작업 부의 혁신 과학 연구의 노르트라인-베스트팔렌 (주니어 리서치 그룹)에 의해와 시대 그물 신경, JTC 2015 Neurodevelopmental 장애, 줄기 MCD에 의해 지원 되었다.

1입니다. 세대 iPSC의
<ol><li>IPSC 식민지에서 단일 셀 단층 문화의 세대<ol>
<li>지하실 막 추출 물 (공학은) 코팅 6-잘 접시를 준비 합니다. 공학은 2-3 h 4 ° C에서 얼음을 녹여, 찬 Dulbecco의 수정이 글 중간 F12로 희석 (DMEM F12; 1시 50분 희석) 1 mL/희석된 공학은 솔루션의 플레이트 커버, 4 ° c.에 하룻밤 접시를 저장</li>
		<li>매체를 발음 하 고 실내 온도 (RT)에 4 분에 대 한 PBS에 0.5 m m ethylenediaminetetraacetic 산 (EDTA) 식민지를 배양 하기 전에 두 번 버퍼링 하는 인산 염 (PBS)에서 0.5 m EDTA 6 잘 플레이트의 2 우물의 그대로 iPSC 식민지를 씻어. EDTA 솔루션을 발음 하 고 부드럽게 DMEM F12 매체의 5 mL와 함께 접시의 바닥에서 그들을 세척 하 여 식민지를 분리. 15 mL 튜브에 그들을 수집 하 고 원심 (1200 x g RT 4 분)에 의해 작은. 참고: Ipsc 상용 섬유 아 세포에서 재설정10성공적으로 사용된 되었습니다.</li>
		<li>발음은 상쾌한 고 세포 분리 시 약 37 ° c.에 6 분의 500 µ L와 iPSC 식민지를 품 어</li>
		<li>피펫으로 세포 현 탁 액 나머지 세포를 1 mL 피 펫으로 여러 번 부드럽게 위아래로 클러스터 단일 셀으로.</li>
		<li>휴대-분리 시 약 희석 세포 현 탁 액에 DMEM F12의 4 mL를 추가 합니다.</li>
		<li>실시간에서 4 분 동안 1200 x g 에 아래로 셀 회전</li>
		<li>5 µ M와 보충 iPSC 매체의 2 mL에 셀 resuspend Y-27632 및 씨앗 코팅 공학은 6 잘 플레이트의 한 잘에 세포. 참고: 단일 셀 단층 iPSC 문화에 대 한 재료의 테이블에 에서 지정 된 iPSC 매체를 사용 합니다.</li>
		<li>다음 날, Y-27632 부족 신선한 iPSC 매체와 매체를 교체 합니다. 이 시점에서 문화 매체 Ipsc 100% 합칠 때까지 매일 변경 셀을 계속. 셀 라인 시작 웰 스의 confluency에 따라이 2-4 일 소요 됩니다.</li>
		<li>일단 confluent 통로 Ipsc입니다. 중간 발음 하 고 셀에 셀 분리 시 약의 500 µ L를 적용 합니다.</li>
		<li>37 ° c.에 5-10 분에 대 한 셀을 품 어 부드럽게 셀 분리 접시 바위.</li>
		<li>우물에서 세포를 씻어 DMEM F12의 2 개 mL를 사용 하 고 15 mL 튜브에 수집. 5 mL의 전체 볼륨에 대 한 DMEM-f12 키를 추가 합니다.</li>
		<li>1200 x g RT 4 분에 셀 아래로 회전 시키십시오 그리고는 상쾌한 발음.</li>
		<li>씨 셀 5 µ M와 보충 iPSC 매체에는 공학은에 1:4 비율 1: 2에서 Y-27632 코팅 6 잘 플레이트 (2 mL/매체의 우물).</li>
		<li>계속 해 서 2-5 일에 대 한 셀을 문화 부족 Y-27632 매일 iPSC 매체를 변경. 일단 confluent 통로 Ipsc (단계 1.1.4-1.1.8). 참고: IPSC의 세대에 대 한 문화 조건에 맞게 셀 수 있도록 그들을 사용 하기 전에 재료의 테이블에 에서 지정 된 iPSC 매체에 단층으로 적어도 2 구절에 대 한 Ipsc 문화.</li>
	</ol>
</li>
	<li>IPSC의 세대에 대 한 70-90% 합칠 때 단층 iPSC 문화를 사용 합니다. 참고: 단일 셀은 적은 스트레스 경향이 문화 환경에 적응 하는 iPSC 분리 및 집계 절차 동안 세포 죽음에 이르게. 단층 iPSC 문화 차별화의 증거 없는 전형적인 만능 형태를 표시 해야 합니다. Mycoplasma 오염에 대 한 정기적으로 문화를 테스트 합니다. Mycoplasma 무료 iPSC 문화 에서만 작동 합니다.<ol>
<li>6 잘 플레이트의 한 우물에서 문화 매체를 발음 하 고 셀에 셀 분리 시 약의 500 µ L를 적용 합니다.</li>
		<li>37 ° c.에 5-10 분에 대 한 셀을 품 어 부드럽게 셀 분리 접시 바위.</li>
		<li>우물에서 세포를 씻어 DMEM F12의 2 개 mL를 사용 하 고 15 mL 튜브에 수집. 10 ml 전체 볼륨에 대 한 DMEM-f12 키를 추가 합니다.</li>
		<li>셀 계산, 세포 현 탁 액에서 25 µ L를가지고 고 trypan 죽은 세포를 표시 하는 파란색의 25 µ L 함께 섞는다. 세 챔버를 사용 하 여 살아있는 세포를 계산 합니다.</li>
		<li>15 mL 튜브에 세포 현 탁 액에서 충분 한 셀 (4500 iPSC 집계 당)를 수집 합니다.</li>
		<li>1200 x g RT 4 분에 셀 아래로 회전 시키십시오 그리고는 상쾌한 발음.</li>
		<li>50 µ M으로 보충 iPSC 매체의 적절 한 볼륨에 셀 resuspend 150 µ L 당 4500 라이브 세포를 Y-27632. 참고: Y-27632의 높은 농도 사용 하 여 (50 µ M)는 Ipsc의 생존을 위해 중요 하다.</li>
		<li>각 150 µ L 플레이트 플레이트 낮은 첨부 파일 96 잘 U-바닥의 잘 고 37 ° C, 5% CO2배양 기에. 참고: IPSC 집계를 생성할 때에 적어도 6 organoids을 하루 20 (섹션 5 참조)에서 품질 관리에 필요한 것을 하는 것이 좋습니다.</li>
	</ol>
</li>
</ol>2입니다. 앞쪽 Neuroectoderm의 유도
<ol><li>밀접 하 게 iPSC 집계의 형태 변화는 4 배 또는 10 배 전원 렌즈를 사용 하 여 조직 문화 현미경 매일 모니터링 합니다. 하루 1, 명확한 테두리와 셀 집계에서 관찰. 37 ° C, 5% CO2배양 기에서 문화 iPSC 집계를 계속 합니다. 참고: 죽은 세포/잘의 특정 번호는 정상 이며 organoid 세대에는 영향을 미치지 않습니다.</li>
	<li>IPSC 집계 하루 2에서에서 시작 하 고 하단에 셀 집계를 방해 하지 않고 매체의 약 2/3를 부드럽게 발음 하 여 매일 계속 피드. IPSC 매체 Y-27632 부족의 추가 100 µ L를 추가 합니다. 참고: 4-6 일 이내 셀 집계 350-450 µ m 직경에서 고 됩니다 부드러운 가장자리를 전시.</li>
	<li>이 단계에서 수영장 셀 집계 컷 100 µ L 피 펫 팁 낮은 첨부 6 cm 접시 (20 집계/접시의 최대)에 n 2 보충 (1: 200), B27 보충 (1: 100), 포도 당 (0.2 mg/mL), 주기적 DMEM-f12 키를 포함 하는 대뇌 피 질의 유도 매체에 아데노신 monophosphate (캠프, 0.15 µ g/mL), 0.5% 비 본질적인 아미노산 (NEAA), 1 %L-alanyl-L-글루타민, 헤 파 린 (10 µ g/mL), 및 화합물 LDN-193189 (180 nM), A83-01 (500 nM), 및 Wnt 응답-1 (IWR-1)의 억제제 (10 µ g/mL). 6 cm 접시에 그들을 전송한 후 3 일 피 질 유도 매체를 변경 하 여 셀 집계를 피드.</li>
	<li>밀접 하 게 렌즈를 4 X 파워를 사용 하 여 조직 문화 현미경 대뇌 피 질의 유도 중 형태학 상 변화를 모니터링 합니다. 참고: 4-5 일 후에 대뇌 피 질의 유도 매체, 셀 집계의 가장자리 neuroectodermal 차별화를 나타내는 표면에서 밝게 하기 시작 한다. 이 단계에서 pseudostratified 상피의 방사형 조직이 나온다. 공학은 행렬에서 셀 집계를 포함 하는 섹션 3을 진행 합니다.</li>
</ol>3. 매트릭스 비 계에 집계 Neuroectodermal의 포함
<ol><li>공학은 2 3 h. Aliquot undiluted 공학은 충분 한 양 위한 4 ° C에서 얼음에 녹여</li>
	<li>포함 하는 절차에 대 한 플라스틱 파라핀 필름 시트를 준비 합니다. 컷 4 c m x 4 cm 큰 살 균가 위를 사용 하 여 플라스틱 파라핀 영화 조각, 플라스틱의 조각을 넣어 필름 100 µ L 팁에 대 한 빈 100 µ L 팁 트레이 위에 파라핀 그리고 플라스틱 파라핀 필름 시트에 작은 보조 (1 디 만들어집니다 gloved 손가락으로 눌러 mple/셀 집계 필요)입니다. 70% 에탄올과 플라스틱 파라핀 영화 청소 하 고 UV 빛으로 비추는 (전원: 15 와트, 파장: 435 nm) 30 분에 대 한 닫힌된 살 균 벤치에서.</li>
	<li>1.5-2 m m 직경에서 여 100 µ L 컷된 팁을 사용 하 여 플라스틱 파라핀 필름 시트에의 한 보조 개를 각 셀 집계를 전송 합니다. 두 집계 셀 경우에 융합 하는, 그들을 분리 하지 마십시오 하지만 함께 한 보조 개를 그들을 전송.</li>
	<li>부드럽게 발음 한 포경된 100 µ L 피 펫 팁을 사용 하 여 셀 집계를 둘러싼 매체. 참고: 조심 하지 팁에 셀 집계를 빨 아이 집계를 손상 시킬 것 이다.</li>
	<li>각 셀 집계를 undiluted 공학은의 40 µ L를 추가 합니다.</li>
	<li>각 셀은 공학은 중간 집계 포경된 100 µ L 피 펫 팁을 사용 하 여 드롭 위치입니다. 참고: 피 펫 팁 개발 neuroepithelium 해를 하지 매우 주의 해야 합니다.</li>
	<li>조심 스럽게 플라스틱 파라핀 필름 시트 10 cm 배양 접시에 소독 집게 (또는 다른 충분 한 세포 문화 접시)을 사용 하 여 전송 하 고 공고히 공학은 수 있도록 15-20 분 동안 인큐베이터에 접시를 놓고.</li>
	<li>한편, 대뇌 피 질의 유도 매체의 5 mL를 포함 하는 낮은-첨부 6 cm 접시를 준비 합니다.</li>
	<li>공학은의 중 합 후 플라스틱 파라핀 필름 시트에서 셀 집계를 포함 하는 작은 물방울을 제거 합니다. 소독 집게를 사용 하 여 플라스틱 파라핀 영화를 설정 하 고 부드럽게 약간 기울이면에 셀 집계를 짠 다 (약 30 °) 낮은-첨부 6 cm 접시 방울 플라스틱 파라핀 필름 시트를가까지. 1 6 cm 접시에 최대 16 셀 집계를 전송 합니다.</li>
	<li>37 ° c.에서 셀 집계를 품 어 계속</li>
</ol>4. 개 형 Organoids Neuroectodermal 집계에서의 세대
<ol><li>공학은 매트릭스에서 포함 후에 1 일 5 °와 14 rpm, 셀 문화 인큐베이터에 설치의 틸팅 각도와 락 셀 문화 통에 organoid 문화 요리를 놓습니다.</li>
	<li>Organoids 매일 모니터링 합니다. 균질 neuroepithelial 루프와 같은 구조 공학은 매트릭스에 포함 하는 후 점차적으로 개발할 수 있습니다.</li>
	<li>Neuroepithelial 루프 구조 표시 될 때, organoid 차별화 매체 DMEM-F12 n 2 보충 (1: 200), B27 보충 (1: 100), 포도 당 (0.2 mg/mL), 캠프 (0.15 µ g/mL), 0.5%를 포함 하는 매체 변경 NEAA, 1 %L-alanyl-L-글루타민, 인슐린 (2.5 µ g/mL)</li>
	<li>Organoid 차별화 매체 원하는 차별화 시간 지점에이 때까지 3-4 일 마다 교체 합니다. 다음 수정 organoids (섹션 5 참조)입니다. 참고: 때때로, 조직을 루프 구조 없이 광학 반투명 조직의 싹 전시 수 있습니다. 이 이상적 이지만, 이것은 하지에 영향을 대뇌 피 질의 구조 개발. organoids 최대 40 일 동안 organoid 차별화 매체에 경작 될 수 있습니다. 동안 확장된 문화 (40-100 일) 1:50 organoid 차별화 매체를 보완 될 수 있습니다 공학은 조직의 복잡성이 증가 하 고와 BDNF GDNF 신경 생존과 성숙14,15수 있도록.</li>
</ol>5. 고정 및 개 형 Organoids의 유효성 검사
<ol><li>유효성 검사를 위해 하루에 20에서 6 organoids를 수집 합니다. 3 organoids를 사용 하 여 mRNA 격리 및 PCR 분석. 고정 및 순차 immunocytochemical 분석에 대 한 3-3.5 m m의 오프닝 컷된 1 mL 피 펫 팁을 사용 하 여 PBS를 포함 하는 24-잘 접시에 추가 3 organoids를 전송 합니다.</li>
	<li>신중 하 게 PBS 발음과 5 mL 피 펫을 사용 하 여 신선한 PBS와 함께 그것을 대체 하 여 두 번에 organoids을 씻어. 추운 4 %paraformaldehyde (PFA) (pH 7.4)에 15 분 동안 organoids를 수정. 주의: PFA는 알려진된 인간 발암 물질 주의. 모든 작업은 니트 릴 장갑을 끼고 화학 증기 두건에서 수행 되어야 합니다. 안전 안경을 착용 하는 것이 좋습니다. 포름알데히드는 각 막에 돌이킬 수 없는 손상을 일으킬 수 있습니다.</li>
	<li>PFA는 신중 하 게 발음 하 고 씻어 3 시간 10 분 동안 실내 온도 PBS를 사용 하 여.</li>
	<li>30% 자당 해결책 PBS 바꿉니다 (wt/집, PBS 기반) organoids 탈수 있도록 4 ° C에서 샘플을 저장 하 고. Organoids는 추가 처리까지 최대 7 일 동안 저장할 수 있습니다.</li>
	<li>고정, 후에 1 일 미리 cryosectioning 절차 동안에 organoids의 시각화 수 있도록 10 분 약 1시 50분에 trypan blue를 추가 하 여 탈수 organoids 얼룩.</li>
	<li>10% 자당, 7.5% 젤라틴 wt/집 PBS에 포함 된 포함 매체를 준비 하 고 75 ° C까지 액체 따뜻한.</li>
	<li>포함 매체와 30% 자당 해결책을 대체 하 고는 organoids equilibrate에 15 분 동안가 열 플레이트 (60 ° C)에 24-잘 접시를 전송.</li>
	<li>포함 미디어 레이어와 포함 금형의 하단을 커버 하 고 유해를 얼음에 그들을 배치.</li>
	<li>전송 포함을 24-잘 접시에서 organoids 금형 polymerized 포함 매체를 포함 하는 organoids, 커버 된다 고 목욕 (냉동 100% 에탄올/드라이 아이스에서 금형을 신속 하 게 배치 위에 추가 포함 매체 추가 온도-50 ° C-30 사이 여야 합니다) 적어도 1 분 충격 동결.</li>
	<li>일시적으로 드라이 아이스에 집게와 어느 게 그들-80 ° C에 또는 직접 진행 cryosectioning 금형을 놓습니다.</li>
	<li>20 µ m 두께 수집에서 Cryosection organoids 현미경 슬라이드, 유지에 섹션 섹션 순서 슬라이드 (순차적 이해)에 추적 합니다. 섹션-80 ° C에서 그들을 저장 하거나 직접 immunocytochemical 얼룩을 수행 하기 전에 몇 시간 동안 슬라이드에 건조를 허용 합니다.</li>
</ol>

<ol><li>Otani, T., Marchetto, M. C., Gage, F. H., Simons, B. D., Livesey, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((2D+and+3D+Stem+Cell+Models+of+Primate+Cortical+Development+Identify+Species-Specific+Differences+in+Progenitor+Behavior+Contributing+to+Brain+Size%5BTitle%5D)+AND+%22Cell+Stem+Cell%22%5BJournal%5D)">2D and 3D Stem Cell Models of Primate Cortical Development Identify Species-Specific Differences in Progenitor Behavior Contributing to Brain Size.</a> Cell Stem Cell. 18 (4), 467-480 (2016).</li>
<li>Fietz, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((OSVZ+progenitors+of+human+and+ferret+neocortex+are+epithelial-like+and+expand+by+integrin+signaling%5BTitle%5D)+AND+%22Nat+Neurosci%22%5BJournal%5D)">OSVZ progenitors of human and ferret neocortex are epithelial-like and expand by integrin signaling.</a> Nat Neurosci. 13 (6), 690-699 (2010).</li>
<li>Hansen, D. V., Lui, J. H., Parker, P. R., Kriegstein, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Neurogenic+radial+glia+in+the+outer+subventricular+zone+of+human+neocortex%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Neurogenic radial glia in the outer subventricular zone of human neocortex.</a> Nature. 464 (7288), 554-561 (2010).</li>
<li>Shi, Y., Kirwan, P., Smith, J., Robinson, H. P., Livesey, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Human+cerebral+cortex+development+from+pluripotent+stem+cells+to+functional+excitatory+synapses%5BTitle%5D)+AND+%22Nat+Neurosci%22%5BJournal%5D)">Human cerebral cortex development from pluripotent stem cells to functional excitatory synapses.</a> Nat Neurosci. 15 (3), 477-486 (2012).</li>
<li>Lancaster, M. A., Knoblich, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Organogenesis+in+a+dish%3A+modeling+development+and+disease+using+organoid+technologies%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Organogenesis in a dish: modeling development and disease using organoid technologies.</a> Science. 345 (6194), 1247125(2014).</li>
<li>Eiraku, M., Sasai, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Self-formation+of+layered+neural+structures+in+three-dimensional+culture+of+ES+cells%5BTitle%5D)+AND+%22Curr+Opin+Neurobiol%22%5BJournal%5D)">Self-formation of layered neural structures in three-dimensional culture of ES cells.</a> Curr Opin Neurobiol. 22 (5), 768-777 (2012).</li>
<li>Camp, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Human+cerebral+organoids+recapitulate+gene+expression+programs+of+fetal+neocortex+development%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Human cerebral organoids recapitulate gene expression programs of fetal neocortex development.</a> Proc Natl Acad Sci U S A. 112 (51), 15672-15677 (2015).</li>
<li>Quadrato, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cell+diversity+and+network+dynamics+in+photosensitive+human+brain+organoids%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Cell diversity and network dynamics in photosensitive human brain organoids.</a> Nature. 545 (7652), 48-53 (2017).</li>
<li>Kelava, I., Lancaster, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Stem+Cell+Models+of+Human+Brain+Development%5BTitle%5D)+AND+%22Cell+Stem+Cell%22%5BJournal%5D)">Stem Cell Models of Human Brain Development.</a> Cell Stem Cell. 18 (6), 736-748 (2016).</li>
<li>Iefremova, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+Organoid-Based+Model+of+Cortical+Development+Identifies+Non-Cell-Autonomous+Defects+in+Wnt+Signaling+Contributing+to+Miller-Dieker+Syndrome%5BTitle%5D)+AND+%22Cell+Rep%22%5BJournal%5D)">An Organoid-Based Model of Cortical Development Identifies Non-Cell-Autonomous Defects in Wnt Signaling Contributing to Miller-Dieker Syndrome.</a> Cell Rep. 19 (1), 50-59 (2017).</li>
<li>Chambers, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Highly+efficient+neural+conversion+of+human+ES+and+iPS+cells+by+dual+inhibition+of+SMAD+signaling%5BTitle%5D)+AND+%22Nat+Biotechnol%22%5BJournal%5D)">Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling.</a> Nat Biotechnol. 27 (3), 275-280 (2009).</li>
<li>Kadoshima, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Self-organization+of+axial+polarity%2C+inside-out+layer+pattern%2C+and+species-specific+progenitor+dynamics+in+human+ES+cell-derived+neocortex%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">Self-organization of axial polarity, inside-out layer pattern, and species-specific progenitor dynamics in human ES cell-derived neocortex.</a> Proc Natl Acad Sci U S A. 110 (50), 20284-20289 (2013).</li>
<li>Lancaster, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cerebral+organoids+model+human+brain+development+and+microcephaly%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Cerebral organoids model human brain development and microcephaly.</a> Nature. 501 (7467), 373-379 (2013).</li>
<li>Qian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Brain-Region-Specific+Organoids+Using+Mini-bioreactors+for+Modeling+ZIKV+Exposure%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Brain-Region-Specific Organoids Using Mini-bioreactors for Modeling ZIKV Exposure.</a> Cell. 165 (5), 1238-1254 (2016).</li>
<li>Lancaster, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Guided+self-organization+and+cortical+plate+formation+in+human+brain+organoids%5BTitle%5D)+AND+%22Nat+Biotechnol%22%5BJournal%5D)">Guided self-organization and cortical plate formation in human brain organoids.</a> Nat Biotechnol. , (2017).</li>
<li>Yamaguchi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Phosphorylation+by+Cdk1+induces+Plk1-mediated+vimentin+phosphorylation+during+mitosis%5BTitle%5D)+AND+%22J+Cell+Biol%22%5BJournal%5D)">Phosphorylation by Cdk1 induces Plk1-mediated vimentin phosphorylation during mitosis.</a> J Cell Biol. 171 (3), 431-436 (2005).</li>
<li>Heidebrecht, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((p100%3A+a+novel+proliferation-associated+nuclear+protein+specifically+restricted+to+cell+cycle+phases+S%2C+G2%2C+and+M%5BTitle%5D)+AND+%22Blood%22%5BJournal%5D)">p100: a novel proliferation-associated nuclear protein specifically restricted to cell cycle phases S, G2, and M.</a> Blood. 90 (1), 226-233 (1997).</li>
<li>Kosodo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Regulation+of+interkinetic+nuclear+migration+by+cell+cycle-coupled+active+and+passive+mechanisms+in+the+developing+brain%5BTitle%5D)+AND+%22EMBO+J%22%5BJournal%5D)">Regulation of interkinetic nuclear migration by cell cycle-coupled active and passive mechanisms in the developing brain.</a> EMBO J. 30 (9), 1690-1704 (2011).</li>
<li>Lancaster, M. A., Knoblich, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Generation+of+cerebral+organoids+from+human+pluripotent+stem+cells%5BTitle%5D)+AND+%22Nat+Protoc%22%5BJournal%5D)">Generation of cerebral organoids from human pluripotent stem cells.</a> Nat Protoc. 9 (10), 2329-2340 (2014).</li>
<li>Chenn, A., Walsh, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Regulation+of+cerebral+cortical+size+by+control+of+cell+cycle+exit+in+neural+precursors%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Regulation of cerebral cortical size by control of cell cycle exit in neural precursors.</a> Science. 297 (5580), 365-369 (2002).</li>
<li>Bagley, J. A., Reumann, D., Bian, S., Levi-Strauss, J., Knoblich, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Fused+cerebral+organoids+model+interactions+between+brain+regions%5BTitle%5D)+AND+%22Nat+Methods%22%5BJournal%5D)">Fused cerebral organoids model interactions between brain regions.</a> Nat Methods. , (2017).</li>
<li>Birey, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Assembly+of+functionally+integrated+human+forebrain+spheroids%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Assembly of functionally integrated human forebrain spheroids.</a> Nature. 545 (7652), 54-59 (2017).</li>
</ol>

저자는 공개 없다.

뇌 organoids 관련 종 배경 및 조직 컨텍스트에서 셀의 복잡 한 3 차원 배열을 제공 하는 때 인간 두뇌 개발에서 체 외에 공부를 위한 강력한 도구를 나타냅니다. 함께, 그들은 인간이 아닌 동물 모델 및 reductionist 인간의 2 차원 단층 세포 문화 기술 간의 격차 다리. 그러나 그들의 응용 프로그램은,, 재현성9의 부족에 의해 방해 됩니다. 요소를 패턴화 하 그들의 순종과 iPSC의 자기 조직 능력을 결합 하 여 큰 샘플 샘플 변화를 극복 하는 개 형 organoid 프로토콜을 개발 했습니다. 특히, Ipsc 자기 조직화를 촉진 하 고 이후에 TGF-ß/SMAD 문화 BMP (LDN-193189)를 노출 하 여 등 피 질 차별화를 촉진 하는 신호를 억제를 집계 했다 그리고 TGF-β 유형 I 수용 체 억제제 (A83-01). 또한, Wnt 통로 (IWR) posteriorization를 방지 하기 위해 억제 하는 화합물은 적용 했다. '본질적인' 대뇌 organoid 프로토콜19, 달리는 기반 자기 집합 오히려 다른 유형의 뇌 organoids를 야 기한 및 큰 일괄 변화 전시 외부 제어 없이 (측정의 효율성에 의해 편광 신경 ectoderm 대형15), 인간의 Ipsc에서 균질 개 특정 organoids를 생성 하는 reproducibly 여기에 설명 된 프로토콜.
이러한 개 형 organoids neurodevelopmental 연구, 유전자 기능 연구, 진화 연구와 같은 응용 프로그램의 다양 한 사용할 수 있습니다 질병 모델링 하 고, 잠재적으로, 마약 테스트 및 치료 목적으로. 그러나 프로토콜은,, 인간 대뇌 피 질의 발달의 초기 측면 검사에 가장 적합 한. 예를 들어 vRGC 행동의 인간-특정 측면을 검토 하 개 형 organoids를 사용 했습니다. 좀 더 구체적으로, lissencephaly, 인간 대뇌 피 질의 기형 대뇌 피 질의 접는의 근처 부재에 의해 특징의 심한 형태와 관련 된 병 태 생리 변화 해결 했다. 이 질병의 특정 측면에만 마우스 두뇌는 자연스럽 게 lissencephalic 쥐에서 모델링 될 수 있습니다. Lissencephaly 환자 파생 Ipsc organoid 시스템 적용 때 우리가 안정적으로 질병의 인간-특정 측면을 정리 하 고 근본적인 메커니즘을 식별 수 있습니다. 좀 더 구체적으로, 우리가 수 환자에서 파생 된 organoids vRGCs의 비대칭 세포 분열을 대칭에서 스위치에 의해 발생 하는 크기에 상당한 감소를 보여 보여 줍니다. 이 스위치 관련 vRGCs' microtubule 네트워크, VZ 틈새의 건축의 중단의 조직에서 변경 된 및 N-cadherin/β-catenin의 장애인된 활성화로 이어지는 세포 접착 분자의 표현을 변경 신호 축10. 참고: vRGC 부문 모드의 β-catenin-종속 규칙 인간-특정 쥐에서 β-catenin의 overexpression 접선 피 확장을 리드 하 고 이후20접는 대뇌 피 질의를 제안 했다. 따라서, 우리의 데이터는 개 형 organoid 시스템 유망한 도구 초기 대뇌 피 질의 개발에 생체 외에서의 인간-특정 측면 정량 방식으로 공부를 나타내는 강조 표시 합니다.
미래에 대 한 주요 도전은 더 성숙한 신경 고기를 달성 하기 위해 연장된 기간에 걸쳐는 organoids의 동질성을 유지 하는 것 이다. 이 다음 중 하나 이상에 의해 실현 될 수 있습니다: 생물 반응 기 시스템14에 organoids 경작,15, 신경 성장 또는 신경 생존 요인 차별화 매체를 보충 투어 부동 적용. 마지막으로, 뇌 복잡성 증가 제어 다른 지역 정체성21,22의 대뇌 organoids와 개 형 organoids 융합에 의해 달성 될 수 있습니다.
함께 찍은, 여기 개 형 organoid 프로토콜 초기 대뇌 피 질의 구조 체 외의 세대는 쉽게 적용 하 고 신뢰할 수 있는 도구를 제공 합니다. 프로토콜 제공 iPSC 여러 줄에 걸쳐 매우 균질 초기 대뇌 피 질의 조직에 상승 하 고 안정적으로 개인 특정 대뇌 피 질의 조직 생성에 이용 될 수 있다. 따라서, 시스템은 동질성 및 질병 모델링 등 재현성의 높은 학위를 필요로 하는 응용 프로그램에 특히 적합 합니다.

인간의 두뇌는 명확 하 게 가장 복잡 한 기관 중 하나 이며 모든 인간의 지적 능력에 대 한 책임. 따라서, 인간 특정 두뇌 개발의 깊은 이해 인간 인지 능력의 이해를 위한 중요 한 전제 조건입니다. 전통적으로, 유전자 변형 동물 모형 유기 체 공부 두뇌 개발을 역임 했습니다. 이러한 모델 두뇌 개발의 원리에 대 한 근본적인 통찰력을 제공합니다. 우리는 지금 모든 포유류에서 두뇌 개발의 일반적인 기능은 조상 확산, 성체, 그리고 신경 마이그레이션의 정확한 안무는 알고 있다. 그러나 중요 한 모형 유기 체는 피 질에서 특히 인간과 설치류 등의 두뇌 구조 차이,, 있다. 영장류의 대뇌 피 질의 발전에 기여할 제안 하는 기본 메커니즘은 외부 광선 명과 세포 (oRGCs), 설치류1에에서 매우 드물게 발견 되는의 생성 뿐만 아니라 줄기와 조상 세포의 증가 확산 ,2,3.
모델 인간의 대뇌 피 질을 개발 하는 방법으로 단층 문화 PSC 파생 telencephalic 조상 세포와 대뇌 피 질 프로젝션 뉴런의 생성을 포함합니다. 이러한 차별화를 표준화 프로토콜 대뇌 피 질의 신경 신생4의 틀에 박힌 시간적 순서 같은 인간 대뇌 피 질의 발달의 특정 측면을 재생. 그러나 그들은,,가 짧은 공간 패턴 등 morphogenesis organogenesis의 개발 프로세스의 재현 부에 관해서. 줄기 세포 생물학에서 최근 개발 생체 외에서 인간 organogenesis의 연구에 혁명을 일으키고는 Psc에서 3D organoid 문화의 설립에 지도 했다. Organotypic 구조로 구성 자체에 Psc의 용량을 활용 하 여, 신장, 용기, 눈, 그리고 두뇌의 포함 하는 기관의 키 구조 고 기능 속성을 반영 하는 다양 한 organoids 설립된5되었습니다. 그런 organoids는 그룹화 및 공간 개발 기관 vivo에서5,6매우 유사한 구성 여러 기관 특정 세포 하위 포함 되어 있습니다. 또한, 셀 구성, 혈통 관계, 유전자 네트워크 연구 단일 셀 RNA 시퀀싱을 사용 하 여 밝혀 인간의 대뇌 organoids 충실 하 게 유전자 표현 프로그램 등 인간의 태아 피 질 개발의 주요 측면 정리 7 , 그러나 8. 방해 그들의 광범위 한 응용 프로그램을 지금까지, 하나의 주요 결점은,, 큰 일괄 배치 변화와 organoid organoid이9.
여기, 우리는 간단 하 고 표준화 된 개 타입 organoid 문화 시스템에 대 한 상세한 프로토콜을 제공합니다. 이 시스템의 주요 기능은 효율적으로 그리고 reproducibly 생성 하는지 거의 독점 등 telencephalic 정체성의 PSC 파생 된 organoids입니다. 프로토콜은 우리의 최근 셀 보고서 종이10에 사용 되는 메서드를 기반으로 합니다. 그것은 대뇌 피 질의 neuroepithelium의 선택적 유도 Ipsc의 자기 조직 능력을 결합 하 고 견고 하 게 3 주. 이내 초기 지 telencephalic 조직의 균질 문화를 생성할 수 있습니다. 이전에 보고 된 SMAD 신호 및 Wnt 억제 전략을 포함 하는 매트릭스와 조합에 이전 neuroectodermal 계보11,12 쪽으로 PSC의 차별화 가이드를 바탕으로 프로토콜 크고 연속 neuroepithelial 구조13의 형성을 촉진합니다. 성공적으로 다양 한 iPSC 라인, 개인 당 여러 클론에 설명 된 방법을 사용 했습니다. 우리는이 시스템은 재현성 및 동질성 질병 모델링 등 주요 중요성은 다운스트림 응용 프로그램에 대 한 적합 한 보였다. 때 심각한 대뇌 피 질의 기형으로 고통 받아 환자에서 파생 Ipsc 프로토콜 적용, 생체 외에서 질병의 병 적인 특징을 정리 하 고 선도 하는 phenotypic 새로운 분자 메커니즘을 식별 하 수 있었습니다. 10으로 변경합니다. 설명된 organoid 프로토콜 reductionist PSC 파생 대뇌 피 질의 단층 문화와 학문 vivo에서 , 사이 간격을 이용 될 수 있다 그리고 그것은 안정적이 고 안정 된 세포 기반 모델 시스템 초기 시뮬레이션을 대표 하는 것이 좋습니다. 건강과 질병 인간의 몸 밖에 서 인간의 대뇌 피 질의 개발.

<table><tbody><tr><td>A83-01</td><td>StemGent</td><td>130-106-274</td><td>500 nM</td></tr><tr><td>B27 Supplement</td><td>Gibco</td><td>17504-044</td><td>1 to 100</td></tr><tr><td>Basement membrane extract (e.g. Geltrex)</td><td>Gibco</td><td>A14132-02</td><td></td></tr><tr><td>Cyclic adenosine monophosphate (cAMP)</td><td>Sigma-Aldrich</td><td>A9501</td><td>0.15 &amp;micro;g/mL</td></tr><tr><td>Cell-dissociation reagent (TrypLE Express)</td><td>Gibco</td><td>12605028</td><td></td></tr><tr><td>Counting chamber e.g. Fuchs-Rosenthal</td><td>Karl Hecht</td><td>40449001</td><td></td></tr><tr><td>D-Glucose</td><td>Carl Roth</td><td>HN06.3</td><td>0.2 mg/mL</td></tr><tr><td>DMEM-F12 L-Glutamin</td><td>Gibco</td><td>11320033</td><td></td></tr><tr><td>Embedding molds (Tissue-Tek Cryomold)</td><td>Sakura Finetek</td><td>4565</td><td></td></tr><tr><td>Ethylenediaminetetraacetic acid</td><td>Sigma-Aldrich</td><td>E6511</td><td>0.5 mM&amp;nbsp;</td></tr><tr><td>Gelantin</td><td>Sigma-Aldrich</td><td>G1890</td><td></td></tr><tr><td>Heparin</td><td>Sigma-Aldrich</td><td>H3149-25KU</td><td>10 ug/mL</td></tr><tr><td>Inhibitor of WNT response (IWR-1)</td><td>Enzo Life Science</td><td>BML-WN103-0005</td><td>10 ug/mL</td></tr><tr><td>Insulin</td><td>Sigma-Aldrich</td><td>91077C</td><td>2.5 &amp;micro;g/mL</td></tr><tr><td>IPSC medium for monolayer cultures (Pluripro)</td><td>Cell Guidance Systems</td><td>MK01</td><td></td></tr><tr><td>L-alanyl-L-glutamine (GlutaMax)</td><td>Gibco</td><td>35050038</td><td>1%</td></tr><tr><td>Low-adhesion 6 cm plates</td><td>Labomedic</td><td>2081646L</td><td></td></tr><tr><td>Low-adhesion 10 cm plates</td><td>Labomedic</td><td>2081646O</td><td></td></tr><tr><td>LDN-193189</td><td>Miltenyi Biotec</td><td>130-104-171</td><td>180 nM</td></tr><tr><td>N2 Supplement</td><td>Gibco</td><td>17502-048</td><td>1 to 200</td></tr><tr><td>Non-essential amino acids</td><td>Gibco</td><td>11140035</td><td>0.50%</td></tr><tr><td>Paraformaldehyde</td><td>Sigma-Aldrich</td><td>P6148</td><td>4.00%</td></tr><tr><td>Phosphate buffered saline (PBS)</td><td>Gibco</td><td>14190144</td><td></td></tr><tr><td>Plastic paraffin film (Parafilm)</td><td>BRAND GMBH + CO KG</td><td>701606</td><td></td></tr><tr><td>ROCK inhibitor Y-27632</td><td>Cell Guidance Systems</td><td>SM02-100</td><td>5 &amp;micro;M or 50 &amp;micro;M</td></tr><tr><td>Sucrose</td><td>Sigma-Aldrich</td><td>S7903</td><td></td></tr><tr><td>Tubes 15 mL</td><td>Corning Life Sciences</td><td>734-0451&amp;nbsp;</td><td></td></tr><tr><td>Microscope Slides e.g. Superfrost Plus Microscope Slides</td><td>Thermo Scientific</td><td>4951PLUS4</td><td></td></tr><tr><td>Tissue culture 6 well plate</td><td>Falcon</td><td>734-0019</td><td></td></tr><tr><td>Tissue culture 24 well plate</td><td>Falcon</td><td>734-0949</td><td></td></tr><tr><td>Trypan blue stain</td><td>Gibco</td><td>15250-061</td><td></td></tr><tr><td>Ultra-low-binding 96 well lipidure-coat plate A-U96</td><td>Amsbio</td><td>AMS.51011610</td><td></td></tr><tr><td>Antibodies</td><td></td><td></td><td></td></tr><tr><td>Sox2</td><td>R&amp;amp;D Systems</td><td>MAB2018</td><td></td></tr><tr><td>Pax6</td><td>Covance</td><td>PRB-278P-100</td><td></td></tr><tr><td>Otx2</td><td>R&amp;amp;D Systems</td><td>ab9566</td><td></td></tr><tr><td>Emx1</td><td>Sigma</td><td>HPA006421</td><td></td></tr><tr><td>N-cadherin</td><td>BD</td><td>610921</td><td></td></tr><tr><td>ZO-1</td><td>Life Tech</td><td>61-7300</td><td></td></tr><tr><td>P-Vimentin</td><td>Biozol</td><td>D076-3</td><td></td></tr><tr><td>Tpx2</td><td>Novus Biologicals</td><td>NB500-179</td><td></td></tr><tr><td>Acetylated &amp;alpha;-tubulin&amp;nbsp;</td><td>NEB/CS</td><td>5335</td><td></td></tr><tr><td>Alexa488 anti ms</td><td>Invitrogen</td><td>A11001</td><td></td></tr><tr><td>Alexa488 anti rb</td><td>Invitrogen</td><td>A11008</td><td></td></tr><tr><td>Alexa555 anti ms</td><td>Invitrogen</td><td>A21424</td><td></td></tr><tr><td>Alexa555 anti rb</td><td>Invitrogen</td><td>A21429</td><td></td></tr></tbody></table>

generation of standardized and reproducible forebrain-type cerebral organoids from human induced pluripotent stem cells

인간의 대뇌 피 질 높은 확장 및 인식 등 더 높은 두뇌 기능을 제공 하는 특정 기능 영역, 복잡 한 구조를 전시. 인간의 대뇌 피 질 개발을 연구 하는 노력 모델 시스템의 가용성에 의해 제한 되어 있다. 종의 차이 의해 제한 된다 인간 시스템에 설치류 학문에서 결과 번역 하 고 인간의 기본 조직에 대 한 연구 윤리 문제 뿐 아니라 조직의 가용성의 부족에 의해 방해 된다. 최근 개발 인간 만능 줄기 세포 (PSC) 기술에 3 차원 (3D) 자기 조직 organotypic 문화 시스템을 모방 하는 특정 정도 인간 특정 두뇌 개발에 생체 외에서생성을 포함 합니다. 현재, 다양 한 프로토콜 중 뇌 또는 뇌 영역 특정 organoids의 생성에 대 한 사용할 수 있습니다. 방법은에서 균질 하 고 재현할 수 개-유형 organoids의 생성 PSC (iPSC), 우리가 이전에 설립을 유도 하 고 여기에, 설명 결합 자체 향해 가이드 차별화로 정리 하는 PSC의 기본 능력은 이전 neuroectodermal 계보 그리고 연속 neuroepithelium의 형성을 지원 하기 위해 포함 하는 행렬. 이 프로토콜을 포함 하는 좀 더 구체적으로: (1) iPSC 집계, confluent 단층 문화; iPSC 식민지의 변환 등의 세대 (2) 앞쪽 neuroectoderm;의 유도 (3) 행렬 비 계;에서 neuroectodermal의 포함 (4) 개 형 organoids neuroectodermal 집계;에서 생성 (5) 고정 및 개 형 organoids의 유효성 검사. 따라서,이 프로토콜은 표준화 되 고 재현 iPSC 파생 대뇌 피 질의 조직 구조에서 생체 외에서의 세대에 대 한 쉽게 적용 가능한 시스템을 제공합니다.

일반적으로 여기에 설명 된 표준된 개 형 organoid 프로토콜에서에서 생성 하는 거의 독점적으로 등 쪽 외피 정체성의 매우 동질적인 organoid 문화 인간의 Ipsc 재배 ( 그림 1 에 설명 된 프로토콜의 20 일 이내 A). 정의 된 프로토콜의 시간 과정 동안 여러 가지 품질 관리 단계를 수행 하는 것이 좋습니다 여기로: (계속 분화 과정) ' 가'와 '노' (차선 문화, 것이 좋습니다 일괄 처리를 종료) (그림 1 ). 그것은 또한 잘 이미지와 메모를 복용 하 여 품질 관리의 각 단계를 문서화 하는 것이 좋습니다.
개 형 organoids 생성의 첫 번째 중요 한 단계 높은 품질 iPSC 문화 시작 하는 것입니다. Ipsc 차별화 된 세포의 큰 분수를 포함 하지 않습니다 중요 하다. 만 현재 iPSC 문화를 사용 하 여 (그림 1B, C) 시작 인구에 미 분화 세포의 단일 단층으로. 또한, iPSC 집계에 대 한 특정된 휴대폰 번호와 함께 시작 하는 결정적 이다. 하루에 2 iPSC 집계의 첫번째 상세한 검사를 수행 합니다. 이 단계에서 집계 형성 해야한다 소형 셀 싹 매끄러운 가장자리 ('가')으로 불규칙 한 나타나는 집계 또는 충 치와 집계 폐기 ('아니오인') (그림 1D, E) 해야 하는 반면. 다음 품질 관리 단계 하루 10의 프로토콜에서 수행 되어야 합니다. 이 시간 포인트에서 셀 집계 표시 해야 부드럽고 광학 반투명 조직 같은 조직의 부재 나타냅니다 차선 신경 유도 하는 반면 neuroectoderm ('가')의 유도 대표 하는 외부 표면에 ('노') (그림 1 층 G ). 반투명 표면 (그림 1F) 하는 집계만 공학은 매트릭스에 포함 한다. 일단 내장, 피 질 organoids 연속 neuroepithelial 루프와 같은 구조를 신속 하 게 확장 됩니다 개발할 것입니다. 여부는 organoids 개발된 편광된 신경 ectoderm 그림 1H, J ('가')에서 같이 조사 하 여 15 일과 20 일에 대뇌 피 질의 유도의 효율성을 분석. 경우는 organoids을 개발 하지 않은 같은 neuroepithelial 싹 ('노' 그림 1I, K에서볼 수 있듯이), 비판적으로 문제 해결을 위해 수행된 품질 관리 단계를 수정 합니다. 밀접 하 게 다음 프로토콜, 고도로 표준화 organoid 일괄 처리 될 때 생성 (그림 2A, B), ectoderm 신경 형성 및 배치 (그림 2C)에서 편광이 ≥ 90% 균질에 표시 됩니다. 편광된 신경 ectoderm 형성의 가변 효율으로 이어지는 일반적인 실수 iPSC 집계에 대 한 시작 셀 번호를 증가 하는 또는 시작으로 낮은-품질 iPSC 문화와 mycoplasma 같은 오염 문화 또는 문화를 포함 하는 세포 분화.
생성 된 organoids의 telencephalic 등의 상세한 유효성 검사는 하루에 20에서 수행 되어야 합니다. 이 위해, 3 organoids 고정 고 면역 형광 분석에 사용 될 해야 합니다. 층 화 neuroepithelial 루프 (그림 3A) 신경 줄기 세포 표식 Sox2 표현 (그림 3B, D), Pax6와 Otx2 개 마커 (그림 3C, E), 그리고 등 쪽 외피 마커 Emx1 (그림 3 F). 이러한 대뇌 피 질의 루프는 더 N cadherin ZO-1 (그림 3G, H), 심 실 영역 방사형 명과 셀 (vRGC)의 꼭대기 지역화 특징 이다-는 꼭대기에서 구조 (의 기저 면에 걸쳐 microtubule 파생 그림 3 나), phosphorylated vimentin에 대 한 긍정적인 얼룩 셀 분할 꼭대기 위치 (p-Vimentin, 그림 3J). 세포 죽음 organoid 구조 안에 있을 수 있습니다. 중앙 apoptosis는 정상 이며 대뇌 피 질의 조직 개발에 영향을 미치지 않습니다. 또한, 유전자 표정 분석에 의해 3 organoids 프로토콜의 동질성을 평가 하기 위해 사용 되어야 한다. 개 형 organoids midbrain (FoxA2, Pax5)의 표현 하면서 식 등 개 마커 (FoxG1, Otx2, Emx1)의 표시 그리고 hindbrain (HoxB2, HoxA4, HoxB4, HoxB6) 마커 감지 (그림 3K) 하지 않습니다.
품질 제어 organoids의 배치는 꼭대기 광선 glial 세포의 사단 평면 분석 같은 다양 한 애플리케이션에 사용할 수 있습니다. 이 위해, 두 배 얼룩 p Vimentin Tpx2에 대 한 항 체를 사용 하 여 수행 것이 좋습니다 (그림 3J). P-Vimentin 유사 분열 동안 CDK1에 의해 phosphorylated 모든 핵 mitotic 단계16에 따라서 표시는 핵에 위치 하 고. Tpx2 interkinetic 핵 이동17,18동안 mitotic 스핀 들과 꼭대기 프로세스를 시각화 수 microtubule 관련 된 단백질 이다. 이러한 마커를 사용 하 여, vRGC의 세 가지 측면 원칙적으로 분석 될 수 있다: (I) 여부 부문 평면 정렬된 수직 (나타내는 대칭 세포 분열), 수평, 또는 오블리크 (인지 꼭대기 쪽, (II)에 일어난 사단 셀 비대칭 세포 분열을 나타내는) 꼭대기 표면, 및 (III) 여부 센터 microtubule 조직 형성 된다 일반적으로.
Organoids는 더 복잡 한 조직, 층 화 대뇌 피 질의 조직 구조에 더 또한 분화 될 수 있다. 하루 35 ± 2 organoids 내 대뇌 피 질의 구조 심 실 영역 (VZ)-는 내부 및 외부 帯 (SVZ) 뿐 아니라, 대뇌 피 질의 플레이트 (CP)-의 영역 처럼 구성 됩니다. VZ와 내부 및 외부 SVZ, vRGCs, 중간 창시자 (IPs), 및 oRGCs의 연상 셀 식별할 수 있습니다. 또한, 계층화 된 외피의 초기 형성 관찰 될 수 있다 CP 같은 지역에서 Tbr1 및 Ctip2 내부와 Satb2, 표현 하는 위 대뇌 피 질의 뉴런 깊은 대뇌 피 질의 뉴런으로 외부 지역10에 있는 Reelin 표현 세포 뿐만 아니라.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56768/56768fig1.jpg"> 그림 1 : Organoid 프로토콜 및 '가'와 '노' 기준의 일러스트의 도식 개요. (A) 프로토콜의 개요 개요. CI 매체: 대뇌 피 질의 유도 매체; CD: 대뇌 피 질의 차별화 매체입니다. (CB-) 최적의 90% confluent iPSC 단층 문화 (B) 및 비-적당 한 iPSC 문화 전시 차별화 (C)의 이미지. (D-E) 크기, 세포 밀도, 그리고 표면 외관 (D) 최적 iPSC 집계 및 전시 중 셀 2 '노' 셀 집계 예비 (E, 위 집계) 충 치 또는 불규칙 한 가장자리 (E, 낮은 집계) 2 일 다음 셀 집계입니다. (F-G) 반투명 하 고 부드러운 가장자리 (F)와 셀 집계 광 부족 전시 셀 집계 지우기 (G). 노란색 라인은 관심 영역을 머릿속으로. (H-K) 연속 neuroepithelial 루프 (H, J)는 최적의 organoid와 광선 개발 하지 못한 organoid 조직 neuroectoderm (나, K) 15 일과 20 일에 각각 몇 군데. 스케일 바, B C 500 µ m; D-K 200 µ m. <a href="//cloudflare.jove.com/files/ftp_upload/56768/56768fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56768/56768fig2.jpg"> 그림 2 : 동질성 및 개 형 organoid 프로토콜의 재현성. (A-B) 하루 15 (A)와 하루 26 (B)에서 하나의 일괄 처리에서 organoids의 대표적인 밝은 분야 심상. 하루에 20에서 organoids의 (C) 정량 분석. Organoids neuroepithelium, 명확한 테두리와 방사형 세포 구조의 증거 분명 광학 표면 조직으로 밝은 분야에서 인식할 수 있는 외부 표면에 표시 된 계량 (n = 당 최소 16 organoids와 iPSC 라인 당 3 실험)입니다. 스케일 바, A-b: 500 µ m. 오류 막대 ± sd. <a href="//cloudflare.jove.com/files/ftp_upload/56768/56768fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56768/56768fig3.jpg"> 그림 3 : 하루 20 개-유형 organoids의 유효성 검사. (A-J) Organoids의의 Immunocytochemical 특성화 Organoids 여러 neuroepithelial 루프 (A, DAPI와 counterstained)에서 구성 합니다. 층 화 조직된 내의 셀 neuroepithelial 루프 익스프레스 신경 줄기 세포 표식 Sox2 (B, D), 개 마커 Pax6 (C, D)와 Otx2 (E), 등 개 마커 Emx1 뿐만 아니라 (F). 대뇌 피 질의 루프 구조 전시 잘 부착 정션 벨트 N cadherin (G) 및 zona occludens 단백질 1 (조로-1;의 누적 된 가장 꼭대기 쪽 H). 심 실 RGCs microtubule 네트워크 (스테인드 acetylated α-tubulin, Ac-욕조에 의해)는 꼭대기에서 루프 구조 (나)의 기저 면에 확장. P-vimentin (p-Vim) 표현 확산 셀 꼭대기 표면에 있습니다. Mitotic 스핀 들 Tpx2. 수직의 대표 높은 확대 이미지에 의해 얼룩이 고 가로 부문 비행기 (J) 오른쪽에 표시 됩니다. (K) 2 다른 iPSC 라인에서 파생 된 organoids의 2 개의 독립적인 세트의 하루 20 지역 특정 전사 인자에 대 한 RT-PCR 분석. FB: 태아 두뇌 제어; AB: 성인 두뇌 제어 합니다. 스케일 바, A-D 200 µ m; E-난 10 µ m. <a href="//cloudflare.jove.com/files/ftp_upload/56768/56768fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table fo:keep-together.within-page="1"><tbody>
<tr>
<td>피토 프</td>
			<td>희석</td>
		</tr>
<tr>
<td>Sox2</td>
			<td>1-300</td>
		</tr>
<tr>
<td>Pax6</td>
			<td>1-500</td>
		</tr>
<tr>
<td>Otx2</td>
			<td>1-500</td>
		</tr>
<tr>
<td>Emx1</td>
			<td>1-50</td>
		</tr>
<tr>
<td>N-cadherin</td>
			<td>1-500</td>
		</tr>
<tr>
<td>ZO-1</td>
			<td>1-100</td>
		</tr>
<tr>
<td>P-Vimentin</td>
			<td>1-1000</td>
		</tr>
<tr>
<td>Tpx2</td>
			<td>1-500</td>
		</tr>
<tr>
<td>Acetylated α-tubulin</td>
			<td>1-500</td>
		</tr>
<tr>
<td>Alexa488 ms 안티</td>
			<td>1-1000</td>
		</tr>
<tr>
<td>Alexa488 rb 안티</td>
			<td>1-1000</td>
		</tr>
<tr>
<td>Alexa555 ms 안티</td>
			<td>1-1000</td>
		</tr>
<tr>
<td>Alexa555 rb 안티</td>
			<td>1-1000</td>
		</tr>
</tbody></table>표 1: 하루 20에서 organoids의 품질 관리에 대 한 항 체.
<table fo:keep-together.within-page="1"><tbody>
<tr>
<td>뇌관</td>
			<td>시퀀스</td>
		</tr>
<tr>
<td>Otx2 앞으로</td>
			<td>tgcaggggttcttctgtgat</td>
		</tr>
<tr>
<td>Otx2 역</td>
			<td>agggtcagagcaattgacca</td>
		</tr>
<tr>
<td>FoxG1 앞으로</td>
			<td>ccctcccatttctgtacgttt</td>
		</tr>
<tr>
<td>FoxG1 역</td>
			<td>ctggcggctcttagagat</td>
		</tr>
<tr>
<td>Emx1 앞으로</td>
			<td>agacgcaggtgaaggtgtgg</td>
		</tr>
<tr>
<td>Emx1 역</td>
			<td>caggcaggcaggctctcc</td>
		</tr>
<tr>
<td>FoxA2 앞으로</td>
			<td>ccaccaccaaccccacaaaatg</td>
		</tr>
<tr>
<td>FoxA2 역</td>
			<td>tgcaacaccgtctccccaaagt</td>
		</tr>
<tr>
<td>Pax5 앞으로</td>
			<td>aggatgccgctgatggagtac</td>
		</tr>
<tr>
<td>Pax5 역</td>
			<td>tggaggagtgaatcagcttgg</td>
		</tr>
<tr>
<td>HoxB2 앞으로</td>
			<td>tttagccgttcgcttagagg</td>
		</tr>
<tr>
<td>HoxB2 역</td>
			<td>cggatagctggagacaggag</td>
		</tr>
<tr>
<td>HoxA4 앞으로</td>
			<td>ttcagcaaaatgccctctct</td>
		</tr>
<tr>
<td>HoxA4 역</td>
			<td>taggccagctccacagttct</td>
		</tr>
<tr>
<td>HoxB4 앞으로</td>
			<td>acacccgctaacaaatgagg</td>
		</tr>
<tr>
<td>HoxB4 역</td>
			<td>gcacgaaagatgagggagag</td>
		</tr>
<tr>
<td>HoxB6 앞으로</td>
			<td>gaactgaggagcggactcac</td>
		</tr>
<tr>
<td>HoxB6 역</td>
			<td>ctgggatcagggagtcttca</td>
		</tr>
<tr>
<td>18 앞으로</td>
			<td>ttccttggaccggcgcaag</td>
		</tr>
<tr>
<td>18 역</td>
			<td>gccgcatcgccggtcgg</td>
		</tr>
</tbody></table>표 2: 뇌관 그리고 유전자 표현 프로 파일에 대 한 입문 시퀀스.

Watch this Scientific Journal Video about Generation of Standardized and Reproducible Forebrain-type Cerebral Organoids from Human Induced Pluripotent Stem Cells at JoVE.com

Generation of Standardized and Reproducible Forebrain-type Cerebral Organoids from Human Induced Pluripotent Stem Cells

대뇌 organoids 초기 인간의 두뇌 개발에서 체 외에서조사 하는 새로운 모델 시스템을 나타냅니다. 이 문서는 효율적으로 중요 한 특성 및 유효성 검사 단계를 포함 하 여 인간 유도 만능 줄기 세포에서 균질 등 개 형 organoids를 생성 하는 상세한 방법론을 제공 합니다.

인간에서 표준화 되 고 재현 가능한 개 타입 대뇌 Organoids의 생성 유도 만능 줄기 세포

The human cortex is highly expanded and exhibits a complex structure with specific functional areas, providing higher brain function, such as cognition. ...

generation-standardized-reproducible-forebrain-type-cerebral

Research

JoVE Journal

Developmental Biology

21.3K 조회수.  University of Bonn. 대뇌 organoids 초기 인간의 두뇌 개발에서 체 외에서조사 하는 새로운 모델 시스템을 나타냅니다. 이 문서는 효율적으로 중요 한 특성 및 유효성 검사 단계를 포함 하 여 인간 유도 만능 줄기 세포에서 균질 등 개 형 organoids를 생성 하는 상세한 방법론을 제공 합니다.

비디오: Generation of Standardized and Reproducible Forebrain-type Cerebral Organoids from Human Induced Pluripotent Stem Cells

Generation of iPSC-derived Human Brain Organoids to Model Early Neurodevelopmental Disorders

The restricted availability of suitable in vitro models that can reliably represent complex human brain development is a significant bottleneck that limits the translation of basic brain research into clinical application. While induced pluripotent stem cells (iPSCs) have replaced the ethically questionable human embryonic stem cells, iPSC-based neuronal differentiation studies remain descriptive at the cellular level but fail to adequately provide the details that could be derived from a complex, 3D human brain tissue. 
This gap is now filled through the application of iPSC-derived, 3D brain organoids, "Brains in a dish," that model many features of complex human brain development. Here, a method for generating iPSC-derived, 3D brain organoids is described. The organoids can help with modeling autosomal recessive primary microcephaly (MCPH), a rare human neurodevelopmental disorder. A widely accepted explanation for the brain malformation in MCPH is a depletion of the neural stem cell pool during the early stages of human brain development, a developmental defect that is difficult to recreate or prove in vitro. 
To study MCPH, we generated iPSCs from patient-derived fibroblasts carrying a mutation in the centrosomal protein CPAP. By analyzing the ventricular zone of microcephaly 3D brain organoids, we showed the premature differentiation of neural progenitors. These 3D brain organoids are a powerful in vitro system that will be instrumental in modeling congenital brain disorders induced by neurotoxic chemicals, neurotrophic viral infections, or inherited genetic mutations.

Modeling human brain development has been hindered due to the unprecedented complexity of neural epithelial tissue. Here, a method for the robust generation of brain organoids to delineate early events of human brain development and to model microcephaly in vitro is described.

IPSC 파생 된 인간의 두뇌 Organoids의 세대는 초기 신경 발달 장애를 모델링하기

The restricted availability of suitable in vitro models that can reliably represent complex human brain development is a significant bottleneck that ...

연구

발생학

A Static Self-Directed Method for Generating Brain Organoids from Human Embryonic Stem Cells

Human brain organoids differentiated from embryonic stem cells offer the unique opportunity to study complicated interactions of multiple cell types in a three-dimensional system. Here we present a relatively straightforward and inexpensive method that yields brain organoids. In this protocol human pluripotent stem cells are broken into small clusters instead of single cells and grown in basic media without a heterologous basement membrane matrix or exogenous growth factors, allowing the intrinsic developmental cues to shape the organoid&#39;s growth. This simple system produces a diversity of brain cell types including glial and microglial cells, stem cells, and neurons of the forebrain, midbrain, and hindbrain. Organoids generated from this protocol also display hallmarks of appropriate temporal and spatial organization demonstrated by brightfield images, histology, immunofluorescence and real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR). Because these organoids contain cell types from various parts of the brain, they can be utilized for studying a multitude of diseases. For example, in a recent paper we demonstrated the use of organoids generated from this protocol for studying the effects of hypoxia on the human brain. This approach can be used to investigate an array of otherwise difficult to study conditions such as neurodevelopmental handicaps, genetic disorders, and neurologic diseases.

This protocol was generated as a means to produce brain organoids in a simplified, low cost manner without exogenous growth factors or basement membrane matrix while still maintaining the diversity of brain cell types and many features of cellular organization.

인간 배아 줄기 세포에서 뇌 오르가노이드를 생성하기위한 정적 자기 지향 방법

Human brain organoids differentiated from embryonic stem cells offer the unique opportunity to study complicated interactions of multiple cell types in a ...

2D and 3D Human Induced Pluripotent Stem Cell-Based Models to Dissect Primary Cilium Involvement during Neocortical Development

Primary cilia (PC) are non-motile dynamic microtubule-based organelles that protrude from the surface of most mammalian cells. They emerge from the older centriole during the G1/G0 phase of the cell cycle, while they disassemble as the cells re-enter the cell cycle at the G2/M phase boundary. They function as signal hubs, by detecting and transducing extracellular signals crucial for many cell processes. Similar to most cell types, all neocortical neural stem and progenitor cells (NSPCs) have been shown harboring a PC allowing them to sense and transduce specific signals required for the normal cerebral cortical development. Here, we provide detailed protocols to generate and characterize two-dimensional (2D) and three-dimensional (3D) cell-based models from human induced pluripotent stem cells (hIPSCs) to further dissect the involvement of PC during neocortical development. In particular, we present protocols to study the PC biogenesis and function in 2D neural rosette-derived NSPCs including the transduction of the Sonic Hedgehog (SHH) pathway. To take advantage of the three-dimensional (3D) organization of cerebral organoids, we describe a simple method for 3D imaging of in toto immunostained cerebral organoids. After optical clearing, rapid acquisition of entire organoids allows detection of both centrosomes and PC on neocortical progenitors and neurons of the whole organoid. Finally, we detail the procedure for immunostaining and clearing of thick free-floating organoid sections preserving a significant degree of 3D spatial information and allowing for the high-resolution acquisition required for the detailed qualitative and quantitative analysis of PC biogenesis and function.

We present detailed protocols for the generation and characterization of 2D and 3D human induced pluripotent stem cell (hIPSC)-based models of neocortical development as well as complementary methodologies enabling qualitative and quantitative analysis of primary cilium (PC) biogenesis and function.

2D 및 3D 인간 유도 만능 줄기 세포 기반 모델은 신코르티컬 개발 중 1 차용성 개입을 해부합니다.

Primary cilia (PC) are non-motile dynamic microtubule-based organelles that protrude from the surface of most mammalian cells. They emerge from the older ...

Brain Organoid Generation from Induced Pluripotent Stem Cells in Home-Made Mini Bioreactors

The iPSC-derived brain organoid is a promising technology for in vitro modeling the pathologies of the nervous system and drug screening. This technology has emerged recently. It is still in its infancy and has some limitations unsolved yet. The current protocols do not allow obtaining organoids to be consistent enough for drug discovery and preclinical studies. The maturation of organoids can take up to a year, pushing the researchers to launch multiple differentiation processes simultaneously. It imposes additional costs for the laboratory in terms of space and equipment. In addition, brain organoids often have a necrotic zone in the center, which suffers from nutrient and oxygen deficiency. Hence, most current protocols use a circulating system for culture medium to improve nutrition.
Meanwhile, there are no inexpensive dynamic systems or bioreactors for organoid cultivation. This paper describes a protocol for producing brain organoids in compact and inexpensive home-made mini bioreactors. This protocol allows obtaining high quality organoids in large quantities.

Here we describe a protocol for generating brain organoids from human induced pluripotent stem cells (iPSCs). To obtain brain organoids in large quantities and of high quality, we use home-made mini bioreactors.

집에서 만든 미니 생물 반응기에서 유도 만능 줄기 세포에서 뇌 오르간성 생성

The iPSC-derived brain organoid is a promising technology for in vitro modeling the pathologies of the nervous system and drug screening. This technology ...

Generation of 3D Midbrain Organoids from Human-Induced Pluripotent Stem Cells

The development of midbrain organoids (MOs) from human pluripotent stem cells (hPSCs) represents a significant advancement in understanding brain development, facilitating precise disease modeling, and advancing therapeutic research. This protocol outlines a method for generating midbrain-specific organoids using induced pluripotent stem cells (iPSCs), employing a strategic differentiation approach. Key techniques include dual-SMAD inhibition to suppress SMAD signaling, administration of fibroblast growth factor 8b (FGF-8b), and activation of the Sonic Hedgehog pathway using the agonist purmorphamine, guiding iPSCs towards a midbrain fate.
The organoids produced by this method achieve diameters up to 2 mm and incorporate a diverse array of neuroepithelial cell types, reflecting the midbrain&#39;s inherent cellular diversity. Validation of these organoids as authentic midbrain structures involves the expression of midbrain-specific markers, confirming their identity. A notable outcome of this methodology is the effective differentiation of iPSCs into dopaminergic neurons, which are characteristic of the midbrain.
The significance of this protocol lies in its ability to produce functionally mature, midbrain-specific organoids that closely replicate essential aspects of the midbrain, offering a valuable model for in-depth exploration of midbrain developmental processes and the pathophysiology of related disorders such as Parkinson&#39;s disease. Thus, this protocol serves as a crucial resource for researchers seeking to enhance our understanding of the human brain and develop new treatments for neurodegenerative diseases, making it an indispensable tool in the field of neurological research.

This protocol describes a novel method for creating 3D midbrain organoids from human induced pluripotent stem cells, guiding their formation to mimic native midbrain tissue, thereby aiding in the study of development and disorders.

인간 유도 만능 줄기 세포에서 3D 중뇌 오가노이드 생성

The development of midbrain organoids (MOs) from human pluripotent stem cells (hPSCs) represents a significant advancement in understanding brain ...

Robust and Highly Reproducible Generation of Cortical Brain Organoids for Modelling Brain Neuronal Senescence In Vitro

Brain organoids are three-dimensional models of the developing human brain and provide a compelling, cutting-edge platform for disease modeling and large-scale genomic and drug screening. Due to the self-organizing nature of cells in brain organoids and the growing range of available protocols for their generation, issues with heterogeneity and variability between organoids have been identified. In this protocol paper, we describe a robust and replicable protocol that largely overcomes these issues and generates cortical organoids from neuroectodermal progenitors within 1 month, and that can be maintained for more than 1 year. This highly reproducible protocol can be easily carried out in a standard tissue culture room and results in organoids with a rich diversity of cell types typically found in the developing human cortex. Despite their early developmental make-up, neurons and other human brain cell types will start to exhibit the typical signs of senescence in neuronal cells after prolonged in vitro culture, making them a valuable and useful platform for studying aging-related neuronal processes. This protocol also outlines a method for detecting such senescent cells in cortical brain organoids using senescence-associated beta-galactosidase staining.

Robust and Highly Reproducible Generation of Cortical Brain Organoids for Modelling Brain Neuronal Senescence In Vitro

In this study, we provide a detailed technique for a simple yet robust cortical organoid culture system using standard feeder-free hPSC cultures. This is a rapid, efficient, and reproducible protocol for generating organoids that model aspects of brain senescence in vitro.

체외에서 뇌 신경 노화를 모델링하기위한 피질 뇌 오가노이드의 강력하고 재현 가능한 생성

Brain organoids are three-dimensional models of the developing human brain and provide a compelling, cutting-edge platform for disease modeling and ...

신경과학

An In Vitro Method to Generate Human Brain Organoids

Source: Gabriel, E., et al., <a href="https://app.jove.com/v/55372">Generation of iPSC-derived Human Brain Organoids to Model Early Neurodevelopmental Disorders.</a> J. Vis. Exp. (2017)
The video demonstrates a method for generating human brain organoids from induced pluripotent stem cells. It shows how the neurosphere forms a neuroectodermal layer, which suppresses the formation of other germ layers. The neurospheres are embedded in a 3D gel matrix and form neuroepithelial buds. When incubated with organoid media, these neuroepithelial buds differentiate into specific brain regions, resulting in the formation of mature brain organoids.

인간 뇌 오가노이드를 생성하는 체외 방법

All procedures involving sample collection have been performed in accordance with the institute&#39;s IRB guidelines.
1. Generation of Brain Organoids (23 ...

JoVE Encyclopedia of Experiments

Neuroscience

Neuronal Culture Techniques

Advanced Neuronal Models

Generating Induced Pluripotent Stem Cell-Derived Cerebral Organoids

Source: Koch, L. S., et al. <a href="https://app.jove.com/v/64586">Robust Tissue Fabrication for Long-Term Culture of iPSC-Derived Brain Organoids for Aging Research.</a> J. Vis. Exp. (2023).
This video demonstrates an assay to generate cerebral organoids from induced pluripotent stem cells (iPSCs). Human iPSCs are induced to form embryoid bodies (EBs). The EBs are cultured over a polymer scaffold using an induction medium, promoting differentiation into neural stem cells, progenitor cells, and immature neurons. Finally, the EBs are embedded in a matrix and transferred to a maintenance medium for cerebral organoid formation.

유도 만능 줄기 세포 유래 대뇌 오가노이드 생성

All procedures involving sample collection have been performed in accordance with the institute&#39;s IRB guidelines.
Figure 1 illustrates a schematic ...

Generating Forebrain-Type Cerebral Organoids from Human-Induced Pluripotent Stem Cells

Source: Krefft, O. et al., <a href="https://app.jove.com/v/56768">Generation of Standardized and Reproducible Forebrain-type Cerebral Organoids from Human Induced Pluripotent Stem Cells.</a> J. Vis. Exp. (2018).
This video outlines the creation of forebrain-type organoids from human induced pluripotent stem cells (iPSCs), demonstrating the progression from stem cell aggregates to complex structures that mimic the brain&#39;s cortex and differentiate into various neuron types.

인간 유도 만능 줄기 세포에서 전뇌형 대뇌 오가노이드 생성

1. Generation of iPSC Aggregates

	Generation of single-cell monolayer cultures from iPSC colonies
	
		Prepare a basement membrane extract (BME) coated ...

Co-culture and Interaction Studies

Generation of Spheroids from Human Pluripotent Stem Cells

Source: Shaker, M. R., et al. <a href="https://app.jove.com/v/63714">Robust and Highly Reproducible Generation of Cortical Brain Organoids for Modelling Brain Neuronal Senescence In Vitro.</a> J. Vis. Exp. (2022).
This video demonstrates the transformation of human pluripotent stem cells (hPSCs) into spherical brain organoids. By using specific inhibitors, the hPSCs are guided to differentiate towards a neuronal lineage, forming neuroectodermal colonies. Special growth factors are then introduced, which encourage the self-organization and proliferation of the colonies, ultimately leading to the formation of spherical brain organoids.

인간 만능 줄기 세포에서 스페로이드 생성

1. Cortical brain organoid generation (Figure 1) 
NOTE: All the steps in this section of the protocol will occur in a Class 2 biosafety hood unless stated ...