Name: highly efficient transfection of primary macrophages with in vitro transcribed mrna
Uploaded: 2019-11-09T13:00:00.000+00:00
Duration: 6 min 46 s
Description: Watch this Scientific Journal Video about Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA at JoVE.com

This work was supported by the Deutsche Forschungsgemeinschaft (SFB 670).

Macrophage isolation from mice was performed in accordance with the Animal Protection Law of Germany in compliance with the Ethics Committee at the University of Cologne.
NOTE: Carry out all steps wearing gloves. Carry out all transfection steps under a laminar flow hood to prevent contamination of the cells. Before working with mRNA, clean all instruments such as pipettes and every surface with 70% ethanol and/or a RNAse-degrading surfactant (Table of Materials). Ensure that all reaction tubes are RNAse-free and sterile. Use only sterile, RNAase-free water for dilutions. Exclusively use pipette tips with filters. Change pipette tips after every pipetting step.
1. Generation of the DNA Template
NOTE: The DNA template for in vitro mRNA transcription using this protocol must contain a T7 promotor sequence to allow docking of the RNA polymerase. If the plasmid containing the DNA sequence of the protein of interest already contains a correctly orientated T7 promotor sequence directly upstream of the sequence of interest, linearization of the plasmid (see step 1.1.) needs to be performed. Otherwise, attach a T7 promotor to the sequence of interest by polymerase chain reaction (PCR, see step 1.2.).
<ol>
	<li>Linearization of T7 promotor-containing plasmids
	<ol>
		<li>Linearize plasmids already containing a correctly orientated T7 promotor sequence by digestion with a restriction enzyme cutting downstream of the stop codon of the sequence of interest. Otherwise, transcription will not end properly after the sequence of interest. 
		NOTE: It is best to use restriction enzymes leaving blunt ends or 5&#39; overhangs.</li>
		<li>Confirm complete linearization of the plasmid by agarose gel electrophoresis of undigested versus digested plasmid DNA.</li>
		<li>Purify linearized plasmid DNA prior to use as DNA template for in vitro mRNA transcription using a DNA purification kit (Table of Materials).</li>
	</ol>
	</li>
	<li>Attachment of the T7 promotor by PCR
	<ol>
		<li>Use a forward primer containing the following components (in the indicated order from 5&#39; to 3&#39;): about 5 random bp upstream of the promotor (e.g., GAAAT); the T7 promotor sequence (TAATACGACTCACTATAG); two extra Gs for increased transcription efficiency (GG); the target sequence-specific part that is homologous to the plasmid sequence surrounding the start codon. 
		NOTE: It should be composed of: 3-6 bp upstream of the KOZAK sequence and start codon, the KOZAK sequence and start codon (usually GCCACC ATG G), 12-18 bp downstream of the start codon. If the sequence of interest does not already contain a KOZAK sequence or start codon, these can be attached in this step by simply including them in the primer sequence.</li>
		<li>Calculate the tm of the forward primer only by taking into account the part homologous to the target sequence.</li>
		<li>To assess dimers/hairpin formation use the whole primer sequence, which easily can exceed 50 bp.</li>
		<li>Use a reverse primer located somewhere downstream of the stop codon. 
		NOTE: If the sequence of interest doesn&#39;t already contain a stop codon, it can be attached in this step by simply including it in the primer sequence.</li>
		<li>Use the forward and reverse primers to perform a PCR using a high-fidelity polymerase with proofreading (Table of Materials).</li>
		<li>Confirm generation of a single product and amplicon size by agarose gel electrophoresis (e.g., use a 1% agarose gel and 100 V constant current).</li>
		<li>Purify the PCR product prior to use as DNA template for in vitro mRNA transcription using a DNA purification kit.</li>
	</ol>
	</li>
</ol>
2. mRNA Generation
<ol>
	<li>Thaw all components of the in vitro mRNA transcription kit (see the Table of Materials). Vortex for 5 s and spin down for 2 s at 2,000 x g. Keep on ice until use.</li>
	<li>Prepare the reaction mix for in vitro mRNA transcription in a 0.5 mL microcentrifuge tube in the following order (total volume of 40 &#181;L): 20 &#181;L of 10x ARCA/NTP mix (included in the in vitro mRNA transcription kit); 0.25 &#181;L of 5-methyl-CTP (final concentration (f.c.) is 1.25 mM; 50% of total CTP); 0.25 &#181;L of pseudo-UTP (f.c. is 1.25 mM; 50% of total UTP); X &#181;L of DNA template; 2 &#181;L of T7 RNA polymerase mix (included in the in vitro mRNA transcription kit); Y &#181;L of RNAse-free H2O. 
	NOTE: X is a volume containing at least 1 &#181;g of DNA. For example, 1.6 &#181;L from a 625 ng/&#181;L stock solution. Y is the spare volume to the total volume of 40 &#181;L.</li>
	<li>Vortex for 5 s and spin down for 2 s at 2,000 x g. Incubate at 37 &#176;C for 30 min at 400 rpm on a thermal mixer for in vitro transcription.</li>
	<li>Then, add 2 &#181;L of DNase I directly into the reaction mix for removal of the template DNA. Vortex for 5 s and spin down for 2 s at 2,000 x g.</li>
	<li>Incubate at 37 &#176;C for 15 min at 400 rpm on a thermal mixer. Take an aliquot of 2 &#181;L for the control gel (step 3.3) and store at -80 &#176;C.</li>
	<li>For poly(A) tailing, add the following components directly into the previous reaction mix (to a final volume of 50 &#181;L): 5 &#181;L of 10x poly(A) polymerase reaction buffer and 5 &#181;L of poly(A) polymerase (both included in the in vitro mRNA transcription kit). Vortex for 5 s and spin down for 2 s at 2,000 x g.</li>
	<li>Incubate the mix at 37 &#176;C for 30 min at 400 rpm on a thermomixer. Take an aliquot of 2 &#181;L for the control gel (step 3.3) and store at -80 &#176;C.</li>
	<li>For dephosphorylation of the 5&#180;-ends of the mRNA, add the following components directly into the previous reaction mix (to a final volume of 60 &#181;L): 3 &#181;L of RNAse-free H2O; 6 &#181;L of 10x Antarctic phosphatase reaction buffer; 3 &#181;L of Antarctic phosphatase (15 units for 60 &#181;L reaction volume). Vortex for 5 s and spin down for 2 s at 2,000 x g.</li>
	<li>Incubate the mix at 37 &#176;C for 30 min at 400 rpm on a thermal mixer.</li>
	<li>Heat-inactivate Antarctic phosphatase by incubation at 80 &#176;C for 2 min. 
	NOTE: Ideally, use a separate thermal mixer, do not wait until the first mixer reaches the desired temperature.</li>
</ol>
3. mRNA Purification
<ol>
	<li>Purify the in vitro transcribed mRNA using a dedicated RNA purification kit (Table of Materials).
	<ol>
		<li>Add X &#181;L of elution solution to the mRNA reaction mix from step 2.10. Mix by inverting 5 times. Add 300 &#181;L of binding solution concentrate. Mix by gentle pipetting 5 times. 
		NOTE: X is the spare volume to a total volume of 100 &#181;L. For example, add 40 &#181;L elution solution to 60 &#181;L mRNA reaction mix.</li>
		<li>Add 100 &#181;L of RNAase-free ethanol. Mix by gentle pipetting 5 times.</li>
		<li>Place a filter column in one of the supplied collection tubes. Transfer the mRNA reaction mix gently onto the center of the filter without touching the filter. Centrifuge at 15,000 x g for 1 min at room temperature (RT).</li>
		<li>Carefully lift the filter column and discard the flow-through in the collection tube. Place the filter column back into the same collection tube.</li>
		<li>Add 500 &#181;L of wash solution (do not forget to add 20 mL of RNAase-free ethanol before using the wash solution for the first time).</li>
		<li>Centrifuge at 15,000 x g for 1 min at RT. Repeat steps 3.1.4-3.1.6 to wash one more time.</li>
		<li>Centrifuge at full speed (17,900 x g) for 1 min at RT to remove any residual fluid from the filter column. Carefully take the filter column from the collection tube. Place the filter column in a new collection tube.</li>
		<li>Add 50 &#181;L of elution buffer onto the center of the filter without touching the filter. Incubate at 65 &#176;C for 10 min on a thermal mixer.</li>
		<li>Centrifuge at 15,000 x g for 1 min at RT. Remove the filter column and discard it.</li>
	</ol>
	</li>
	<li>Measure the concentration and purity of the eluted mRNA, for example, by using a microvolume spectrophotometer to measure absorbance at 260 and 280 nm. 
	NOTE: An A260/A280 ratio of 1.8-2.1 is indicative of highly purified mRNA.</li>
	<li>Verify presence of a single product, correct transcript length and poly(A) tailing by analyzing the aliquots from steps 2.5 and 2.7 by agarose gel electrophoresis under denaturing conditions (for example, use a 1.2% agarose gel containing 20 mM 3-(N-morpholino)propanesulfonic acid [MOPS], 5 mM sodium acetate, 1 mM EDTA and 20% formaldehyde and run in 20 mM MOPS, 5 mM sodium acetate, 1 mM EDTA and 0.74 % formaldehyde at 100 V constant current).</li>
	<li>Store the purified mRNA in the elution tube at -80 &#176;C until transfection. If using only low amounts of the mRNA for transfection then aliquot the mRNA to avoid repeated freeze-thaw cycles. 
	NOTE: mRNA can be stored at -80 &#176;C for about 1 year.</li>
</ol>
4. Macrophage Preparation
<ol>
	<li>Euthanize C57/BL6 mice (use mice of the same sex and of 6-24 weeks of age) by cervical dislocation. 
	NOTE: The same mice can be used for isolation of PM (step 4.2) and generation of BMDM (steps 4.3 and 4.4). For isolation of PM use at least two mice. If only BMDM are to be generated one mouse usually is enough.</li>
	<li>Immunomagnetic enrichment of peritoneal macrophages.
	<ol>
		<li>Fill a 10 mL syringe with a 0.9 x 40 mm cannula with 8 mL of ice-cold phosphate-buffered saline (PBS) and 2 mL of air. Flush the peritoneal cavity with PBS. The air will form a bubble that minimizes leakage of the PBS.</li>
		<li>Quickly collect peritoneal lavage with the same syringe and transfer into a 50 mL conical centrifugation tube. Combine peritoneal cells of multiple mice if required. Keep cell suspension on ice.</li>
		<li>Centrifuge cell suspension at 650 x g for 5 min at 4 &#176;C. Discard the supernatant and resuspend the cell pellet in 5 mL of 0.2 % NaCl for 30 s to lyse red blood cells.</li>
		<li>Add 5 mL of 1.6% NaCl to a total volume of 10 mL to reconstitute isotonic conditions. Centrifuge at 650 x g for 5 min at 4 &#176;C.</li>
		<li>Discard the supernatant and resuspend the cell pellet in 97.5 &#181;L of magnetic cell sorting (MCS) buffer (2 mM ethylenediaminetetraacetic acid [EDTA], 0.5% bovine serum albumin [BSA] in PBS) per 1 peritoneal lavage (e.g., if three mice were flushed, resuspend in 292.5 &#181;L).</li>
		<li>Add 2.5 &#181;L of paramagnetic beads conjugated to an CD11b-specific antibody per 97.5 &#181;L of cell suspension (e.g., add 7.5 &#181;L to 292.5 &#181;L).</li>
		<li>Incubate on ice for 15 min at 150 rpm on an orbital shaker.</li>
		<li>Centrifuge cell suspension at 650 x g for 5 min at 4 &#176;C, discard the supernatant and resuspend the cell pellet in 1 mL of MCS buffer.</li>
		<li>Add 4 mL of MCS buffer to a total volume of 5 mL and wash the cells by gently pipetting up and down three times.</li>
		<li>Repeat steps 4.2.8 and 4.2.9 two more times for a total of three wash steps.</li>
		<li>During the wash steps place an LS column in a magnetic cell separator (see Table of Materials). Rinse the column with 3 mL of MCS buffer. 
		NOTE: Avoid any bubbles as these may clog the column.</li>
		<li>Resuspend the cell pellet in 1 mL of MCS buffer. Add 3 mL of MCS buffer to a total volume of 4 mL, mix by pipetting up and down three times.</li>
		<li>Transfer the 4 mL of cell suspension onto the rinsed LS column. 
		NOTE: Again, avoid any bubbles as these may clog the column.</li>
		<li>Wait until the reservoir of the column is completely empty. Do not add additional fluid until the column stops dripping.</li>
		<li>Add 3 mL of MCS buffer onto the column. Then, wait until the reservoir of the column is completely empty. Repeat step 4.2.15 two more times.</li>
		<li>Place the LS column in a 15 mL conical centrifugation tube. Apply 5 mL of MCS buffer onto the column. Wait until 2 mL of fluid has passed through the column, then use the plunger to gently push the remaining fraction into the tube.</li>
		<li>Centrifuge cell suspension at 650 x g for 5 min at 4 &#176;C and discard the supernatant.</li>
		<li>Resuspend the cell pellet in 1 mL of DMEM supplemented with 10% heat-inactivated fetal calf serum (FCS) (DMEM+FCS).</li>
		<li>Determine the number of viable cells by counting in trypan blue solution in a Neubauer counting chamber and seed cells in DMEM+FCS into culture plates. 
		NOTE: Seed PM at a density of 100,000 cells/well in a flat bottom microtiter plate. Do not use tissue culture-treated plates as PM cannot be detached from these. Use non-treated plates instead.</li>
	</ol>
	</li>
	<li>Generation of BMDM
	<ol>
		<li>Remove skin and muscles from the hind legs using a pair of scissors. Wash each leg by short submersion in 70% ethanol.</li>
		<li>Detach legs and open both ends of the femur and the tibia by cutting with scissors.</li>
		<li>Fill a 5 mL syringe filled with a 0.6 mm x 30 mm cannula with 5 mL of very low endotoxin (VLE) RPMI 1640 and flush the bone marrow out of the opened bones into a culture dish.</li>
		<li>Combine bone marrow of multiple mice if required by repeating steps 4.3.1-4.3.3. Transfer the bone marrow into a 50 mL conical centrifugation tube.</li>
		<li>Centrifuge the bone marrow suspension at 650 x g for 5 min at 4 &#176;C and discard the supernatant.</li>
		<li>Resuspend the cell pellet in 5 mL of red blood cell lysis buffer (8.3% NH4Cl, 0.1 M Tris) and incubate for 5 min at RT to lyse the red blood cells.</li>
		<li>Centrifuge the cell suspension at 650 x g at 4&#176; C for 5 min and discard the supernatant.</li>
		<li>Resuspend the cell pellet in 1 mL of VLE RPMI 1640 medium supplemented with 10% FCS, 1% penicillin/streptomycin, 1% HEPES, 1% sodium pyruvate and 10 ng/mL recombinant macrophage colony-stimulating factor (M-CSF) (RPMI+++++).</li>
		<li>Add 4 mL of RPMI+++++ to a total volume of 5 mL.</li>
		<li>Prepare 5 92 mm x 16 mm untreated Petri dishes with cams (see the Table of Materials) per mouse by pipetting 7 mL of RPMI+++++ medium into each dish.</li>
		<li>Transfer the 1 mL of cell solution to the 5 prepared culture dishes and incubate at 37 &#176;C and 5% CO2.</li>
		<li>After 4 days, feed the cells by adding 4 mL of RPMI+++++. After 6-7 days, the bone marrow cells are fully differentiated into BMDM.</li>
	</ol>
	</li>
	<li>Harvesting of BMDM
	<ol>
		<li>Completely remove the medium from culture dishes. Add 5 mL of warm 0.2 mM EDTA in PBS to each dish.</li>
		<li>Gently scrape the whole plate with a cell scraper to detach the BMDM. Combine the cell suspensions in a 50 mL conical centrifugation tube.</li>
		<li>Flush all 5 dishes again. Use the same volume of 5 mL of warm 0.2 mM EDTA in PBS for all 5 dishes. Combine this cell suspension with the one from the previous step.</li>
		<li>Centrifuge the cell suspension at 650 x g for 5 min at 4&#176; C and discard the supernatant.</li>
		<li>Resuspend the cell pellet in 1 mL of VLE RPMI 1640 medium supplemented with 10% FCS, 1% HEPES, 1% sodium pyruvate and 10 ng/mL recombinant M-CSF but no antibiotics (RPMI++++).</li>
		<li>Determine the number of viable cells by counting in trypan blue solution in a Neubauer counting chamber and seed cells in RPMI++++ into culture plates. 
		NOTE: Seed BMDM at a density of 50,000 cells/well maximum in a flat bottom microtiter plate. Do not use tissue culture-treated plates as BMDM can hardly be detached from these. Use non-treated plates instead.</li>
	</ol>
	</li>
</ol>
5. Transfection of Macrophages with mRNA
<ol>
	<li>Calculate the required volume of mRNA transfection buffer. 
	NOTE: The volume of mRNA transfection buffer required depends on well size: use 200 &#181;L for transfection in a 6-well plate, 100 &#181;L in a 12-well plate and so on. Always add a little spare volume because of pipetting loss (but not too much, to prevent undue dilution of mRNA). For example, use 450 &#181;L instead of 4 x 100 &#181;L = 400 &#181;L to transfect in 4 wells of a 12-well plate.</li>
	<li>Calculate the required volume of mRNA transfection reagent. The mRNA transfection reagent is added at a ratio of 1:50. For example, 9 &#181;L of mRNA transfection reagent is required for a final volume of 450 &#181;L.</li>
	<li>Calculate the total amount of mRNA required. At least 100 ng per 100,000 macrophages are required for efficient transfection, 200 ng works even better (e.g., 800 ng mRNA to transfect 400,000 macrophages).
	<ol>
		<li>Multiply the calculated amount of mRNA required with the total number of wells that have to be transfected (e.g., 4 wells with 400,000 macrophages each: 4 x 800 ng = 3,200 ng mRNA is required in total for all wells). For example, if your mRNA stock is 426.8 ng/&#181;L, 7.49 &#181;L are needed for optimal transfection of 4 wells with 400,000 macrophages each.</li>
	</ol>
	</li>
	<li>Add the calculated volume of mRNA transfection buffer (step 5.1.) minus the volumes for mRNA transfection reagent (step 5.2) and the mRNA (step 5.3) to a reaction tube. For example, 450 &#181;L - 9 &#181;L - 7.49 &#181;L = 433.51 &#181;L.</li>
	<li>Thaw the mRNA stock and mix it by gentle flipping of the elution tube. Add the calculated volume of mRNA (step 5.3) to the reaction tube with mRNA reaction buffer (in the example presented above: 7.49 &#181;L in 433.51 &#181;L).</li>
	<li>Vortex for 5 s and spin down for 2 s at 2,000 x g.</li>
	<li>Vortex the mRNA transfection reagent for 5 s and spin down for 2 s at 2,000 x g.</li>
	<li>Add the calculated volume of mRNA transfection reagent (step 5.2) to the reaction tube containing the mRNA transfection buffer and the mRNA (in the example presented above: 9 &#181;L of mRNA transfection reagent).</li>
	<li>Vortex the transfection mix for 5 s and spin down for 2 s at 2,000 x g.</li>
	<li>Incubate for 15 min at RT.</li>
	<li>Meanwhile, replace the culture medium of the macrophages with fresh, warm culture medium (see steps 4.2.18. and 4.4.5).</li>
	<li>After the incubation step 5.10, add the transfection mix to the wells containing the macrophages in a volume appropriate for the size of the well (see step 5.1). Add the transfection mix dropwise in a circle from the outside to the middle of the well.</li>
	<li>Gently rock the plate, first in a vertical and then in a horizontal direction to ensure uniform distribution of the transfection mix in the well. Then, incubate at 37 &#176;C and 5 % CO2. Synthesis of the protein encoded by the transfected mRNA will begin shortly after transfection. For best results, incubate for at least 6 h.</li>
	<li>After the incubation, analyze transfection efficiency by (immuno)fluorescence microscopy, flow cytometry or immunoblot16, or use the transfected macrophages for the experiment of choice.</li>
</ol>

<ol>
	<li>Ley, K., Pramod, A. B., Croft, M., Ravichandran, K. S., Ting, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+Mouse+Macrophages+Sense+What+Is+Going+On.">How Mouse Macrophages Sense What Is Going On.</a> Frontiers in Immunology. 7 (204), (2016).</li><li>Zhang, X., Edwards, J. P., Mosser, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expression+of+exogenous+genes+in+macrophages:+obstacles+and+opportunities.">The expression of exogenous genes in macrophages: obstacles and opportunities.</a> Methods in Molecular Biolology. 531, 123-143 (2009).</li><li>Guo, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfection+reagent+Lipofectamine+triggers+type+I+interferon+signaling+activation+in+macrophages.">Transfection reagent Lipofectamine triggers type I interferon signaling activation in macrophages.</a> Immunology and cell biology. 97 (1), 92-96 (2019).</li><li>Kariko, K., Weissman, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Naturally+occurring+nucleoside+modifications+suppress+the+immunostimulatory+activity+of+RNA:+implication+for+therapeutic+RNA+development.">Naturally occurring nucleoside modifications suppress the immunostimulatory activity of RNA: implication for therapeutic RNA development.</a> Current Opinion in Drug Discovery and Development. 10 (5), 523-532 (2007).</li><li>Van De Parre, T. J., Martinet, W., Schrijvers, D. M., Herman, A. G., De Meyer, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mRNA+but+not+plasmid+DNA+is+efficiently+transfected+in+murine+J774A.1+macrophages.">mRNA but not plasmid DNA is efficiently transfected in murine J774A.1 macrophages.</a> Biochemical and biophysical research communications. 327 (1), 356-360 (2005).</li><li>Uchida, S., Kataoka, K., Itaka, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Screening+of+mRNA+Chemical+Modification+to+Maximize+Protein+Expression+with+Reduced+Immunogenicity.">Screening of mRNA Chemical Modification to Maximize Protein Expression with Reduced Immunogenicity.</a> Pharmaceutics. 7 (3), 137-151 (2015).</li><li>Kariko, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incorporation+of+pseudouridine+into+mRNA+yields+superior+nonimmunogenic+vector+with+increased+translational+capacity+and+biological+stability.">Incorporation of pseudouridine into mRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability.</a> Molecular Therapy. 16 (11), 1833-1840 (2008).</li><li>Khantakova, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfection+of+bone+marrow+derived+cells+with+immunoregulatory+proteins.">Transfection of bone marrow derived cells with immunoregulatory proteins.</a> Cytokine. 108, 82-88 (2018).</li><li>Franz, K. M., Kagan, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+Immune+Receptors+as+Competitive+Determinants+of+Cell+Fate.">Innate Immune Receptors as Competitive Determinants of Cell Fate.</a> Molecular Cell. 66 (6), 750-760 (2017).</li><li>Kaestner, L., Scholz, A., Lipp, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conceptual+and+technical+aspects+of+transfection+and+gene+delivery.">Conceptual and technical aspects of transfection and gene delivery.</a> Bioorganic &amp; medicinal chemistry letters. 25 (6), 1171-1176 (2015).</li><li>Kim, T. K., Eberwine, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+cell+transfection:+the+present+and+the+future.">Mammalian cell transfection: the present and the future.</a> Analytical and Bioanalytical Chemistry. 397 (8), 3173-3178 (2010).</li><li>Kormann, M. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+therapeutic+proteins+after+delivery+of+chemically+modified+mRNA+in+mice.">Expression of therapeutic proteins after delivery of chemically modified mRNA in mice.</a> Nature Biotechnology. 29 (2), 154-157 (2011).</li><li>Kariko, K., Buckstein, M., Ni, H., Weissman, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+RNA+recognition+by+Toll-like+receptors:+the+impact+of+nucleoside+modification+and+the+evolutionary+origin+of+RNA.">Suppression of RNA recognition by Toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA.</a> Immunity. 23 (2), 165-175 (2005).</li><li>Hornung, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=5'-Triphosphate+RNA+is+the+ligand+for+RIG-I.">5'-Triphosphate RNA is the ligand for RIG-I.</a> Science. 314 (5801), 994-997 (2006).</li><li>Pichlmair, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-mediated+antiviral+responses+to+single-stranded+RNA+bearing+5'-phosphates.">RIG-I-mediated antiviral responses to single-stranded RNA bearing 5'-phosphates.</a> Science. 314 (5801), 997-1001 (2006).</li><li>Herb, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+reactive+oxygen+species+enable+proinflammatory+signaling+through+disulfide+linkage+of+NEMO.">Mitochondrial reactive oxygen species enable proinflammatory signaling through disulfide linkage of NEMO.</a> Science Signaling. 12 (568), (2019).</li><li>Schmidt-Supprian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NEMO/IKK+gamma-deficient+mice+model+incontinentia+pigmenti.">NEMO/IKK gamma-deficient mice model incontinentia pigmenti.</a> Molecular Cell. 5 (6), 981-992 (2000).</li><li>Mandal, P. K., Rossi, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+human+fibroblasts+to+pluripotency+using+modified+mRNA.">Reprogramming human fibroblasts to pluripotency using modified mRNA.</a> Nature Protocols. 8 (3), 568-582 (2013).</li><li>Oh, S., Kessler, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design,+Assembly,+Production,+and+Transfection+of+Synthetic+Modified+mRNA.">Design, Assembly, Production, and Transfection of Synthetic Modified mRNA.</a> Methods. 133, 29-43 (2018).</li></ol>

The authors have nothing to disclose.

Here we present a protocol for highly efficient transfection of usually hard-to-transfect primary macrophages with in vitro transcribed mRNA. Importantly, transfection of the macrophages using this protocol does not induce cell death or activate proinflammatory signaling indicating that neither the transfection reagent nor the transfected mRNA are recognized as non-self.
The quality of the mRNA is of key importance for successful transfection of macrophages using this protocol. Thus, great car...

Macrophages are phagocytic cells that specialize in detecting, ingesting and degrading microbes, apoptotic cells and cellular debris. Moreover, they help to orchestrate immune responses by secreting cytokines and chemokines and by presenting antigens to T cells and B cells. Macrophages also play important roles in numerous other processes, such as wound healing, atherosclerosis, tumorigenesis and obesity.
To be able to detect non-self molecules such as pathogen-associated molecular patterns (PAMPs) and out-of-place molecules such as damage-associated molecular patterns (DAMPs), macrophages are equipped with a large array of pattern recognition receptors (PRR)1. Unfortunately, this also makes macrophages particularly challenging to transfect2 as the transfection reagent3 and the transfected nucleic acids4,5,6,7 often are recognized by the PRRs as non-self. For this reason, transfection of macrophages using chemical or physical methods8 usually results in macrophage activation and degradation of the transfected nucleic acids or even in macrophage suicide via pyroptosis, a form of programmed lytic cell death triggered after recognition of cytosolic PAMPs/DAMPs such as DNA or foreign RNA9. Biological transfection of macrophages using viruses such as adenoviruses or lentiviruses as vectors is often more efficient, yet construction of such viral vectors is time-consuming and requires biosafety level 2 equipment10,11.
Thus, although macrophages are the subject of intensive research, analysis of their functions on the molecular level is hampered because one of the most important tools of molecular biology, the transfection of nucleic acid constructs for exogenous expression of proteins, is hardly applicable. This often forces researchers to use macrophage-like cell lines rather than bona fide macrophages. Applications for nucleic acid construct transfection include expression of mutated or tagged protein versions, overexpression of a specific protein, protein re-expression in a respective knockout background and expression of proteins from other species (e.g., Cre recombinase or guide RNA and Cas9 for targeted gene knockout).
Here, we describe a protocol that allows highly efficient transfection of (usually hard to transfect) primary macrophages, that is murine peritoneal macrophages (PM) and bone marrow-derived macrophages (BMDM) with mRNA generated from DNA templates such as plasmids. Importantly, the in vitro transcribed mRNA generated using this protocol contains the naturally occurring modified nucleosides 5-methyl-CTP and pseudo-UTP that reduce immunogenicity and enhance stability4,6,7,12,13. Moreover, the 5&#39;-ends of the in vitro transcribed mRNA are dephosphorylated by Antarctic phosphatase to prevent recognition by the RIG-I complex14,15. This minimizes innate immune recognition of the in vitro transcribed mRNA. With our easy to perform protocol, transfection rates between 50-65% (peritoneal macrophages (PM)) and 85% (BMDM) are reached while, importantly, there is no cytotoxicity or immunogenicity observed. We describe in detail (i) how the immunologically silenced mRNA for transfection can be generated from DNA constructs such as plasmids and (ii) the transfection procedure itself.

<table><tbody><tr><td>5-methyl-CTP (100 mM)</td><td>Jena Biosience</td><td>NU-1138S</td><td>stored at -20 &amp;deg;C</td></tr><tr><td>Antarctic phosphatase</td><td>New England BioLabs</td><td>M0289</td><td>stored at -20 &amp;deg;C</td></tr><tr><td>Antarctic phosphatase reaction buffer (10x)</td><td>New England BioLabs</td><td>B0289</td><td>stored at -20 &amp;deg;C</td></tr><tr><td>anti-NEMO/IKK&amp;gamma; antibody</td><td>Invitrogen</td><td>MA1-41046</td><td>stored at -20 &amp;deg;C</td></tr><tr><td>anti-&amp;beta;-actin antibody</td><td>Sigma-Aldrich</td><td>A2228</td><td>stored at -20 &amp;deg;C</td></tr><tr><td>Petri dishes 92,16 mm with cams</td><td>Sarstedt</td><td>821,473</td><td>stored at RT</td></tr><tr><td>CD11b Microbeads mouse and human</td><td>Miltenyi Biotec</td><td>130-049-601</td><td>stored at 4 &amp;deg;C</td></tr><tr><td>Cre recombinase + T7-Promotor forward primer</td><td>Sigma-Aldrich</td><td></td><td>5&amp;prime;-GAAATTAATACGACTCACTATA&lt;br/&gt;GGGGCAGCCGCCACCATGTCC&lt;br/&gt;AATTTACTGACCGTAC-3&amp;acute;, stored at -20 &amp;deg;C</td></tr><tr><td>Cre recombinase + T7-Promotor reverse primer</td><td>Sigma-Aldrich</td><td></td><td>5&amp;prime;-CTAATCGCCATCTTCCAGCAGG&lt;br/&gt;C-3&amp;prime;, stored at -20 &amp;deg;C</td></tr><tr><td>DNA purification kit: QIAquick PCR purification Kit</td><td>Qiagen</td><td>28104</td><td>stored at RT</td></tr><tr><td>eGFP + T7-Promotor forward primer</td><td>Sigma-Aldrich</td><td></td><td>5&amp;acute;-GAAATTAATACGACTCACTATA&lt;br/&gt;GGGATCCATCGCCACCATGGTG&lt;br/&gt;AGCAAGG-3&amp;acute;, stored at -20 &amp;deg;C</td></tr><tr><td>eGFP + T7-Promotor reverse primer</td><td>Sigma-Aldrich</td><td></td><td>5&amp;acute;-TGGTATGGCTGATTA&lt;br/&gt;TGATCTAGAGTCG-3&amp;acute;, stored at -20 &amp;deg;C</td></tr><tr><td>Fast Digest buffer (10x)</td><td>Thermo Scientific</td><td>B64</td><td>stored at -20 &amp;deg;C</td></tr><tr><td>FastDigest XbaI</td><td>Thermo Scientific</td><td>FD0684</td><td>stored at -20 &amp;deg;C</td></tr><tr><td>High-fidelity polymerase with proofreading: Q5 High-Fidelity DNA-Polymerase</td><td>New England Biolabs Inc</td><td>M0491S</td><td>stored at -20 &amp;deg;C</td></tr><tr><td>IKK&amp;beta; + T7-Promotor forward primer</td><td>Sigma-Aldrich</td><td></td><td>5&amp;prime;-GAAATTAATACGACTCACTATA&lt;br/&gt;GGGTTGATCTACCATGGACTACA&lt;br/&gt;AAGACG-3&amp;prime;, stored at -20 &amp;deg;C</td></tr><tr><td>IKK&amp;beta; + T7-Promotor reverse primer</td><td>Sigma-Aldrich</td><td></td><td>5&amp;prime;-GAGGAAGCGAGAGCT-CCATCTG-3&amp;prime;, stored at -20 &amp;deg;C</td></tr><tr><td>&lt;em&gt;In vitro&lt;/em&gt; mRNA transcription kit: HiScribe T7 ARCA mRNA kit (with polyA tailing)</td><td>New England BioLabs</td><td>E2060</td><td>stored at -20 &amp;deg;C</td></tr><tr><td>LS Columns</td><td>Miltenyi Biotec</td><td>130-042-401</td><td>stored at RT</td></tr><tr><td>MACS MultiStand</td><td>Miltenyi Biotec</td><td>130-042-303</td><td>stored at RT</td></tr><tr><td>mRNA transfection buffer and reagent: jetMESSENGER</td><td>Polyplus transfection</td><td>409-0001DE</td><td>stored at 4 &amp;deg;C</td></tr><tr><td>Mutant IKK&amp;beta; IKK-2S177/181E plasmid</td><td>Addgene</td><td>11105</td><td>stored at -20 &amp;deg;C</td></tr><tr><td>Mutant NEMOC54/347A plasmid</td><td>Addgene</td><td>27268</td><td>stored at -20 &amp;deg;C</td></tr><tr><td>pEGFP-N3 plasmid</td><td>Addgene</td><td>62043</td><td>stored at -20 &amp;deg;C</td></tr><tr><td>poly(I:C)</td><td>Calbiochem</td><td>528906</td><td>stored at -20 &amp;deg;C</td></tr><tr><td>pPGK-Cre plasmid</td><td></td><td></td><td>F.T. Wunderlich, H. Wildner, K. Rajewsky, F. Edenhofer, New variants of inducible Cre recombinase: A novel mutant of Cre-PR fusion protein exhibits enhanced sensitivity and an expanded range of inducibility. Nucleic Acids Res. 29, 47e (2001). stored at -20 &amp;deg;C</td></tr><tr><td>pseudo-UTP (100 mM)</td><td>Jena Biosience</td><td>NU-1139S</td><td>stored at -20 &amp;deg;C</td></tr><tr><td>QuadroMACS Separator</td><td>Miltenyi Biotec</td><td>130-090-976</td><td>stored at RT</td></tr><tr><td>Rat-anti-mouse CD11b antibody, APC-conjugated</td><td>BioLegend</td><td>101212</td><td>stored at 4 &amp;deg;C</td></tr><tr><td>Rat-anti-mouse F4/80 antibody, PE-conjugated</td><td>eBioscience</td><td>12-4801-82</td><td>stored at 4 &amp;deg;C</td></tr><tr><td>Recombinant M-CSF</td><td>Peprotech</td><td>315-02</td><td>stored at -20 &amp;deg;C</td></tr><tr><td>RNA purification kit: MEGAclear transcription clean-up kit</td><td>ThermoFisher Scientific</td><td>AM1908</td><td>stored at 4 &amp;deg;C</td></tr><tr><td>RNAse-degrading surfactant: RnaseZAP</td><td>Sigma-Aldrich</td><td>R2020</td><td>stored at RT</td></tr><tr><td>Ultrapure LPS from E.coli O111:B4</td><td>Invivogen</td><td></td><td>stored at -20 &amp;deg;C</td></tr><tr><td>Wild type IKK&amp;beta; plasmid</td><td>Addgene</td><td>11103</td><td>stored at -20 &amp;deg;C</td></tr><tr><td>Wild type NEMO plasmid</td><td>Addgene</td><td>27268</td><td>stored at -20 &amp;deg;C</td></tr></tbody></table>

highly efficient transfection of primary macrophages with in vitro transcribed mrna

Macrophages are phagocytic cells specialized in detecting molecules of non-self origin. To this end, they are equipped with a large array of pattern recognition receptors (PRRs). Unfortunately, this also makes macrophages particularly challenging to transfect as the transfection reagent and the transfected nucleic acids are often recognized by the PRRs as non-self. Therefore, transfection often results in macrophage activation and degradation of the transfected nucleic acids or even in suicide of the macrophages. Here, we describe a protocol that allows highly efficient transfection of murine primary macrophages such as peritoneal macrophages (PM) and bone marrow-derived macrophages (BMDM) with mRNA in vitro transcribed from DNA templates such as plasmids. With this simple protocol, transfection rates of about 50-65% for PM and about 85% for BMDM are achieved without cytotoxicity or immunogenicity observed. We describe in detail the generation of mRNA for transfection from DNA constructs such as plasmids and the transfection procedure.

We have successfully used this protocol to generate mRNA encoding for FLAG-tagged NEMO and IKK&#946; variants for transfection of primary macrophages16. The plasmids encoding for FLAG-tagged wild-type (NEMOWT) and C54/347A mutant NEMO (NEMOC54/374A) (see the Table of Materials) already contain a T7 promotor in the correct orientation (Figure 1A). Thus, we only had to linearize the...

Watch this Scientific Journal Video about Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA at JoVE.com

Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA

Macrophages, especially primary macrophages, are challenging to transfect as they specialize in detecting molecules of non-self origin. We describe a protocol that allows highly efficient transfection of primary macrophages with mRNA generated from DNA templates such as plasmids.

Macrophages are phagocytic cells specialized in detecting molecules of non-self origin. To this end, they are equipped with a large array of pattern ...

highly-efficient-transfection-primary-macrophages-with-vitro

Research

JoVE Journal

Immunology and Infection

22.3K Views.  University of Cologne. elektronisch chiming Omdat macrofagen gespecialiseerd zijn in het detecteren van moleculen van niet-zelfoorsprong, zijn ze bijzonder moeilijk te transfecteren. We beschrijven een protocol dat een zeer efficiënte transfectie van primaire macrofagen mogelijk maakt met mRNA gegenereerd uit DNA-sjablonen zoals plasmiden. Het belangrijkste voordeel van onze methode is dat hoge transfectiepercentages worden bereikt bij afwezigheid van detecteerbare cytotoxiciteit of immunogeniciteit.Het aan...

Video: Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA

Optimized Protocol for Efficient Transfection of Dendritic Cells without Cell Maturation

Dendritic cells (DCs) can be considered sentinels of the immune system which play a critical role in its initiation and response to infection1. Detection of pathogenic antigen by na&iuml;ve DCs is through pattern recognition receptors (PRRs) which are able to recognize specific conserved structures referred to as pathogen-associated molecular patterns (PAMPS). Detection of PAMPs by DCs triggers an intracellular signaling cascade resulting in their activation and transformation to mature DCs. This process is typically characterized by production of type 1 interferon along with other proinflammatory cytokines, upregulation of cell surface markers such as MHCII and CD86 and migration of the mature DC to draining lymph nodes, where interaction with T cells initiates the adaptive immune response2,3. Thus, DCs link the innate and adaptive immune systems. 
The ability to dissect the molecular networks underlying DC response to various pathogens is crucial to a better understanding of the regulation of these signaling pathways and their induced genes. It should also help facilitate the development of DC-based vaccines against infectious diseases and tumors. However, this line of research has been severely impeded by the difficulty of transfecting primary DCs4.
Virus transduction methods, such as the lentiviral system, are typically used, but carry many limitations such as complexity and bio-hazardous risk (with the associated costs)5,6,7,8. Additionally, the delivery of viral gene products increases the immunogenicity of those transduced DCs9,10,11,12. Electroporation has been used with mixed results13,14,15, but we are the first to report the use of a high-throughput transfection protocol and conclusively demonstrate its utility.
In this report we summarize an optimized commercial protocol for high-throughput transfection of human primary DCs, with limited cell toxicity and an absence of DC maturation16. Transfection efficiency (of GFP plasmid) and cell viability were more than 50% and 70% respectively. FACS analysis established the absence of increase in expression of the maturation markers CD86 and MHCII in transfected cells, while qRT-PCR demonstrated no upregulation of IFN&beta;. Using this electroporation protocol, we provide evidence for successful transfection of DCs with siRNA and effective knock down of targeted gene RIG-I, a key viral recognition receptor16,17, at both the mRNA and protein levels.

We present our optimized high-throughput nucleofection protocol as an efficient way of transfecting primary human monocyte-derived dendritic cells with either plasmid DNA or siRNA without causing cell maturation. We further provide evidence for successful siRNA silencing of targeted gene RIG-I at both the mRNA and protein levels.

Dendritic cells (DCs) can be considered sentinels of the immune system which play a critical role in its initiation and response to infection1. Detection ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells. When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the pathogen, produce various cytokines and chemokines to recruit and stimulate other immune cells, and present antigens to stimulate the adaptive immune response. Thus, being able to efficiently manipulate macrophages with techniques such as RNA-interference (RNAi) is critical to our ability to investigate this important innate immune cell. However, macrophages can be technically challenging to transfect and can exhibit inefficient RNAi-induced gene knockdown. In this protocol, we describe methods to efficiently transfect two mouse macrophage cell lines (RAW264.7 and J774A.1) with siRNA using the Amaxa Nucleofector 96-well Shuttle System and describe procedures to maximize the effect of siRNA on gene knockdown. Moreover, the described methods are adapted to work in 96-well format, allowing for medium and high-throughput studies. To demonstrate the utility of this approach, we describe experiments that utilize RNAi to inhibit genes that regulate lipopolysaccharide (LPS)-induced cytokine production.

In this protocol, we describe methods to efficiently transfect murine macrophage cell lines with siRNAs using the Amaxa Nucleofector 96-well Shuttle System, stimulate the macrophages with lipopolysaccharide, and monitor the effects on inflammatory cytokine production.

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

A Guide to Precise Gene Disruption in Primary Bone Marrow-Derived Macrophages

High-Efficiency Gene Disruption in Primary Bone Marrow-Derived Macrophages Using Electroporated Cas9-sgRNA Complexes

Bone marrow-derived macrophages (BMDMs) from mice are a key tool for studying the complex biology of tissue macrophages. As primary cells, they model the physiology of macrophages in vivo more closely than immortalized macrophage cell lines and can be derived from mice already carrying defined genetic changes. However, disrupting gene function in BMDMs remains technically challenging. Here, we provide a protocol for efficient CRISPR/Cas9 genome editing in BMDMs, which allows for the introduction of small insertions and deletions (indels) that result in frameshift mutations that disrupt gene function. The protocol describes how to synthesize single-guide RNAs (sgRNA-Cas9) and form purified sgRNA-Cas9 ribonucleoprotein complexes (RNPs) that can be delivered by electroporation. It also provides an efficient method for monitoring editing efficiency using routine Sanger sequencing and a freely available online analysis program. The protocol can be performed within 1 week and does not require plasmid construction; it typically results in 85% to 95% editing efficiency.

Author Spotlight: Efficient CRISPR/Cas9 Genome Editing in Bone Marrow-Derived Macrophages for Precise Gene Disruption

This protocol describes the procedure for genome editing in mouse bone marrow-derived macrophages using Cas9-sgRNA ribonucleoprotein complexes assembled in vitro and delivered by electroporation.

Bone marrow-derived macrophages (BMDMs) from mice are a key tool for studying the complex biology of tissue macrophages. As primary cells, they model the ...

Genetics

Highly Efficient Transfection of Human THP-1 Macrophages by Nucleofection

Macrophages, as key players of the innate immune response, are at the focus of research dealing with tissue homeostasis or various pathologies. Transfection with siRNA and plasmid DNA is an efficient tool for studying their function, but transfection of macrophages is not a trivial matter. Although many different approaches for transfection of eukaryotic cells are available, only few allow reliable and efficient transfection of macrophages, but reduced cell vitality and severely altered cell behavior like diminished capability for differentiation or polarization are frequently observed. Therefore a transfection protocol is required that is capable of transferring siRNA and plasmid DNA into macrophages without causing serious side-effects thus allowing the investigation of the effect of the siRNA or plasmid in the context of normal cell behavior. The protocol presented here provides a method for reliably and efficiently transfecting human THP-1 macrophages and monocytes with high cell vitality, high transfection efficiency, and minimal effects on cell behavior. This approach is based on Nucleofection and the protocol has been optimized to maintain maximum capability for cell activation after transfection. The protocol is adequate for adherent cells after detachment as well as cells in suspension, and can be used for small to medium sample numbers. Thus, the method presented is useful for investigating gene regulatory effects during macrophage differentiation and polarization. Apart from presenting results characterizing macrophages transfected according to this protocol in comparison to an alternative chemical method, the impact of cell culture medium selection after transfection on cell behavior is also discussed. The presented data indicate the importance of validating the selection for different experimental settings.

This protocol presents an efficient and reliable method to transfect human THP-1 macrophages with siRNA or plasmid DNA by electroporation with high transfection efficiency while maintaining high cell vitality and full macrophage capacity for differentiation and polarization.

Macrophages, as key players of the innate immune response, are at the focus of research dealing with tissue homeostasis or various pathologies. ...

Isolation, Transfection, and Culture of Primary Human Monocytes

Human immunodeficiency virus (HIV) remains a major health concern despite the introduction of combined antiretroviral therapy (cART) in the mid-1990s. While antiretroviral therapy efficiently lowers systemic viral load and restores normal CD4+ T cell counts, it does not reconstitute a completely functional immune system. A dysfunctional immune system in HIV-infected individuals undergoing cART may be characterized by immune activation, early aging of immune cells, or persistent inflammation. These conditions, along with comorbid factors associated with HIV infection, add complexity to the disease, which cannot be easily reproduced in cellular and animal models. To investigate the molecular events underlying immune dysfunction in these patients, a system to culture and manipulate human primary monocytes in vitro is presented here. Specifically, the protocol allows for the culture and transfection of primary CD14+ monocytes obtained from HIV-infected individuals undergoing cART as well as from HIV-negative controls. The method involves isolation, culture, and transfection of monocytes and monocyte-derived macrophages. While commercially available kits and reagents are employed, the protocol provides important tips and optimized conditions for successful adherence and transfection of monocytes with miRNA mimics and inhibitors as well as with siRNAs.

Presented here is an optimized protocol for isolating, culturing, transfecting, and differentiating human primary monocytes from HIV-infected individuals and healthy controls.

Human immunodeficiency virus (HIV) remains a major health concern despite the introduction of combined antiretroviral therapy (cART) in the mid-1990s. ...

Polyethyleneimine-coated Iron Oxide Nanoparticles as a Vehicle for the Delivery of Small Interfering RNA to Macrophages In Vitro and In Vivo

Because of their critical role in regulating immune responses, macrophages have continuously been the subject of intensive research and represent a promising therapeutic target in many disorders, such as autoimmune diseases, atherosclerosis, and cancer. RNAi-mediated gene silencing is a valuable approach of choice to probe and manipulate macrophage function; however, the transfection of macrophages with siRNA is often considered to be technically challenging, and, at present, few methodologies dedicated to the siRNA transfer to macrophages are available. Here, we present a protocol of using polyethyleneimine-coated superparamagnetic iron oxide nanoparticles (PEI-SPIONs) as a vehicle for the targeted delivery of siRNA to macrophages. PEI-SPIONs are capable of binding and completely condensing siRNA when the Fe:siRNA weight ratio reaches 4 and above. In vitro, these nanoparticles can efficiently deliver siRNA into primary macrophages, as well as into the macrophage-like RAW 264.7 cell line, without compromising cell viability at the optimal dose for transfection, and, ultimately, they induce siRNA-mediated target gene silencing. Apart from being used for in vitro siRNA transfection, PEI-SPIONs are also a promising tool for delivering siRNA to macrophages in vivo. In view of its combined features of magnetic property and gene-silencing ability, systemically administered PEI-SPION/siRNA particles are expected not only to modulate macrophage function but also to enable macrophages to be imaged and tracked. In essence, PEI-SPIONs represent a simple, safe, and effective nonviral platform for siRNA delivery to macrophages both in vitro and in vivo.

Polyethyleneimine-coated Iron Oxide Nanoparticles as a Vehicle for the Delivery of Small Interfering RNA to Macrophages In Vitro and In Vivo

We describe a method of using polyethyleneimine (PEI)-coated superparamagnetic iron oxide nanoparticles for transfecting macrophages with siRNA. These nanoparticles can efficiently deliver siRNA to macrophages in vitro and in vivo and silence target gene expression.

Because of their critical role in regulating immune responses, macrophages have continuously been the subject of intensive research and represent a ...

Medicine

Lentiviral Vector Preparation for In Vivo Gene Modulation 

Lentiviral Vector Preparation for Efficient Gene and MicroRNA Modulation of Peritoneal Cavity Tissue&#45;Resident Macrophages In Vivo in Mice

Peritoneal tissue-resident macrophages have broad functions in the maintenance of homeostasis and are involved in pathologies within local and neighboring tissues. Their functions are dictated by microenvironmental cues; thus, it is essential to investigate their behavior in an in vivo physiological niche. Currently, specific peritoneal macrophage-targeting methodologies employ whole-mouse transgenic models. Here, a protocol for effective in vivo modulation of mRNA and small RNA species (e.g., microRNA) expression in peritoneal macrophages using lentivirus particles is described. Lentivirus preparations were made in HEK293T cells and purified on a single sucrose layer. In vivo validation of lentivirus effectivity following intraperitoneal injection revealed predominant infection of macrophages restricted to local tissue. Targeting of peritoneal macrophages was successful during homeostasis and thioglycolate-induced peritonitis. The limitations of the protocol, including low-level inflammation induced by intraperitoneal delivery of lentivirus and time restrictions for potential experiments, are discussed. Overall, this study presents a quick and accessible protocol for the rapid assessment of gene function in peritoneal macrophages in vivo.

Author Spotlight: Exploring Macrophage Immunometabolism Through Lentiviral Vector&#45;Mediated Gene Manipulation

We demonstrate a step-by-step protocol for the investigation of gene function in peritoneal tissue-resident macrophages in vivo, using lentiviral vectors.

Peritoneal tissue-resident macrophages have broad functions in the maintenance of homeostasis and are involved in pathologies within local and neighboring ...

Transfecting RAW264.7 Cells with a Luciferase Reporter Gene

Transfection of desired genetic materials into cells is an inevitable procedure in biomedical research studies. While numerous methods have been described, certain types of cells are resistant to many of these methods and yield low transfection efficiency1, potentially hindering research in those cell types. In this protocol, we present an optimized transfection procedure to introduce luciferase reporter genes as a plasmid DNA into the RAW264.7 macrophage cell line. Two different types of transfection reagents (lipid-based and polyamine-based) are described, and important notes are given throughout the protocol to ensure that the RAW264.7 cells are minimally altered by the transfection procedure and any experimental data obtained are the direct results of the experimental treatment. While transfection efficiency may not be higher compared to other transfection methods, the described procedure is robust enough for detecting luciferase signal in RAW264.7 without changing the physiological response of the cells to stimuli.

Transfection into the macrophage cell line, RAW264.7, is difficult due to the cell&#8217;s natural response against foreign materials. We described here a gentle yet robust procedure for transfecting luciferase reporter genes into RAW264.7 cells.

Transfection of desired genetic materials into cells is an inevitable procedure in biomedical research studies. While numerous methods have been ...

Biology

Expression of Fluorescent Fusion Proteins in Murine Bone Marrow-derived Dendritic Cells and Macrophages

Dendritic cells and macrophages are crucial cells that form the first line of defense against pathogens. They also play important roles in the initiation of an adaptive immune response. Experimental work with these cells is rather challenging. Their abundance in organs and tissues is relatively low. As a result, they cannot be isolated in large numbers. They are also difficult to transfect with cDNA constructs. In the murine model, these problems can be partially overcome by in vitro differentiation from bone marrow progenitors in the presence of M-CSF for macrophages or GM-CSF for dendritic cells. In this way, it is possible to obtain large amounts of these cells from very few animals. Moreover, bone marrow progenitors can be transduced with retroviral vectors carrying cDNA constructs during early stages of cultivation prior to their differentiation into bone marrow derived dendritic cells and macrophages. Thus, retroviral transduction followed by differentiation in vitro can be used to express various cDNA constructs in these cells. The ability to express ectopic proteins substantially extends the range of experiments that can be performed on these cells, including live cell imaging of fluorescent proteins, tandem purifications for interactome analyses, structure-function analyses, monitoring of cellular functions with biosensors and many others. In this article, we describe a detailed protocol for retroviral transduction of murine bone marrow derived dendritic cells and macrophages with vectors coding for fluorescently-tagged proteins. On the example of two adaptor proteins, OPAL1 and PSTPIP2, we demonstrate its practical application in flow cytometry and microscopy. We also discuss the advantages and limitations of this approach.

In this article, we provide a detailed protocol for the expression of fluorescent fusion proteins in murine bone marrow derived dendritic cells and macrophages. The method is based on the transduction of bone marrow progenitors with retroviral constructs followed by differentiation into macrophages and dendritic cells in vitro.

Dendritic cells and macrophages are crucial cells that form the first line of defense against pathogens. They also play important roles in the initiation ...

Transfecting Primary Macrophages with Modified mRNA

Source: Herb, M. et al., <a href="https://app.jove.com/v/60143">Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA.</a> J. Vis. Exp. (2019)
This video demonstrates the process of transfecting primary macrophages with modified mRNA encoding green fluorescent protein. These modified mRNAs, designed to reduce immunogenicity and improve its stability, ensure the successful transfection and subsequent expression of green fluorescent proteins, which is confirmed through fluorescence microscopy.

Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video