulation of valvular interstitial cell calcification by components of the extracellular matrix.</a> J Biomed Mater Res A. 90 (4), 1043-1053 (2009).</li>
<li>Rattazzi, M., Iop, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Clones+of+interstitial+cells+from+bovine+aortic+valve+exhibit+different+calcifying+potential+when+exposed+to+endotoxin+and+phosphate%5BTitle%5D)+AND+%22Arterioscler+Thromb+Vasc+Biol%22%5BJournal%5D)">Clones of interstitial cells from bovine aortic valve exhibit different calcifying potential when exposed to endotoxin and phosphate.</a> Arterioscler Thromb Vasc Biol. 28 (12), 2165-2172 (2008).</li>
<li>Zhu, D., Hadoke, P. W. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ablation+of+the+androgen+receptor+from+vascular+smooth+muscle+cells+demonstrates+a+role+for+testosterone+in+vascular+calcification%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">Ablation of the androgen receptor from vascular smooth muscle cells demonstrates a role for testosterone in vascular calcification.</a> Sci Rep. 6 (April), 24807(2016).</li>
<li>Zhu, D., Mackenzie, N. C. W., Millan, J. L., Farquharson, C., Macrae, V. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Upregulation+of+IGF2+expression+during+vascular+calcification%5BTitle%5D)+AND+%22J+Mol+Endocrinol%22%5BJournal%5D)">Upregulation of IGF2 expression during vascular calcification.</a> J Mol Endocrinol. 52 (2), 77-85 (2014).</li>
<li>Latif, N., Quillon, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Modulation+of+human+valve+interstitial+cell+phenotype+and+function+using+a+fibroblast+growth+factor+2+formulation%5BTitle%5D)+AND+%22PLoS+ONE%22%5BJournal%5D)">Modulation of human valve interstitial cell phenotype and function using a fibroblast growth factor 2 formulation.</a> PLoS ONE. 10 (6), (2015).</li>
<li>Liu, A. C., Joag, V. R., Gotlieb, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+emerging+role+of+valve+interstitial+cell+phenotypes+in+regulating+heart+valve+pathobiology%5BTitle%5D)+AND+%22Am+J+Pathol%22%5BJournal%5D)">The emerging role of valve interstitial cell phenotypes in regulating heart valve pathobiology.</a> Am J Pathol. 171 (5), 1407-1418 (2007).</li>
<li>Katwa, L. C., Ratajska, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Angiotensin+converting+enzyme+and+kininase-II-like+activities+in+cultured+valvular+interstitial+cells+of+the+rat+heart%5BTitle%5D)+AND+%22Cardiovasc+Res%22%5BJournal%5D)">Angiotensin converting enzyme and kininase-II-like activities in cultured valvular interstitial cells of the rat heart.</a> Cardiovasc Res. 29 (1), 57-64 (1995).</li>
<li>Shao, J. S., Cheng, S. L., Pingsterhaus, J. M., Charlton-Kachigian, N., Loewy, A. P., Towler, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Msx2+promotes+cardiovascular+calcification+by+activating+paracrine+Wnt+signals%5BTitle%5D)+AND+%22J+Clin+Invest%22%5BJournal%5D)">Msx2 promotes cardiovascular calcification by activating paracrine Wnt signals.</a> J Clin Invest. 115, 1210-1220 (2005).</li>
<li>Mackenzie, N. C. W., Zhu, D., Longley, L., Patterson, C. S., Kommareddy, S., MacRae, V. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((MOVAS-1+cell+line%3A+a+new+in+vitro+model+of+vascular+calcification%5BTitle%5D)+AND+%22Int+J+Mol+Med%22%5BJournal%5D)">MOVAS-1 cell line: a new in vitro model of vascular calcification.</a> Int J Mol Med. 27, 663-668 (2011).</li>
<li>Kiffer-Moreira, T., Yadav, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Pharmacological+inhibition+of+PHOSPHO1+suppresses+vascular+smooth+muscle+cell+calcification%5BTitle%5D)+AND+%22J+Bone+Miner+Res%22%5BJournal%5D)">Pharmacological inhibition of PHOSPHO1 suppresses vascular smooth muscle cell calcification.</a> J Bone Miner Res. 28, 81-91 (2013).</li>
<li>Cui, L., Rashdan, N. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((End+stage+renal+disease-induced+hypercalcemia+may+promote+aortic+valve+calcification+via+Annexin+VI+enrichment+of+valve+interstitial+cell+derived-matrix+vesicles%5BTitle%5D)+AND+%22J+Cell+Physio%22%5BJournal%5D)">End stage renal disease-induced hypercalcemia may promote aortic valve calcification via Annexin VI enrichment of valve interstitial cell derived-matrix vesicles.</a> J Cell Physio. , (2017).</li>
<li>Tsang, H., et al. Exploiting novel valve interstitial cell lines to study calcific aortic valve disease. Mol Med Rep. , In press (2017).</li>
</ol>

저자는 공개 없다.

이 상세한 프로토콜 기본 쥐 피해 자들은, 효소 소화를 통해 쥐 심장 밸브에서 이러한 셀의 사용의 수집에 대 한 실제적인 방법을 설명 합니다. 우리의 방법은 더 지원 하 고 관상동맥 밸브 석 회화13연구 모델 생체 외에서 이전에 보고 된 쥐의 사용을 확장 합니다. 대동맥 밸브에서 피해자의 격리 이웃 VECs에서 오염에 대 한 가능성을 소개합니다. 그러나, 우리의 면역 형광 검사 데이터 초기 소화 단계 고립 된 세포를 내 피 세포 마커, CD31 부정적인 렌더링 VECs 제거 충분 한지 확인 합니다. 또한, α-SMA 얼룩 확인는 피해자의 활성화 형은 석 회화12필요 합니다.
빅 격리 이전에 보고 된 큰 동물 모델6,,78. 그러나, 이러한 종 다운스트림 연구로 전 세계 실험실에서 그들의 제한 된 액세스에 사용할 수 있는 제한 된 유전 및 분자 도구에 의해 제약 됩니다. 반면, 이러한 도구를 쉽게 사용할 수 있는 설치류에 따라서 능력을 분리 쥐 파생 된 피해자 수는 큰 실험 설계 용량 잘 설립 있습니다. 젊은 쥐에서 피해자의 사용 또한 세포는 상대적으로 더 오래 된 쥐, 따라서 더 많은 세포를 더 적은 동물이 요구 보다 증식을 의미 합니다. 마우스는 쉽게 액세스할 수, 하지만 쥐 때문 특히 작은 마음, 격리 하는 데 기본 마우스의 피해자 더 많은 시간이 소요 될 것 이라고 하 고 상당히 많은 동물 쥐 모델 셀의 동일한 수익률을 격리 하는 데 필요한 것입니다.
이 기술된 접근의 중요 한 이점은 피해 자들은 야생 종류와 유전자 변형 쥐 뿐만 아니라 심혈 관 질환과 밸브 상해의 쥐 모델에서 일시적으로 고립 될 수 있다 이다. 쥐 모델을 사용 하 여 필요 동물의 더 큰 수 대규모 실험, 따라서 동물 사용을 줄이기 위해, 그것을 잘 특징은 일단 셀 라인 생산 주 쥐 피해 자들은 변형 될 수 있다.
CAVD의 심각한 임상 의미 널리 인식 하 고, 하는 동안 근본적인 원인이 메커니즘은 아직 확인할 수 있다. 또한, 효과적인 약물 치료를 방지 하 고 잠재적으로 관상동맥 밸브 석 회화 치료 수 있습니다에서 사용할 수 있습니다 선물. 석 회화 조건 아래 피해자의 문화는 그러므로 CAVD의 관련성이 높은 생체 외에서 모델을 제공 합니다. 우리는 높은 Ca 및 Pi 수준 osteogenic 유전자 마커 Msx2, Alpl및 Phospho1의 표현에 수 반하는 증가 가진 고립 된 쥐 피해자의 체 외에 석 회화 유도 보여. 그것은 널리 이러한 마커 혈관 석 회화14,,1516의 병 적인 프로세스와 관련 된 설립. 우리의 데이터는 따라서 쥐 피해 자들은 중간 석 회화에 문화는 관상동맥 밸브 석 회화 시험관을 공부 하는 적절 한 모델을 보여준다. 실제로, 우리의 실험실에서 최근 연구는 캘리포니아 빅 파생 매트릭스 소포17의 Annexin VI 농축을 통해 관상동맥 밸브 석 회화 촉진 입증이 모델을 활용 하 고 있다.
쥐 피해 자들은 그들의 효율적인 특성을 사용 하 여의 혜택에도 불구 하 고 몇 가지 제한이 여전히 존재 한다. 첫째, 쥐 밸브 내 빅 인구의 크기는 매우 작습니다, 그리고 따라서 많은 동물 광범위 한 생체 외에서 연구에 대 한 충분 한 셀 번호를 생성 하기 위해 필요. 그러나, 그것은 불멸 하 게 밸브 중간 셀 라인, 최근에18, 우리가 보고 하 고 이후 주 문화를 고용 확인 하 고 이러한 연구 결과 확장 사업 예비 연구 하 여이 제한을 극복 하기 위해 가능 하다.
요약, 설명된 방법 성공적인 절연, 문화, 및 기본 쥐 수 있습니다 이후에 평가 분석을 포함 한 생 화 확 적인 분석 실험 단백질 및 RNA 분석의 다양 한을 사용 하 여 피해자의 석 회화를 설명 합니다. 이 모델 CAVD에서 생체 외에서조사 하는 안정적이 고 편리한 시스템 고이 파괴적인 질병에 대 한 책임 분자 메커니즘을 조사에 대 한 유용한 도구를 제공 합니다.

건강 한 관상동맥 밸브는 밸브의 개폐 중 기계적 스트레스의 분포는 똑같이 apportioned 세 전단지의 구성 됩니다. 밸브 전단은 3 개의 명료한 층의 정의 구조: fibrosa, spongiosa, 및 ventricularis, 어떤 집 우위 한 세포 유형으로 중간 셀 (피해 자들은) 밸브. 이러한 3 개의 계층 밸브 내 피 세포 (VECs)1의 두 침대 사이 끼워 넣으면 됩니다.
피해자의 Calcific 대동맥 밸브 석 회화 (CAVD), 서방 세계에서 가장 일반적인 심장 밸브 질병 진행에서 중요 한 역할을 한다. CAVD은 적극적으로 판 막 병 조직과 그 주변 microenvironment에 의해 규제 진보적인 조건으로 설명 되어 있습니다. 세포질 변화는 처음 거리 두껍게, 그리고 결국 대동맥 밸브 전단의 광범위 한 석 회화 발생할. 이 다음 중요 한 관상동맥 밸브 협 착 증에 지도 하 고 궁극적으로, 왼쪽 심 실 유출 방해2, 떠나는 유일한 치료로 수술 밸브 교체.
CAVD의 이상 복잡 하지만 생리 뼈 강화 작용3비슷한 메커니즘을 공유 합니다. 연구의 숫자 osteogenic 트랜스-차별화 및 석 회화4,5을 피해자의 능력을 보여 준, 하는 동안이 과정을 underpinning 메커니즘은 아직 완전히 해명 될 강조는 모델을 실현 하 고 관련 생체 외에서 CAVD의 중요 한 요구 사항입니다.
실험실 수로 이전 작업, 돼지와 소 모델에서 피해자를 고립 된 성공적으로 있으며 조건6,,78석 회화에서이 세포 배양. 이러한 모델에 관상동맥 밸브의 큰 크기로 인해 효소 소화를 통해 세포의 고립 세포의 순수한 인구 생성에 매우 효과적인 되었습니다. 그러나,이 모델은 대형 동물 종에 대 한 분자 도구의 한정 된 가용성으로 인해 제한 수 있습니다. 대조적으로, 설치류 모델 상대적으로 낮은 비용, 유전자 조작에 대 한 잠재력 및 분자 도구를 쉽게 사용할 수의 광범위 한 배열 유리한 유지. 그러나, 작은 동물 모델에서 피해자의 격리 하지 널리 채택 된다, 작은 조직 샘플을 작업할 때 발생 하는 어려움의 가능성이 결과입니다.
이 상세한 프로토콜 쥐 피해자의 직접 격리에 대 한 포괄적인 방법을 보고합니다. 밸브, 일련의 효소 소화 다음의 주의 해 부에 의해 피해자는 절연 고 실험 기법, 셀 문화, 석 회화, 및 진 식 등의 다양 한 고용 될 수 있습니다. CAVD의 모델 관련성이 높은 생체 외에서 이 의심할 여 지 없이이 병 적인 과정의 우리의 지식을 증가에 필수적인 기여를 하게된다.

<table><tbody><tr><td>Dissection scissors</td><td>World Precision Instruments</td><td>14393</td><td>Autoclave before use.</td></tr><tr><td>Spring straight (8 mm blade)</td><td>World Precision Instruments</td><td>15905</td><td>Autoclave before use.</td></tr><tr><td>SuperFine Vannas scissors (5 mm blade, 8 cm)</td><td>World Precision Instruments</td><td>14003</td><td>Autoclave before use.</td></tr><tr><td>Dumont #5 tweezers (11 cm)</td><td>World Precision Instruments</td><td>500342</td><td>Autoclave before use.</td></tr><tr><td>DMEM-F12</td><td>Thermo Fisher Scientific</td><td>11320074</td><td></td></tr><tr><td>Foetal bovine serum</td><td>Thermo Fisher Scientific</td><td>10500064</td><td>Filter before adding to culture medium.</td></tr><tr><td>Gentamicin</td><td>Thermo Fisher Scientific</td><td>15710049</td><td></td></tr><tr><td>Absolute ethanol</td><td>Thermo Fisher Scientific</td><td>E/0650DF/17</td><td>Dilute to 70% v/v in distilled water.</td></tr><tr><td>Hydrochloric acid (HCl)</td><td>Thermo Fisher Scientific</td><td>H1150PB17</td><td>Dilute to 0.6M with distilled water.</td></tr><tr><td>Sodium hydroxide (NaOH)</td><td>Thermo Fisher Scientific</td><td>UN1823</td><td>Dilute to 0.1M with distilled water.</td></tr><tr><td>DAPI</td><td>Thermo Fisher Scientific</td><td>P36931</td><td></td></tr><tr><td>Alexa Fluor 594 goat anti-mouse antibody</td><td>Thermo Fisher Scientific</td><td>A11005</td><td>1/250 dilution in antibody dilution buffer.</td></tr><tr><td>Alexa Fluor 488 donkey anti-rabbit antibody</td><td>Thermo Fisher Scientific</td><td>A21206</td><td>1/250 dilution in antibody dilution buffer.</td></tr><tr><td>Superscript II kit</td><td>Thermo Fisher Scientific</td><td>18064014</td><td></td></tr><tr><td>dNTP</td><td>Thermo Fisher Scientific</td><td>18427013</td><td></td></tr><tr><td>Random primers</td><td>Thermo Fisher Scientific</td><td>P/N58875</td><td></td></tr><tr><td>Taq Polymerase kit</td><td>Thermo Fisher Scientific</td><td>18038026</td><td></td></tr><tr><td>Tris/Borate/EDTA (TBE)</td><td>Thermo Fisher Scientific</td><td>AM9863</td><td>Dilute to 1x with distlled water, before use.</td></tr><tr><td>Agarose</td><td>Thermo Fisher Scientific</td><td>16500</td><td>2% in 1x Tris/Borate/EDTA(TBE).</td></tr><tr><td>Lysis buffer (RIPA)</td><td>Thermo Fisher Scientific</td><td>89900</td><td></td></tr><tr><td>T75 flask</td><td>Thermo Fisher Scientific</td><td>156472</td><td></td></tr><tr><td>T175 flask</td><td>Thermo Fisher Scientific</td><td>159920</td><td></td></tr><tr><td>qPCR plates</td><td>Thermo Fisher Scientific</td><td>AB0990</td><td></td></tr><tr><td>Rat Msx2 primer</td><td>Qiagen</td><td>QT01084090</td><td></td></tr><tr><td>Rat Alpl primer</td><td>Qiagen</td><td>QT00190680</td><td></td></tr><tr><td>Rat Enpp1 primer</td><td>Qiagen</td><td>QT00181426</td><td></td></tr><tr><td>RNeasy minikit</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>6-well plates</td><td>Sigma</td><td>CLS3516</td><td></td></tr><tr><td>T25 flask</td><td>Sigma</td><td>CLS430639</td><td></td></tr><tr><td>Monobasic phosphate</td><td>Sigma</td><td>S5011</td><td></td></tr><tr><td>Dibasic phosphate</td><td>Sigma</td><td>S5136</td><td></td></tr><tr><td>Calcium chloride</td><td>Sigma</td><td>C1016</td><td></td></tr><tr><td>Sodium dodecyl sulphate (SDS)</td><td>Sigma</td><td>5030</td><td>Dilute to 0.1% with 0.1M NaOH.</td></tr><tr><td>Paraformaldehyde</td><td>Sigma</td><td>P6148</td><td>Dilute to 4% with PBS.</td></tr><tr><td>Triton X100</td><td>Sigma</td><td>X100</td><td></td></tr><tr><td>Bovine serum albumin (BSA)</td><td>Sigma</td><td>A3059</td><td></td></tr><tr><td>Alizarin red S</td><td>Sigma</td><td>A5533</td><td>Make up to 2% with distilled water, and adjust to pH 4.2.</td></tr><tr><td>TGF&amp;beta;-1 primer pair: f: GCTACCATGCCAACTTCTGT r: TGTGTTGGTTGTAGAGGGCA</td><td>Sigma</td><td></td><td>Concentration used: 10 &amp;mu;M</td></tr><tr><td>TGF&amp;beta;-2 primer pair: f: GAAGGCAGAGTTCAGGGTCT r: CGCTGGGTTGGAGATGTTAG</td><td>Sigma</td><td></td><td>Concentration used: 10 &amp;mu;M</td></tr><tr><td>Monoclonal Anti-&amp;beta;-Actin&amp;minus;Peroxidase antibody produced in mouse</td><td>Sigma</td><td>A3854</td><td>1/50000 dilution in 5% BSA in tris-buffered saline + 0.1% Tween (TBS/T).</td></tr><tr><td>Mouse anti-vimentin antibody</td><td>Sigma</td><td>v6389</td><td>1/900 dilution in &lt;strong&gt;antibody dilution buffer&lt;/strong&gt; (1x phosphate buffered saline (PBS), 1% bovine serum albumin (BSA), 0.3% Triton X-100).</td></tr><tr><td>Mouse IgG</td><td>Sigma</td><td>I5381</td><td>Diluted to the same stock concentration as mouse anti-vimentin antibody prior to dilution in antibody dilution buffer.</td></tr><tr><td>Rabbit IgG</td><td>GeneTex</td><td>GTX35035</td><td>Diluted to the same stock concentration as rabbit anti-&amp;alpha;-smooth muscle actin antibody prior to dilution in antibody dilution buffer.</td></tr><tr><td>Rabbit anti-&amp;alpha;-smooth muscle actin antibody</td><td>Abcam</td><td>ab5694</td><td>1/200 dilution in antibody dilution buffer.</td></tr><tr><td>Rabbit anti-CD31</td><td>Abcam</td><td>ab28364</td><td>1/50 dilution in 5% BSA inTBS/T.</td></tr><tr><td>HRP-conjugated goat anti-rabbit antibody</td><td>Dako</td><td>P0448</td><td>1/3000 dilution in in 5% BSA in TBS/T.</td></tr><tr><td>Collagenase II</td><td>Worthington</td><td>41512862</td><td>Adjust to 425 U/mL with distilled water, and then filter.</td></tr><tr><td>SYBR green mastermix</td><td>Primerdesign</td><td>PrecisionPLUS-MX-SY</td><td></td></tr><tr><td>Calcium assay kit</td><td>Randox</td><td>CA590</td><td></td></tr><tr><td>DC protein assay kit</td><td>Bio-Rad</td><td>5000111</td><td></td></tr><tr><td>ECL reagent</td><td>GE Healthcare</td><td>RPN2109</td><td></td></tr><tr><td>Hyperfilm ECL</td><td>GE Healthcare</td><td>28906837</td><td></td></tr><tr><td>Nitrocellulose membrane</td><td>GE Healthcare</td><td>10600007</td><td></td></tr><tr><td>PCR ladder</td><td>Bioline</td><td>BIO-33057</td><td></td></tr><tr><td>Loading dye for gel electrophoresis</td><td>New England Biolabs</td><td>B7025S</td><td></td></tr><tr><td>Syringe filters (0.22 &amp;mu;m)</td><td>Merck Millipore</td><td>SLGP033RS</td><td></td></tr><tr><td>Coverslips</td><td>Scientific Laboratory Supplies LTD</td><td>MIC3100</td><td></td></tr><tr><td>Hematocytometer</td><td>Marienfeld Superior</td><td>640030</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Camera set up for Alizarin red images:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Camera</td><td>Nikon D800</td><td></td><td></td></tr><tr><td>Lens</td><td>Nikon AF_s Micro, Nikko 105 mm, 1:2.8 GED</td><td></td><td></td></tr><tr><td>Dissection forceps 10 cm, curved ends</td><td>World Precision Instruments</td><td>15915</td><td>Autoclave before use.</td></tr></tbody></table>

isolation and characterization of primary rat valve interstitial cells: a new model to study aortic valve calcification

Calcific 대동맥 밸브 질환 (CAVD) 대동맥 밸브 전단의 진보적인 두껍게 특징 이다. 그것은 노인 및 끝 단계 신장 질병 (ESRD) 환자, 일반적으로 hyperphosphatemia와 아 고통에서 자주 발견 하는 조건이 다. 현재,의 진행을 막을 수 없습니다 약물 요법이 있다. 이 병 적인 과정의 기반이 되는 메커니즘은 불분명 남아 있다. 대동맥 밸브 전단 밸브 중간 셀 (피해자)는 VECs 사이 대동맥 cusps의 외부 표면에 얇은 층의 밸브 내 피 세포 (VECs)로 구성 된다. 쥐 모델의 사용에는 vivo에서 physiopathological 혈 청 인산 (Pi) 및 hyperphosphatemia와 아에서 고통 받는 환자의 칼슘 (Ca) 수준에 따라 소성 석 회화의 생체 외에서 연구를 수 있습니다. 설명된 프로토콜 세부 순수한 쥐 빅 인구의 빅 표시자의 식에 의해 표시 된 대로: 알파-부드러운 근육 걸 (α-SMA) vimentin 및 조직 성장 인자 베타 (TGFβ) 1과 2, 그리고 차별화 (CD) 31, 한 VEC의 클러스터의 부재 표식입니다. 이러한 피해자를 확대 하 여 연구 하 고 해명 CAVD underpinning 키 중재자 생화학, 유전, 및 이미징 연구를 수행할 수 있습니다.

이 프로토콜의 목표 기본 쥐 피해자의 격리를 설명 하 고 석 회화 실험 체 외에 문화를 했다. 위에서 설명한 방법을 사용 하 여 쥐 피해 자들은 성공적으로 고립 되 고 CAVD에 대 한 책임 메커니즘의 연구에 대 한 확장.
쥐 주 피해자 공동 설립된 빅 마커 지역화:
격리 된 셀 빅 형 빅 표식에 대 한 면역 형광 검사를 통해 확인 했다: vimentin와 α-SMA (빨간색과 녹색, 각각 그림 1A), 이전 보고서11,12계약입니다. 비 활용 된 마우스와 토끼 IgG 사용 하 여 대표 부정적인 컨트롤 그림 1B에서 표시 됩니다. 또한, 빅-성장 레 귤 레이 터 TGFβ-1 TGFβ-2의 식 PCR 분석 (그림 1C)을 사용 하 여 확인 되었다. 서쪽 오 점 분석 그 쥐를 확인 하기 위해 수행 되었다, 고립 된 쥐 주 피해자 했다 내 피 오염에서 무료로 확인 피해 자들은 부정 했다 CD31, 내 피 세포 표식에 대 한 긍정적인 제어 ( 로 개 mitral VECs를 사용 하 여 그림 1D).
Ca와 Pi 쥐 빅 석 회화 유도:
높은 조직의 Ca 또는 Pi 농도 일반적으로 피해자 체 외의 석 회화를 드라이브. 피해 자들은 격리 된 쥐의 석 회화 가능성, 감사 셀 ESRD 환자에서 병 적인 아 및 hyperphosphatemia 조건 모방 Ca와 Pi의 높은 수준에 노출 되었다. 2.7 m m Ca/2.5 m m 파이와 피해자의 치료 유도 석 회화, 알리자린 레드 S Ca 증 착 (그림 2A)와 HCl (81 배; leaching 다음 Ca 레벨의 색도계 결정에 대 한 얼룩에 의해 결정 되 학생의 t를 사용 하 여 p < 0.05-테스트; 그림 2B)입니다.
진 식 변경 빅 석 회화와 관련 된:
생체 외에서 혈관 세포의 석 회화 별개 분자 프로 파일에 연결 됩니다. 현재 연구에서 2.7 m m Ca/2.5 m m 파이와 피해자의 치료 osteogenic 마커의 mRNA 식에 상당한 증가 유발: Msh homeobox 2, Msx2 (2.04 배 변화; p < 0.01; 그림 3A), 알칼리 성 인산 가수분해 효소, Alpl (1.49 배 변화; p < 0.001; 그림 3B), 및 phosphoethanolamine/phosphocholine 인산 가수분해 효소, Phospho1 (4.7 배 변화; p < 0.01 일방통행 ANOVA;를 사용 하 여 그림 3C)입니다. 그러나, osteogenic 표식, Runx2및 석 회화 억제 물 ectonucleotide pyrophasphatase, Enpp1의 식을 그대로 (그림 3D-E) 남아 있었다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56126/56126fig1.jpg"> 그림 1입니다. 빅 마커의 식. (A) 면역 형광 밸브 중간 셀 (피해자)에 더블 얼룩, 알파-부드러운 근육 말라 (α-SMA; 녹색)와 vimentin의 colocalization를 보여주는. (B) 마우스와 토끼 IgG 사용 하 여 부정적인 컨트롤의 대표 이미지. 핵은 블루 4', 6-diamidino-2-phenylindole를 사용 하 여 (DAPI)에 물 들 다. 눈금 막대 = 50 µ m. (C) 변형 시키는 성장 인자 beta 1 (TGFβ-1)의 존재와 피해자에 TGFβ-2 (차선 1-3) PCR 분석에 의해 표시 된 대로. 레인 4 물 컨트롤입니다. 사용 하는 참조 유전자 Gapdh이었다입니다. (D) 서쪽 오 점 분석 CD31의 풍부한 식 식이 없는 피해자에 비해 개 승 모 판 내 피 세포 (VECs)에서 보여주는. <a href="//cloudflare.jove.com/files/ftp_upload/56126/56126fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56126/56126fig2.jpg"> 그림 2입니다. 쥐 피해 자들은의 석 회화 생체 외에서 . 피해 자들은 증 착 Ca 치료 2.7 m m Ca/2.5 m m Pi에 따라: (A) 사진 보여주는 알리자린 레드 S 잘, 그리고 (B) HCl leaching 다음 Ca 레벨의 색도계 결정에 전체 셀 monolayers의 얼룩. 학생의 t-테스트 두 데이터 그룹 간의 의미 분석을 수행 했다. 결과 ± S.E.M.를 의미 하는 대로 표시 됩니다 *p < 0.5 제어;와 비교 (n = 4).
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56126/56126fig3.jpg"> 그림 3입니다. 빅 석 회화와 관련 된 유전자 표현 변경. Msx2(A), (B) Alpl, (C) Phospho1, (D) Runx2, 배 osteogenic 마커의 mRNA 식에서 변경 하 고 (E) Enpp1 피해자에서 Ca/2.5 m m에 대 한 Pi 2.7 m m로 치료 48 h. mRNA 식 생 참조 유전자에 비해 배 변화로 표시 됩니다 Gadph. 쌍 단위 비교를 통합 하는 일반 선형 모델을 사용 하 여 단방향 ANOVA 여러 그룹 간의 의미 분석을 수행 했습니다. 결과 ± S.E.M.를 의미 하는 대로 표시 됩니다 * *p < 0.01; p < 0.001 제어;에 비해 (n = 6). <a href="//cloudflare.jove.com/files/ftp_upload/56126/56126fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>밸브 전단의 수</td>
			<td>문화 접시/플라스 크</td>
		</tr>
<tr>
<td>9 ~ 15</td>
			<td>1 12-잘 접시에 잘</td>
		</tr>
<tr>
<td>15 ~ 30</td>
			<td>6 잘 플레이트에서 1</td>
		</tr>
<tr>
<td>30 +</td>
			<td>T25</td>
		</tr>
</tbody></table>표 1. 초기 시드에 필요한 전단지의 번호에 대 한 일반적인 지침.

Watch this Scientific Journal Video about Isolation and Characterization of Primary Rat Valve Interstitial Cells: A New Model to Study Aortic Valve Calcification at JoVE.com

Isolation and Characterization of Primary Rat Valve Interstitial Cells: A New Model to Study Aortic Valve Calcification

절연 및 기본 쥐의 밸브 중간 세포: 관상동맥 밸브 석 회화를 공부 하는 새로운 모델

이 프로토콜 절연, 문화, 및 석 회화의 쥐 파생 밸브 중간 셀의 calcific 대동맥 밸브 질환 (CAVD)의 높은 생리 적 체 외에서 모델에 설명합니다. 이 쥐 모델의 착취 셀 및 분자 메커니즘이 복잡 한 병 적인 과정을 기초에 CAVD 연구를 촉진 한다.

Calcific aortic valve disease (CAVD) is characterized by the progressive thickening of the aortic valve leaflets. It is a condition frequently found in ...

isolation-characterization-primary-rat-valve-interstitial-cells-new

Research

JoVE Journal

Developmental Biology

9.7K 조회수.  University of Edinburgh. 이 프로토콜 절연, 문화, 및 석 회화의 쥐 파생 밸브 중간 셀의 calcific 대동맥 밸브 질환 (CAVD)의 높은 생리 적 체 외에서 모델에 설명합니다. 이 쥐 모델의 착취 셀 및 분자 메커니즘이 복잡 한 병 적인 과정을 기초에 CAVD 연구를 촉진 한다.

비디오: Isolation and Characterization of Primary Rat Valve Interstitial Cells: A New Model to Study Aortic Valve Calcification

Isolation of Valvular Endothelial Cells

Heart valves are solely responsible for maintaining unidirectional blood flow through the cardiovascular system. These thin, fibrous tissues are subjected to significant mechanical stresses as they open and close several billion times over a lifespan. The incredible endurance of these tissues is due to the resident valvular endothelial (VEC) and interstitial cells (VIC) that constantly repair and remodel in response to local mechanical and biological signals. Only recently have we begun to understand the unique behaviors of these cells, for which in vitro experimentation has played a key role. Particularly challenging is the isolation and culture of VEC. Special care must be used from the moment the tissue is removed from the host through final plating. Here we present protocols for direct isolation, side specific isolation, culture, and verification of pure populations of VEC. We use enzymatic digestion followed by a gentle swab scraping technique to dislodge only surface cells. These cells are then collected into a tube and centrifuged into a pellet. The pellet is then resuspended and plated into culture flasks pre-coated with collagen I matrix. VEC phenotype is confirmed by contact inhibited growth and the expression of endothelial specific markers such as PECAM1 (CD31), Von Willebrand Factor (vWF), and negative expression of alpha-smooth muscle actin (&alpha;-SMA). The functional characteristics of VEC are associated with high levels of acetylated LDL. Unlike vascular endothelial cells, VEC have the unique capacity to transform into mesenchyme, which normally occurs during embryonic valve formation1. This can also occur during significantly prolonged post confluent in vitro culture, so care should be made to passage at or near confluence. After VEC isolation, pure populations of VIC can then be easily acquired.

We provide a method for isolating and culturing pure populations of heart valve endothelial cells (VEC). VEC can be isolated from either side of the cusp or leaflet and immediately following, underlying interstitial cell (VIC) isolation is straightforward.

판막병 내피 세포의 분리

Heart valves are solely responsible for maintaining unidirectional blood flow through the cardiovascular system.  These thin, fibrous tissues are ...

연구

생물학

Calcification of Vascular Smooth Muscle Cells and Imaging of Aortic Calcification and Inflammation

Cardiovascular disease is the leading cause of morbidity and mortality in the world. Atherosclerotic plaques, consisting of lipid-laden macrophages and calcification, develop in the coronary arteries, aortic valve, aorta, and peripheral conduit arteries and are the hallmark of cardiovascular disease. In humans, imaging with computed tomography allows for the quantification of vascular calcification; the presence of vascular calcification is a strong predictor of future cardiovascular events. Development of novel therapies in cardiovascular disease relies critically on improving our understanding of the underlying molecular mechanisms of atherosclerosis. Advancing our knowledge of atherosclerotic mechanisms relies on murine and cell-based models. Here, a method for imaging aortic calcification and macrophage infiltration using two spectrally distinct near-infrared fluorescent imaging probes is detailed. Near-infrared fluorescent imaging allows for the ex vivo quantification of calcification and macrophage accumulation in the entire aorta and can be used to further our understanding of the mechanistic relationship between inflammation and calcification in atherosclerosis. Additionally, a method for isolating and culturing animal aortic vascular smooth muscle cells and a protocol for inducing calcification in cultured smooth muscle cells from either murine aortas or from human coronary arteries is described. This in vitro method of modeling vascular calcification can be used to identify and characterize the signaling pathways likely important for the development of vascular disease, in the hopes of discovering novel targets for therapy.

Vascular calcification is an important predictor of and contributor to human cardiovascular disease. This protocol describes methods for inducing calcification of cultured primary vascular smooth muscle cells and for quantifying calcification and macrophage burden in animal aortas using near-infrared fluorescence imaging.

대동맥 석회화와 염증의 혈관 평활근 세포 및 이미지의 석회화

Cardiovascular disease is the leading cause of morbidity and mortality in the world.  Atherosclerotic plaques, consisting of lipid-laden macrophages and ...

의학

Investigating Aortic Valve Calcification via Isolation and Culture of T Lymphocytes using Feeder Cells from Irradiated Buffy Coat

Calcific aortic valve disease (CAVD), an active disease process ranging from mild thickening of the valve to severe calcification, is associated with high mortality, despite new therapeutic options such as transcatheter aortic valve replacement (TAVR). 
The complete pathways that start with valve calcification and lead to severe aortic stenosis remain only partly understood. By providing a close representation of the aortic valve cells in vivo, the assaying of T lymphocytes from stenotic valve tissue could be an efficient way to clarify their role in the development of calcification. After surgical excision, the fresh aortic valve sample is dissected in small pieces and the T lymphocytes are cultured, cloned then analyzed using fluorescence activated cell sorting (FACS).
The staining procedure is simple and the stained tubes can also be fixed using 0.5% of paraformaldehyde and analyzed up to 15 days later. The results generated from the staining panel can be used to track changes in T cell concentrations over time in relation to intervention and could easily be further developed to assess activation states of specific T cell subtypes of interest. In this study, we show the isolation of T cells, performed on fresh calcified aortic valve samples and the steps of analyzing T cell clones using flow cytometry to further understand the role of adaptive immunity in CAVD pathophysiology.

In this study, we describe the process of T lymphocyte isolation from fresh samples of calcified aortic valves and the analytical steps of T cell-cloning for the characterization of the adaptive leukocyte subsets by using flow cytometry analysis.

조사 된 버피 코트에서 피더 세포를 사용하여 T 림프구의 격리 및 배양을 통해 대동맥 밸브 석회화 조사

Calcific aortic valve disease (CAVD), an active disease process ranging from mild thickening of the valve to severe calcification, is associated with high ...

면역학 및 감염병학

Isolation of Murine Valve Endothelial Cells

Normal valve structures consist of stratified layers of specialized extracellular matrix (ECM) interspersed with valve interstitial cells (VICs) and surrounded by a monolayer of valve endothelial cells (VECs). VECs play essential roles in establishing the valve structures during embryonic development, and are important for maintaining life-long valve integrity and function. In contrast to a continuous endothelium over the surface of healthy valve leaflets, VEC disruption is commonly observed in malfunctioning valves and is associated with pathological processes that promote valve disease and dysfunction. Despite the clinical relevance, focused studies determining the contribution of VECs to development and disease processes are limited. The isolation of VECs from animal models would allow for cell-specific experimentation. VECs have been isolated from large animal adult models but due to their small population size, fragileness, and lack of specific markers, no reports of VEC isolations in embryos or adult small animal models have been reported. Here we describe a novel method that allows for the direct isolation of VECs from mice at embryonic and adult stages. Utilizing the Tie2-GFP reporter model that labels all endothelial cells with Green Fluorescent Protein (GFP), we have been successful in isolating GFP-positive (and negative) cells from the semilunar and atrioventricular valve regions using fluorescence activated cell sorting (FACS). Isolated GFP-positive VECs are enriched for endothelial markers, including CD31 and von Willebrand Factor (vWF), and retain endothelial cell expression when cultured; while, GFP-negative cells exhibit molecular profiles and cell shapes consistent with VIC phenotypes. The ability to isolate embryonic and adult murine VECs allows for previously unattainable molecular and functional studies to be carried out on a specific valve cell population, which will greatly improve our understanding of valve development and disease mechanisms.

The ability to isolate heart valve endothelial cells (VECs) is critical for understanding mechanisms of valve development, maintenance, and disease. Here we describe the isolation of VECs from embryonic and adult Tie2-GFP mice using FACS that will allow for studies determining the contribution of VECs in developmental and disease processes.

쥐과 밸브 내피 세포의 분리

Normal valve structures consist of stratified layers of specialized extracellular matrix (ECM) interspersed with valve interstitial cells (VICs) and ...

A Simplified Model for Heterotopic Heart Valve Transplantation in Rodents

There is an urgent clinical need for heart valve replacements that can grow in children. Heart valve transplantation is proposed as a new type of transplant with the potential to deliver durable heart valves capable of somatic growth with no requirement for anticoagulation. However, the immunobiology of heart valve transplants remains unexplored, highlighting the need for animal models to study this new type of transplant. Previous rat models for heterotopic aortic valve transplantation into the abdominal aorta have been described, though they are technically challenging and costly. For addressing this challenge, a renal subcapsular transplant model was developed in rodents as a practical and more straightforward method for studying heart valve transplant immunobiology. In this model, a single aortic valve leaflet is harvested and inserted into the renal subcapsular space. The kidney is easily accessible, and the transplanted tissue is securely contained in a subcapsular space that is well vascularized and can accommodate a variety of tissue sizes. Furthermore, because a single rat can provide three donor aortic leaflets and a single kidney can provide multiple sites for transplanted tissue, fewer rats are required for a given study. Here, the transplantation technique is described, providing a significant step forward in studying the transplant immunology of heart valve transplantation.

This protocol describes a simple and efficient method for the transplantation of aortic valve leaflets under the renal capsule to allow for the study of alloreactivity of heart valves.

설치류의 이종 주제 심장 판막 이식을위한 단순화 된 모델

There is an urgent clinical need for heart valve replacements that can grow in children. Heart valve transplantation is proposed as a new type of ...

A Rabbit Aortic Valve Stenosis Model Induced by Direct Balloon Injury

Animal models are emerging as an important tool to understand the pathologic mechanisms underlying aortic valve stenosis (AVS) because of the lack of access to reliable sources of diseased human aortic valves. Among the various animal models, AVS rabbit models are one of the most commonly used in large animal studies. However, traditional AVS rabbit models require a long-term period of dietary supplementation and genetic manipulation to induce significant stenosis in the aortic valve, limiting their use in experimental studies. To address these limitations, a new AVS rabbit model is proposed, in which stenosis is induced by a direct balloon injury to the aortic valve. The present protocol describes a successful technique for inducing AVS in New Zealand white (NZW) rabbits, with step-by-step procedures for the preparation, the surgical procedure, and the post-operative care. This simple and reproducible model offers a promising approach for studying the initiation and progression of AVS and provides a valuable tool for investigating the underlying pathological mechanisms of the disease.

An appropriate animal model is needed to understand the pathologic mechanisms underlying aortic valve stenosis (AVS) and to evaluate the efficacy of therapeutic interventions. The present protocol describes a new procedure for developing the AVS rabbit model via a direct balloon injury in vivo.

직접적인 풍선 손상으로 인한 토끼 대동맥 판막 협착증 모델

Animal models are emerging as an important tool to understand the pathologic mechanisms underlying aortic valve stenosis (AVS) because of the lack of ...

Isolation of Mouse Interstitial Valve Cells to Study the Calcification of the Aortic Valve In Vitro

The calcification of aortic valve cells is the hallmark of aortic stenosis and is associated with valve cusp fibrosis. Valve interstitial cells (VICs) play an important role in the calcification process in aortic stenosis through the activation of their dedifferentiation program to osteoblast-like cells. Mouse VICs are a good in vitro tool for the elucidation of the signaling pathways driving the mineralization of the aortic valve cell. The method described herein, successfully used by these authors, explains how to obtain freshly isolated cells. A two-step collagenase procedure was performed with 1 mg/mL and 4.5 mg/mL. The first step is crucial to remove the endothelial cell layer and avoid any contamination. The second collagenase incubation is to facilitate the migration of VICs from the tissue to the plate. In addition, an immunofluorescence staining procedure for the phenotype characterization of the isolated mouse valve cells is discussed. Furthermore, the calcification assay was performed in vitro by using the calcium reagent measurement procedure and alizarin red staining. The use of mouse valve cell primary culture is essential for testing new pharmacological targets to inhibit cell mineralization in vitro.

Isolation of Mouse Interstitial Valve Cells to Study the Calcification of the Aortic Valve In Vitro

This article describes the isolation of mouse aortic valve cells by a two-step collagenase procedure. Isolated mouse valve cells are important for performing different assays, such as this in vitro calcification assay, and for investigating the molecular pathways leading to aortic valve mineralization.

시험관 내 대동맥 판막의 석회화를 연구하기 위해 마우스 간막판 세포의 격리

The calcification of aortic valve cells is the hallmark of aortic stenosis and is associated with valve cusp fibrosis. Valve interstitial cells (VICs) ...

Isolation of Human Primary Valve Cells for In vitro Disease Modeling

Calcific aortic valve disease (CAVD) is present in nearly a third of the elderly population. Thickening, stiffening, and calcification of the aortic valve causes aortic stenosis and contributes to heart failure and stroke. Disease pathogenesis is multifactorial, and stresses such as inflammation, extracellular matrix remodeling, turbulent flow, and mechanical stress and strain contribute to the osteogenic differentiation of valve endothelial and valve interstitial cells. However, the precise initiating factors that drive the osteogenic transition of a healthy cell into a calcifying cell are not fully defined. Further, the only current therapy for CAVD-induced aortic stenosis is aortic valve replacement, whereby the native valve is removed (surgical aortic valve replacement, SAVR) or a fully collapsible replacement valve is inserted via a catheter (transcatheter aortic valve replacement, TAVR). These surgical procedures come at a high cost and with serious risks; thus, identifying novel therapeutic targets for drug discovery is imperative. To that end, the present study develops a workflow where surgically removed tissues from patients and donor cadaver tissues are used to create patient-specific primary lines of valvular cells for in vitro disease modeling. This protocol introduces the utilization of a cold storage solution, commonly utilized in organ transplant, to reduce the damage caused by the often-lengthy procurement time between tissue excision and laboratory processing with the benefit of greatly stabilizing cells of the excised tissue. The results of the present study demonstrate that isolated valve cells retain their proliferative capacity and endothelial and interstitial phenotypes in culture upwards of several days after valve removal from the donor. Using these materials allows for the collection of control and CAVD cells, from which both control and disease cell lines are established.

This protocol describes the collection of human aortic valves extracted during surgical aortic valve replacement procedures or from cadaveric tissue, and the subsequent isolation, expansion, and characterization of patient specific primary valve endothelial and interstitial cells. Included are important details regarding the processes needed to ensure cell viability and phenotype specificity.

체외 질병 모델링을 위한 인간 일차 판막 세포의 분리

Calcific aortic valve disease (CAVD) is present in nearly a third of the elderly population. Thickening, stiffening, and calcification of the aortic valve ...

Isolation of Mouse Valve Interstitial Cells: An Enzymatic Method to Isolate and Culture VICs from Mouse Aortic Valve

Source: Bouchareb, R. et al. <a href="https://www.jove.com/video/62419" target="_blank">Isolation of Mouse Interstitial Valve Cells to Study the Calcification of the Aortic Valve&#160;In Vitro</a>.&#160;J. Vis. Exp. (2021)
In this video, we demonstrate the isolation of aortic valve interstitial cells from the heart of an adult mouse using a two-step collagenase procedure and their subsequent culture in low volume of growth media.

Isolation of Mouse Valve Interstitial Cells: 마우스 대동맥 판막에서 VIC를 분리하고 배양하는 효소 방법

Source: Bouchareb, R. et al. Isolation of Mouse Interstitial Valve Cells to Study the Calcification of the Aortic Valve&#160;In Vitro.&#160;J. Vis. Exp. ...

JoVE Encyclopedia of Experiments

Rodent Models

Adult

Calcification Assay to Measure Calcium Concentration in Aortic Valve Interstitial Cells

Source: Bouchareb, R. et al., <a href="https://app.jove.com/v/62419">Isolation of Mouse Interstitial Valve Cells to Study the Calcification of the Aortic Valve In Vitro.</a>&#160; J. Vis. Exp. &#160;(2021).
This video demonstrates an assay technique for assessing the calcification of the aortic valve interstitial cells in vitro. The assay helps to quantify the calcium concentration using the arsenazo III reagent, a calcium-sensitive dye that reacts with calcium ions to form a purple-colored calcium-arsenazo complex.

대동맥 판막 간질 세포의 칼슘 농도를 측정하기 위한 석회화 분석

Source: Bouchareb, R. et al., Isolation of Mouse Interstitial Valve Cells to Study the Calcification of the Aortic Valve In Vitro.&#160; J. Vis. Exp. ...