This work was supported by the Deutsche Forschungsgemeinschaft (SFB 670).

Macrophage isolation from mice was performed in accordance with the Animal Protection Law of Germany in compliance with the Ethics Committee at the University of Cologne.
NOTE: Carry out all steps wearing gloves. Carry out all transfection steps under a laminar flow hood to prevent contamination of the cells. Before working with mRNA, clean all instruments such as pipettes and every surface with 70% ethanol and/or a RNAse-degrading surfactant (Table of Materials). Ensure that all reaction tubes are RNAse-free and sterile. Use only sterile, RNAase-free water for dilutions. Exclusively use pipette tips with filters. Change pipette tips after every pipetting step.
1. Generation of the DNA Template
NOTE: The DNA template for in vitro mRNA transcription using this protocol must contain a T7 promotor sequence to allow docking of the RNA polymerase. If the plasmid containing the DNA sequence of the protein of interest already contains a correctly orientated T7 promotor sequence directly upstream of the sequence of interest, linearization of the plasmid (see step 1.1.) needs to be performed. Otherwise, attach a T7 promotor to the sequence of interest by polymerase chain reaction (PCR, see step 1.2.).
<ol>
	<li>Linearization of T7 promotor-containing plasmids
	<ol>
		<li>Linearize plasmids already containing a correctly orientated T7 promotor sequence by digestion with a restriction enzyme cutting downstream of the stop codon of the sequence of interest. Otherwise, transcription will not end properly after the sequence of interest. 
		NOTE: It is best to use restriction enzymes leaving blunt ends or 5&#39; overhangs.</li>
		<li>Confirm complete linearization of the plasmid by agarose gel electrophoresis of undigested versus digested plasmid DNA.</li>
		<li>Purify linearized plasmid DNA prior to use as DNA template for in vitro mRNA transcription using a DNA purification kit (Table of Materials).</li>
	</ol>
	</li>
	<li>Attachment of the T7 promotor by PCR
	<ol>
		<li>Use a forward primer containing the following components (in the indicated order from 5&#39; to 3&#39;): about 5 random bp upstream of the promotor (e.g., GAAAT); the T7 promotor sequence (TAATACGACTCACTATAG); two extra Gs for increased transcription efficiency (GG); the target sequence-specific part that is homologous to the plasmid sequence surrounding the start codon. 
		NOTE: It should be composed of: 3-6 bp upstream of the KOZAK sequence and start codon, the KOZAK sequence and start codon (usually GCCACC ATG G), 12-18 bp downstream of the start codon. If the sequence of interest does not already contain a KOZAK sequence or start codon, these can be attached in this step by simply including them in the primer sequence.</li>
		<li>Calculate the tm of the forward primer only by taking into account the part homologous to the target sequence.</li>
		<li>To assess dimers/hairpin formation use the whole primer sequence, which easily can exceed 50 bp.</li>
		<li>Use a reverse primer located somewhere downstream of the stop codon. 
		NOTE: If the sequence of interest doesn&#39;t already contain a stop codon, it can be attached in this step by simply including it in the primer sequence.</li>
		<li>Use the forward and reverse primers to perform a PCR using a high-fidelity polymerase with proofreading (Table of Materials).</li>
		<li>Confirm generation of a single product and amplicon size by agarose gel electrophoresis (e.g., use a 1% agarose gel and 100 V constant current).</li>
		<li>Purify the PCR product prior to use as DNA template for in vitro mRNA transcription using a DNA purification kit.</li>
	</ol>
	</li>
</ol>
2. mRNA Generation
<ol>
	<li>Thaw all components of the in vitro mRNA transcription kit (see the Table of Materials). Vortex for 5 s and spin down for 2 s at 2,000 x g. Keep on ice until use.</li>
	<li>Prepare the reaction mix for in vitro mRNA transcription in a 0.5 mL microcentrifuge tube in the following order (total volume of 40 &#181;L): 20 &#181;L of 10x ARCA/NTP mix (included in the in vitro mRNA transcription kit); 0.25 &#181;L of 5-methyl-CTP (final concentration (f.c.) is 1.25 mM; 50% of total CTP); 0.25 &#181;L of pseudo-UTP (f.c. is 1.25 mM; 50% of total UTP); X &#181;L of DNA template; 2 &#181;L of T7 RNA polymerase mix (included in the in vitro mRNA transcription kit); Y &#181;L of RNAse-free H2O. 
	NOTE: X is a volume containing at least 1 &#181;g of DNA. For example, 1.6 &#181;L from a 625 ng/&#181;L stock solution. Y is the spare volume to the total volume of 40 &#181;L.</li>
	<li>Vortex for 5 s and spin down for 2 s at 2,000 x g. Incubate at 37 &#176;C for 30 min at 400 rpm on a thermal mixer for in vitro transcription.</li>
	<li>Then, add 2 &#181;L of DNase I directly into the reaction mix for removal of the template DNA. Vortex for 5 s and spin down for 2 s at 2,000 x g.</li>
	<li>Incubate at 37 &#176;C for 15 min at 400 rpm on a thermal mixer. Take an aliquot of 2 &#181;L for the control gel (step 3.3) and store at -80 &#176;C.</li>
	<li>For poly(A) tailing, add the following components directly into the previous reaction mix (to a final volume of 50 &#181;L): 5 &#181;L of 10x poly(A) polymerase reaction buffer and 5 &#181;L of poly(A) polymerase (both included in the in vitro mRNA transcription kit). Vortex for 5 s and spin down for 2 s at 2,000 x g.</li>
	<li>Incubate the mix at 37 &#176;C for 30 min at 400 rpm on a thermomixer. Take an aliquot of 2 &#181;L for the control gel (step 3.3) and store at -80 &#176;C.</li>
	<li>For dephosphorylation of the 5&#180;-ends of the mRNA, add the following components directly into the previous reaction mix (to a final volume of 60 &#181;L): 3 &#181;L of RNAse-free H2O; 6 &#181;L of 10x Antarctic phosphatase reaction buffer; 3 &#181;L of Antarctic phosphatase (15 units for 60 &#181;L reaction volume). Vortex for 5 s and spin down for 2 s at 2,000 x g.</li>
	<li>Incubate the mix at 37 &#176;C for 30 min at 400 rpm on a thermal mixer.</li>
	<li>Heat-inactivate Antarctic phosphatase by incubation at 80 &#176;C for 2 min. 
	NOTE: Ideally, use a separate thermal mixer, do not wait until the first mixer reaches the desired temperature.</li>
</ol>
3. mRNA Purification
<ol>
	<li>Purify the in vitro transcribed mRNA using a dedicated RNA purification kit (Table of Materials).
	<ol>
		<li>Add X &#181;L of elution solution to the mRNA reaction mix from step 2.10. Mix by inverting 5 times. Add 300 &#181;L of binding solution concentrate. Mix by gentle pipetting 5 times. 
		NOTE: X is the spare volume to a total volume of 100 &#181;L. For example, add 40 &#181;L elution solution to 60 &#181;L mRNA reaction mix.</li>
		<li>Add 100 &#181;L of RNAase-free ethanol. Mix by gentle pipetting 5 times.</li>
		<li>Place a filter column in one of the supplied collection tubes. Transfer the mRNA reaction mix gently onto the center of the filter without touching the filter. Centrifuge at 15,000 x g for 1 min at room temperature (RT).</li>
		<li>Carefully lift the filter column and discard the flow-through in the collection tube. Place the filter column back into the same collection tube.</li>
		<li>Add 500 &#181;L of wash solution (do not forget to add 20 mL of RNAase-free ethanol before using the wash solution for the first time).</li>
		<li>Centrifuge at 15,000 x g for 1 min at RT. Repeat steps 3.1.4-3.1.6 to wash one more time.</li>
		<li>Centrifuge at full speed (17,900 x g) for 1 min at RT to remove any residual fluid from the filter column. Carefully take the filter column from the collection tube. Place the filter column in a new collection tube.</li>
		<li>Add 50 &#181;L of elution buffer onto the center of the filter without touching the filter. Incubate at 65 &#176;C for 10 min on a thermal mixer.</li>
		<li>Centrifuge at 15,000 x g for 1 min at RT. Remove the filter column and discard it.</li>
	</ol>
	</li>
	<li>Measure the concentration and purity of the eluted mRNA, for example, by using a microvolume spectrophotometer to measure absorbance at 260 and 280 nm. 
	NOTE: An A260/A280 ratio of 1.8-2.1 is indicative of highly purified mRNA.</li>
	<li>Verify presence of a single product, correct transcript length and poly(A) tailing by analyzing the aliquots from steps 2.5 and 2.7 by agarose gel electrophoresis under denaturing conditions (for example, use a 1.2% agarose gel containing 20 mM 3-(N-morpholino)propanesulfonic acid [MOPS], 5 mM sodium acetate, 1 mM EDTA and 20% formaldehyde and run in 20 mM MOPS, 5 mM sodium acetate, 1 mM EDTA and 0.74 % formaldehyde at 100 V constant current).</li>
	<li>Store the purified mRNA in the elution tube at -80 &#176;C until transfection. If using only low amounts of the mRNA for transfection then aliquot the mRNA to avoid repeated freeze-thaw cycles. 
	NOTE: mRNA can be stored at -80 &#176;C for about 1 year.</li>
</ol>
4. Macrophage Preparation
<ol>
	<li>Euthanize C57/BL6 mice (use mice of the same sex and of 6-24 weeks of age) by cervical dislocation. 
	NOTE: The same mice can be used for isolation of PM (step 4.2) and generation of BMDM (steps 4.3 and 4.4). For isolation of PM use at least two mice. If only BMDM are to be generated one mouse usually is enough.</li>
	<li>Immunomagnetic enrichment of peritoneal macrophages.
	<ol>
		<li>Fill a 10 mL syringe with a 0.9 x 40 mm cannula with 8 mL of ice-cold phosphate-buffered saline (PBS) and 2 mL of air. Flush the peritoneal cavity with PBS. The air will form a bubble that minimizes leakage of the PBS.</li>
		<li>Quickly collect peritoneal lavage with the same syringe and transfer into a 50 mL conical centrifugation tube. Combine peritoneal cells of multiple mice if required. Keep cell suspension on ice.</li>
		<li>Centrifuge cell suspension at 650 x g for 5 min at 4 &#176;C. Discard the supernatant and resuspend the cell pellet in 5 mL of 0.2 % NaCl for 30 s to lyse red blood cells.</li>
		<li>Add 5 mL of 1.6% NaCl to a total volume of 10 mL to reconstitute isotonic conditions. Centrifuge at 650 x g for 5 min at 4 &#176;C.</li>
		<li>Discard the supernatant and resuspend the cell pellet in 97.5 &#181;L of magnetic cell sorting (MCS) buffer (2 mM ethylenediaminetetraacetic acid [EDTA], 0.5% bovine serum albumin [BSA] in PBS) per 1 peritoneal lavage (e.g., if three mice were flushed, resuspend in 292.5 &#181;L).</li>
		<li>Add 2.5 &#181;L of paramagnetic beads conjugated to an CD11b-specific antibody per 97.5 &#181;L of cell suspension (e.g., add 7.5 &#181;L to 292.5 &#181;L).</li>
		<li>Incubate on ice for 15 min at 150 rpm on an orbital shaker.</li>
		<li>Centrifuge cell suspension at 650 x g for 5 min at 4 &#176;C, discard the supernatant and resuspend the cell pellet in 1 mL of MCS buffer.</li>
		<li>Add 4 mL of MCS buffer to a total volume of 5 mL and wash the cells by gently pipetting up and down three times.</li>
		<li>Repeat steps 4.2.8 and 4.2.9 two more times for a total of three wash steps.</li>
		<li>During the wash steps place an LS column in a magnetic cell separator (see Table of Materials). Rinse the column with 3 mL of MCS buffer. 
		NOTE: Avoid any bubbles as these may clog the column.</li>
		<li>Resuspend the cell pellet in 1 mL of MCS buffer. Add 3 mL of MCS buffer to a total volume of 4 mL, mix by pipetting up and down three times.</li>
		<li>Transfer the 4 mL of cell suspension onto the rinsed LS column. 
		NOTE: Again, avoid any bubbles as these may clog the column.</li>
		<li>Wait until the reservoir of the column is completely empty. Do not add additional fluid until the column stops dripping.</li>
		<li>Add 3 mL of MCS buffer onto the column. Then, wait until the reservoir of the column is completely empty. Repeat step 4.2.15 two more times.</li>
		<li>Place the LS column in a 15 mL conical centrifugation tube. Apply 5 mL of MCS buffer onto the column. Wait until 2 mL of fluid has passed through the column, then use the plunger to gently push the remaining fraction into the tube.</li>
		<li>Centrifuge cell suspension at 650 x g for 5 min at 4 &#176;C and discard the supernatant.</li>
		<li>Resuspend the cell pellet in 1 mL of DMEM supplemented with 10% heat-inactivated fetal calf serum (FCS) (DMEM+FCS).</li>
		<li>Determine the number of viable cells by counting in trypan blue solution in a Neubauer counting chamber and seed cells in DMEM+FCS into culture plates. 
		NOTE: Seed PM at a density of 100,000 cells/well in a flat bottom microtiter plate. Do not use tissue culture-treated plates as PM cannot be detached from these. Use non-treated plates instead.</li>
	</ol>
	</li>
	<li>Generation of BMDM
	<ol>
		<li>Remove skin and muscles from the hind legs using a pair of scissors. Wash each leg by short submersion in 70% ethanol.</li>
		<li>Detach legs and open both ends of the femur and the tibia by cutting with scissors.</li>
		<li>Fill a 5 mL syringe filled with a 0.6 mm x 30 mm cannula with 5 mL of very low endotoxin (VLE) RPMI 1640 and flush the bone marrow out of the opened bones into a culture dish.</li>
		<li>Combine bone marrow of multiple mice if required by repeating steps 4.3.1-4.3.3. Transfer the bone marrow into a 50 mL conical centrifugation tube.</li>
		<li>Centrifuge the bone marrow suspension at 650 x g for 5 min at 4 &#176;C and discard the supernatant.</li>
		<li>Resuspend the cell pellet in 5 mL of red blood cell lysis buffer (8.3% NH4Cl, 0.1 M Tris) and incubate for 5 min at RT to lyse the red blood cells.</li>
		<li>Centrifuge the cell suspension at 650 x g at 4&#176; C for 5 min and discard the supernatant.</li>
		<li>Resuspend the cell pellet in 1 mL of VLE RPMI 1640 medium supplemented with 10% FCS, 1% penicillin/streptomycin, 1% HEPES, 1% sodium pyruvate and 10 ng/mL recombinant macrophage colony-stimulating factor (M-CSF) (RPMI+++++).</li>
		<li>Add 4 mL of RPMI+++++ to a total volume of 5 mL.</li>
		<li>Prepare 5 92 mm x 16 mm untreated Petri dishes with cams (see the Table of Materials) per mouse by pipetting 7 mL of RPMI+++++ medium into each dish.</li>
		<li>Transfer the 1 mL of cell solution to the 5 prepared culture dishes and incubate at 37 &#176;C and 5% CO2.</li>
		<li>After 4 days, feed the cells by adding 4 mL of RPMI+++++. After 6-7 days, the bone marrow cells are fully differentiated into BMDM.</li>
	</ol>
	</li>
	<li>Harvesting of BMDM
	<ol>
		<li>Completely remove the medium from culture dishes. Add 5 mL of warm 0.2 mM EDTA in PBS to each dish.</li>
		<li>Gently scrape the whole plate with a cell scraper to detach the BMDM. Combine the cell suspensions in a 50 mL conical centrifugation tube.</li>
		<li>Flush all 5 dishes again. Use the same volume of 5 mL of warm 0.2 mM EDTA in PBS for all 5 dishes. Combine this cell suspension with the one from the previous step.</li>
		<li>Centrifuge the cell suspension at 650 x g for 5 min at 4&#176; C and discard the supernatant.</li>
		<li>Resuspend the cell pellet in 1 mL of VLE RPMI 1640 medium supplemented with 10% FCS, 1% HEPES, 1% sodium pyruvate and 10 ng/mL recombinant M-CSF but no antibiotics (RPMI++++).</li>
		<li>Determine the number of viable cells by counting in trypan blue solution in a Neubauer counting chamber and seed cells in RPMI++++ into culture plates. 
		NOTE: Seed BMDM at a density of 50,000 cells/well maximum in a flat bottom microtiter plate. Do not use tissue culture-treated plates as BMDM can hardly be detached from these. Use non-treated plates instead.</li>
	</ol>
	</li>
</ol>
5. Transfection of Macrophages with mRNA
<ol>
	<li>Calculate the required volume of mRNA transfection buffer. 
	NOTE: The volume of mRNA transfection buffer required depends on well size: use 200 &#181;L for transfection in a 6-well plate, 100 &#181;L in a 12-well plate and so on. Always add a little spare volume because of pipetting loss (but not too much, to prevent undue dilution of mRNA). For example, use 450 &#181;L instead of 4 x 100 &#181;L = 400 &#181;L to transfect in 4 wells of a 12-well plate.</li>
	<li>Calculate the required volume of mRNA transfection reagent. The mRNA transfection reagent is added at a ratio of 1:50. For example, 9 &#181;L of mRNA transfection reagent is required for a final volume of 450 &#181;L.</li>
	<li>Calculate the total amount of mRNA required. At least 100 ng per 100,000 macrophages are required for efficient transfection, 200 ng works even better (e.g., 800 ng mRNA to transfect 400,000 macrophages).
	<ol>
		<li>Multiply the calculated amount of mRNA required with the total number of wells that have to be transfected (e.g., 4 wells with 400,000 macrophages each: 4 x 800 ng = 3,200 ng mRNA is required in total for all wells). For example, if your mRNA stock is 426.8 ng/&#181;L, 7.49 &#181;L are needed for optimal transfection of 4 wells with 400,000 macrophages each.</li>
	</ol>
	</li>
	<li>Add the calculated volume of mRNA transfection buffer (step 5.1.) minus the volumes for mRNA transfection reagent (step 5.2) and the mRNA (step 5.3) to a reaction tube. For example, 450 &#181;L - 9 &#181;L - 7.49 &#181;L = 433.51 &#181;L.</li>
	<li>Thaw the mRNA stock and mix it by gentle flipping of the elution tube. Add the calculated volume of mRNA (step 5.3) to the reaction tube with mRNA reaction buffer (in the example presented above: 7.49 &#181;L in 433.51 &#181;L).</li>
	<li>Vortex for 5 s and spin down for 2 s at 2,000 x g.</li>
	<li>Vortex the mRNA transfection reagent for 5 s and spin down for 2 s at 2,000 x g.</li>
	<li>Add the calculated volume of mRNA transfection reagent (step 5.2) to the reaction tube containing the mRNA transfection buffer and the mRNA (in the example presented above: 9 &#181;L of mRNA transfection reagent).</li>
	<li>Vortex the transfection mix for 5 s and spin down for 2 s at 2,000 x g.</li>
	<li>Incubate for 15 min at RT.</li>
	<li>Meanwhile, replace the culture medium of the macrophages with fresh, warm culture medium (see steps 4.2.18. and 4.4.5).</li>
	<li>After the incubation step 5.10, add the transfection mix to the wells containing the macrophages in a volume appropriate for the size of the well (see step 5.1). Add the transfection mix dropwise in a circle from the outside to the middle of the well.</li>
	<li>Gently rock the plate, first in a vertical and then in a horizontal direction to ensure uniform distribution of the transfection mix in the well. Then, incubate at 37 &#176;C and 5 % CO2. Synthesis of the protein encoded by the transfected mRNA will begin shortly after transfection. For best results, incubate for at least 6 h.</li>
	<li>After the incubation, analyze transfection efficiency by (immuno)fluorescence microscopy, flow cytometry or immunoblot16, or use the transfected macrophages for the experiment of choice.</li>
</ol>

<ol>
	<li>Ley, K., Pramod, A. B., Croft, M., Ravichandran, K. S., Ting, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+Mouse+Macrophages+Sense+What+Is+Going+On.">How Mouse Macrophages Sense What Is Going On.</a> Frontiers in Immunology. 7 (204), (2016).</li><li>Zhang, X., Edwards, J. P., Mosser, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expression+of+exogenous+genes+in+macrophages:+obstacles+and+opportunities.">The expression of exogenous genes in macrophages: obstacles and opportunities.</a> Methods in Molecular Biolology. 531, 123-143 (2009).</li><li>Guo, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfection+reagent+Lipofectamine+triggers+type+I+interferon+signaling+activation+in+macrophages.">Transfection reagent Lipofectamine triggers type I interferon signaling activation in macrophages.</a> Immunology and cell biology. 97 (1), 92-96 (2019).</li><li>Kariko, K., Weissman, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Naturally+occurring+nucleoside+modifications+suppress+the+immunostimulatory+activity+of+RNA:+implication+for+therapeutic+RNA+development.">Naturally occurring nucleoside modifications suppress the immunostimulatory activity of RNA: implication for therapeutic RNA development.</a> Current Opinion in Drug Discovery and Development. 10 (5), 523-532 (2007).</li><li>Van De Parre, T. J., Martinet, W., Schrijvers, D. M., Herman, A. G., De Meyer, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mRNA+but+not+plasmid+DNA+is+efficiently+transfected+in+murine+J774A.1+macrophages.">mRNA but not plasmid DNA is efficiently transfected in murine J774A.1 macrophages.</a> Biochemical and biophysical research communications. 327 (1), 356-360 (2005).</li><li>Uchida, S., Kataoka, K., Itaka, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Screening+of+mRNA+Chemical+Modification+to+Maximize+Protein+Expression+with+Reduced+Immunogenicity.">Screening of mRNA Chemical Modification to Maximize Protein Expression with Reduced Immunogenicity.</a> Pharmaceutics. 7 (3), 137-151 (2015).</li><li>Kariko, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incorporation+of+pseudouridine+into+mRNA+yields+superior+nonimmunogenic+vector+with+increased+translational+capacity+and+biological+stability.">Incorporation of pseudouridine into mRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability.</a> Molecular Therapy. 16 (11), 1833-1840 (2008).</li><li>Khantakova, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfection+of+bone+marrow+derived+cells+with+immunoregulatory+proteins.">Transfection of bone marrow derived cells with immunoregulatory proteins.</a> Cytokine. 108, 82-88 (2018).</li><li>Franz, K. M., Kagan, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+Immune+Receptors+as+Competitive+Determinants+of+Cell+Fate.">Innate Immune Receptors as Competitive Determinants of Cell Fate.</a> Molecular Cell. 66 (6), 750-760 (2017).</li><li>Kaestner, L., Scholz, A., Lipp, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conceptual+and+technical+aspects+of+transfection+and+gene+delivery.">Conceptual and technical aspects of transfection and gene delivery.</a> Bioorganic &amp; medicinal chemistry letters. 25 (6), 1171-1176 (2015).</li><li>Kim, T. K., Eberwine, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+cell+transfection:+the+present+and+the+future.">Mammalian cell transfection: the present and the future.</a> Analytical and Bioanalytical Chemistry. 397 (8), 3173-3178 (2010).</li><li>Kormann, M. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+therapeutic+proteins+after+delivery+of+chemically+modified+mRNA+in+mice.">Expression of therapeutic proteins after delivery of chemically modified mRNA in mice.</a> Nature Biotechnology. 29 (2), 154-157 (2011).</li><li>Kariko, K., Buckstein, M., Ni, H., Weissman, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+RNA+recognition+by+Toll-like+receptors:+the+impact+of+nucleoside+modification+and+the+evolutionary+origin+of+RNA.">Suppression of RNA recognition by Toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA.</a> Immunity. 23 (2), 165-175 (2005).</li><li>Hornung, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=5'-Triphosphate+RNA+is+the+ligand+for+RIG-I.">5'-Triphosphate RNA is the ligand for RIG-I.</a> Science. 314 (5801), 994-997 (2006).</li><li>Pichlmair, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIG-I-mediated+antiviral+responses+to+single-stranded+RNA+bearing+5'-phosphates.">RIG-I-mediated antiviral responses to single-stranded RNA bearing 5'-phosphates.</a> Science. 314 (5801), 997-1001 (2006).</li><li>Herb, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+reactive+oxygen+species+enable+proinflammatory+signaling+through+disulfide+linkage+of+NEMO.">Mitochondrial reactive oxygen species enable proinflammatory signaling through disulfide linkage of NEMO.</a> Science Signaling. 12 (568), (2019).</li><li>Schmidt-Supprian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NEMO/IKK+gamma-deficient+mice+model+incontinentia+pigmenti.">NEMO/IKK gamma-deficient mice model incontinentia pigmenti.</a> Molecular Cell. 5 (6), 981-992 (2000).</li><li>Mandal, P. K., Rossi, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+human+fibroblasts+to+pluripotency+using+modified+mRNA.">Reprogramming human fibroblasts to pluripotency using modified mRNA.</a> Nature Protocols. 8 (3), 568-582 (2013).</li><li>Oh, S., Kessler, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design,+Assembly,+Production,+and+Transfection+of+Synthetic+Modified+mRNA.">Design, Assembly, Production, and Transfection of Synthetic Modified mRNA.</a> Methods. 133, 29-43 (2018).</li></ol>

The authors have nothing to disclose.

Here we present a protocol for highly efficient transfection of usually hard-to-transfect primary macrophages with in vitro transcribed mRNA. Importantly, transfection of the macrophages using this protocol does not induce cell death or activate proinflammatory signaling indicating that neither the transfection reagent nor the transfected mRNA are recognized as non-self.
The quality of the mRNA is of key importance for successful transfection of macrophages using this protocol. Thus, great car...

Macrophages are phagocytic cells that specialize in detecting, ingesting and degrading microbes, apoptotic cells and cellular debris. Moreover, they help to orchestrate immune responses by secreting cytokines and chemokines and by presenting antigens to T cells and B cells. Macrophages also play important roles in numerous other processes, such as wound healing, atherosclerosis, tumorigenesis and obesity.
To be able to detect non-self molecules such as pathogen-associated molecular patterns (PAMPs) and out-of-place molecules such as damage-associated molecular patterns (DAMPs), macrophages are equipped with a large array of pattern recognition receptors (PRR)1. Unfortunately, this also makes macrophages particularly challenging to transfect2 as the transfection reagent3 and the transfected nucleic acids4,5,6,7 often are recognized by the PRRs as non-self. For this reason, transfection of macrophages using chemical or physical methods8 usually results in macrophage activation and degradation of the transfected nucleic acids or even in macrophage suicide via pyroptosis, a form of programmed lytic cell death triggered after recognition of cytosolic PAMPs/DAMPs such as DNA or foreign RNA9. Biological transfection of macrophages using viruses such as adenoviruses or lentiviruses as vectors is often more efficient, yet construction of such viral vectors is time-consuming and requires biosafety level 2 equipment10,11.
Thus, although macrophages are the subject of intensive research, analysis of their functions on the molecular level is hampered because one of the most important tools of molecular biology, the transfection of nucleic acid constructs for exogenous expression of proteins, is hardly applicable. This often forces researchers to use macrophage-like cell lines rather than bona fide macrophages. Applications for nucleic acid construct transfection include expression of mutated or tagged protein versions, overexpression of a specific protein, protein re-expression in a respective knockout background and expression of proteins from other species (e.g., Cre recombinase or guide RNA and Cas9 for targeted gene knockout).
Here, we describe a protocol that allows highly efficient transfection of (usually hard to transfect) primary macrophages, that is murine peritoneal macrophages (PM) and bone marrow-derived macrophages (BMDM) with mRNA generated from DNA templates such as plasmids. Importantly, the in vitro transcribed mRNA generated using this protocol contains the naturally occurring modified nucleosides 5-methyl-CTP and pseudo-UTP that reduce immunogenicity and enhance stability4,6,7,12,13. Moreover, the 5&#39;-ends of the in vitro transcribed mRNA are dephosphorylated by Antarctic phosphatase to prevent recognition by the RIG-I complex14,15. This minimizes innate immune recognition of the in vitro transcribed mRNA. With our easy to perform protocol, transfection rates between 50-65% (peritoneal macrophages (PM)) and 85% (BMDM) are reached while, importantly, there is no cytotoxicity or immunogenicity observed. We describe in detail (i) how the immunologically silenced mRNA for transfection can be generated from DNA constructs such as plasmids and (ii) the transfection procedure itself.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5-methyl-CTP (100 mM)</td>
			<td>Jena Biosience</td>
			<td>NU-1138S</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Antarctic phosphatase</td>
			<td>New England BioLabs</td>
			<td>M0289</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Antarctic phosphatase reaction buffer (10X)</td>
			<td>New England BioLabs</td>
			<td>B0289</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>anti-NEMO/IKK&#947; antibody</td>
			<td>Invitrogen</td>
			<td>MA1-41046</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>anti-&#946;-actin antibody</td>
			<td>Sigma-Aldrich</td>
			<td>A2228</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Petri dishes 92,16 mm with cams</td>
			<td>Sarstedt</td>
			<td>821,473</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>CD11b Microbeads mouse and human</td>
			<td>Miltenyi Biotec</td>
			<td>130-049-601</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Cre recombinase + T7-Promotor forward primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-GAAATTAATACGACTCACTATA GGGGCAGCCGCCACCATGTCC AATTTACTGACCGTAC-3&#180;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Cre recombinase + T7-Promotor reverse primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-CTAATCGCCATCTTCCAGCAGG C-3&#8242;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>DNA purification kit: QIAquick PCR purification Kit</td>
			<td>Qiagen</td>
			<td>28104</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>eGFP + T7-Promotor forward primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#180;-GAAATTAATACGACTCACTATA GGGATCCATCGCCACCATGGTG AGCAAGG-3&#180;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>eGFP + T7-Promotor reverse primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#180;-TGGTATGGCTGATTA TGATCTAGAGTCG-3&#180;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Fast Digest buffer (10X)</td>
			<td>Thermo Scientific</td>
			<td>B64</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>FastDigest XbaI</td>
			<td>Thermo Scientific</td>
			<td>FD0684</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>high-fidelity polymerase with proofreading: Q5 High-Fidelity DNA-Polymerase</td>
			<td>New England Biolabs Inc</td>
			<td>M0491S</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>IKK&#946; + T7-Promotor forward primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-GAAATTAATACGACTCACTATA GGGTTGATCTACCATGGACTACA AAGACG-3&#8242;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>IKK&#946; + T7-Promotor reverse primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-GAGGAAGCGAGAGCT-CCATCTG-3&#8242;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>in vitro mRNA transcription kit: HiScribe T7 ARCA mRNA kit (with polyA tailing)</td>
			<td>New England BioLabs</td>
			<td>E2060</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>LS Columns</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-401</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>MACS MultiStand</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-303</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>mRNA transfection buffer and reagent: jetMESSENGER</td>
			<td>Polyplus transfection</td>
			<td>409-0001DE</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Mutant IKK&#946; IKK-2S177/181E plasmid</td>
			<td>Addgene</td>
			<td>11105</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Mutant NEMOC54/347A plasmid</td>
			<td>Addgene</td>
			<td>27268</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>pEGFP-N3 plasmid</td>
			<td>Addgene</td>
			<td>62043</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>poly(I:C)</td>
			<td>Calbiochem</td>
			<td>528906</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>pPGK-Cre plasmid</td>
			<td></td>
			<td></td>
			<td>F. T. Wunderlich, H. Wildner, K. Rajewsky, F. Edenhofer, New variants of inducible Cre
recombinase: A novel mutant of Cre-PR fusion protein exhibits enhanced sensitivity and
an expanded range of inducibility. Nucleic Acids Res. 29, 47e (2001). stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>pseudo-UTP (100 mM)</td>
			<td>Jena Biosience</td>
			<td>NU-1139S</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>QuadroMACS Separator</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-976</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>Rat-anti-mouse CD11b antibody, APC-conjugated</td>
			<td>BioLegend</td>
			<td>101212</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Rat-anti-mouse F4/80 antibody, PE-conjugated</td>
			<td>eBioscience</td>
			<td>12-4801-82</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>recombinant M-CSF</td>
			<td>Peprotech</td>
			<td>315-02</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>RNA purification kit: MEGAclear transcription clean-up kit</td>
			<td>ThermoFisher Scientific</td>
			<td>AM1908</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>RNAse-degrading surfactant: RnaseZAP</td>
			<td>Sigma-Aldrich</td>
			<td>R2020</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>ultrapure LPS from E.coli O111:B4</td>
			<td>Invivogen</td>
			<td></td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Wild type IKK&#946; plasmid</td>
			<td>Addgene</td>
			<td>11103</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Wild type NEMO plasmid</td>
			<td>Addgene</td>
			<td>27268</td>
			<td>stored at -20 &#176;C</td>
		</tr>
	</tbody>
</table>

highly efficient transfection of primary macrophages with in vitro transcribed mrna

Macrophages are phagocytic cells specialized in detecting molecules of non-self origin. To this end, they are equipped with a large array of pattern recognition receptors (PRRs). Unfortunately, this also makes macrophages particularly challenging to transfect as the transfection reagent and the transfected nucleic acids are often recognized by the PRRs as non-self. Therefore, transfection often results in macrophage activation and degradation of the transfected nucleic acids or even in suicide of the macrophages. Here, we describe a protocol that allows highly efficient transfection of murine primary macrophages such as peritoneal macrophages (PM) and bone marrow-derived macrophages (BMDM) with mRNA in vitro transcribed from DNA templates such as plasmids. With this simple protocol, transfection rates of about 50-65% for PM and about 85% for BMDM are achieved without cytotoxicity or immunogenicity observed. We describe in detail the generation of mRNA for transfection from DNA constructs such as plasmids and the transfection procedure.

We have successfully used this protocol to generate mRNA encoding for FLAG-tagged NEMO and IKK&#946; variants for transfection of primary macrophages16. The plasmids encoding for FLAG-tagged wild-type (NEMOWT) and C54/347A mutant NEMO (NEMOC54/374A) (see the Table of Materials) already contain a T7 promotor in the correct orientation (Figure 1A). Thus, we only had to linearize the...

Watch this Scientific Journal Video about Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA at JoVE.com

Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA

Macrophages, especially primary macrophages, are challenging to transfect as they specialize in detecting molecules of non-self origin. We describe a protocol that allows highly efficient transfection of primary macrophages with mRNA generated from DNA templates such as plasmids.

Macrophages are phagocytic cells specialized in detecting molecules of non-self origin. To this end, they are equipped with a large array of pattern ...

highly-efficient-transfection-primary-macrophages-with-vitro

Research

JoVE Journal

Immunology and Infection

21.9K Views.  University of Cologne. Macrophages, especially primary macrophages, are challenging to transfect as they specialize in detecting molecules of non-self origin. We describe a protocol that allows highly efficient transfection of primary macrophages with mRNA generated from DNA templates such as plasmids.

Video: Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA

A Simple and Efficient Method to Isolate Macrophages from Mixed Primary Cultures of Adult Liver Cells

Kupffer cells are liver-specific resident macrophages and play an important role in the physiological and pathological functions of the liver1-3. Although the isolation methods of liver macrophages have been well-described4-6, most of these methods require sophisticated equipment, such as a centrifugal elutriator and technical skills. Here, we provide a novel method to obtain liver macrophages in sufficient number and purity from mixed primary cultures of adult rat liver cells, as schematically illustrated in Figure 1.
After dissociation of the liver cells by two-step perfusion method7,8,a fraction mostly composed of parenchymal hepatocytes is prepared and seeded into T75 tissue culture flasks with culture medium composed of DMEM and 10% FCS.Parenchymal hepatocytes lose the epithelial cell morphology within a few days in culture, degenerate or transform into fibroblast-like cells (Figure 2). As the culture proceeds, around day 6, phase contrast-bright, round macrophage-like cells start to proliferate on the fibroblastic cell sheet (Figure 2). The growth of the macrophage-like cells continue and reach to maximum levels around day 12, covering the cell sheet on the flask surface. By shaking of the culture flasks, macrophages are readily suspended into the culture medium. Subsequent transfer and short incubation in plastic dishes result in selective adhesion of macrophages(Figure 3), where as other contaminating cells remain suspended. After several rinses with PBS, attached macrophages are harvested. More than 106 cells can be harvested repeatedly from the same T75 tissue culture flask at two to three day intervals for more than two weeks(Figure 3).The purities of the isolated macrophages were 95 to 99%, as evaluated by flow cytometry or immunocytochemistry with rat macrophage-specific antibodies (Figure 4).The isolated cells show active phagocytosis of polystylene beads (Figure 5), proliferative response to recombinant GM-CSF, secretion of inflammatory/anti-inflammatory cytokines upon stimulation with LPS, and formation of multinucleated giant cells9.
In conclusion, we provide a simple and efficient method to obtain liver macrophages in sufficient number and purity without complex equipment and skills.This method might be applicable to other mammalian species.

A novel method to obtain macrophages from primary culture of rat liver cells is described. This method utilizes the proliferation of macrophages in the culture, followed by shaking of culture flasks and purification by selective attachment to plastic dishes. This technique efficiently provides liver macrophages without complex equipment and skills.

Kupffer cells are liver-specific resident macrophages and play an important role in the physiological and pathological functions of the liver1-3. Although ...

Optimized Protocol for Efficient Transfection of Dendritic Cells without Cell Maturation

Dendritic cells (DCs) can be considered sentinels of the immune system which play a critical role in its initiation and response to infection1. Detection of pathogenic antigen by na&iuml;ve DCs is through pattern recognition receptors (PRRs) which are able to recognize specific conserved structures referred to as pathogen-associated molecular patterns (PAMPS). Detection of PAMPs by DCs triggers an intracellular signaling cascade resulting in their activation and transformation to mature DCs. This process is typically characterized by production of type 1 interferon along with other proinflammatory cytokines, upregulation of cell surface markers such as MHCII and CD86 and migration of the mature DC to draining lymph nodes, where interaction with T cells initiates the adaptive immune response2,3. Thus, DCs link the innate and adaptive immune systems. 
The ability to dissect the molecular networks underlying DC response to various pathogens is crucial to a better understanding of the regulation of these signaling pathways and their induced genes. It should also help facilitate the development of DC-based vaccines against infectious diseases and tumors. However, this line of research has been severely impeded by the difficulty of transfecting primary DCs4.
Virus transduction methods, such as the lentiviral system, are typically used, but carry many limitations such as complexity and bio-hazardous risk (with the associated costs)5,6,7,8. Additionally, the delivery of viral gene products increases the immunogenicity of those transduced DCs9,10,11,12. Electroporation has been used with mixed results13,14,15, but we are the first to report the use of a high-throughput transfection protocol and conclusively demonstrate its utility.
In this report we summarize an optimized commercial protocol for high-throughput transfection of human primary DCs, with limited cell toxicity and an absence of DC maturation16. Transfection efficiency (of GFP plasmid) and cell viability were more than 50% and 70% respectively. FACS analysis established the absence of increase in expression of the maturation markers CD86 and MHCII in transfected cells, while qRT-PCR demonstrated no upregulation of IFN&beta;. Using this electroporation protocol, we provide evidence for successful transfection of DCs with siRNA and effective knock down of targeted gene RIG-I, a key viral recognition receptor16,17, at both the mRNA and protein levels.

We present our optimized high-throughput nucleofection protocol as an efficient way of transfecting primary human monocyte-derived dendritic cells with either plasmid DNA or siRNA without causing cell maturation. We further provide evidence for successful siRNA silencing of targeted gene RIG-I at both the mRNA and protein levels.

Dendritic cells (DCs) can be considered sentinels of the immune system which play a critical role in its initiation and response to infection1. Detection ...

Quantitative In vitro Assay to Measure Neutrophil Adhesion to Activated Primary Human Microvascular Endothelial Cells under Static Conditions

The vascular endothelium plays an integral part in the inflammatory response. During the acute phase of inflammation, endothelial cells (ECs) are activated by host mediators or directly by conserved microbial components or host-derived danger molecules. Activated ECs express cytokines, chemokines and adhesion molecules that mobilize, activate and retain leukocytes at the site of infection or injury. Neutrophils are the first leukocytes to arrive, and adhere to the endothelium through a variety of adhesion molecules present on the surfaces of both cells. The main functions of neutrophils are to directly eliminate microbial threats, promote the recruitment of other leukocytes through the release of additional factors, and initiate wound repair. Therefore, their recruitment and attachment to the endothelium is a critical step in the initiation of the inflammatory response. In this report, we describe an in vitro neutrophil adhesion assay using calcein AM-labeled primary human neutrophils to quantitate the extent of microvascular endothelial cell activation under static conditions. This method has the additional advantage that the same samples quantitated by fluorescence spectrophotometry can also be visualized directly using fluorescence microscopy for a more qualitative assessment of neutrophil binding.

Quantitative In vitro Assay to Measure Neutrophil Adhesion to Activated Primary Human Microvascular Endothelial Cells under Static Conditions

Neutrophil adherence to the activated endothelium at sites of infection is an integral component of the host's inflammatory response. Described in this report is a neutrophil binding assay that allows for the in vitro quantitation of primary human neutrophil binding to endothelial cells activated by inflammatory mediators under static conditions.

The vascular  endothelium plays an integral part in the inflammatory response. During the  acute phase of inflammation, endothelial cells (ECs) are ...

Highly Efficient Transfection of Human THP-1 Macrophages by Nucleofection

Macrophages, as key players of the innate immune response, are at the focus of research dealing with tissue homeostasis or various pathologies. Transfection with siRNA and plasmid DNA is an efficient tool for studying their function, but transfection of macrophages is not a trivial matter. Although many different approaches for transfection of eukaryotic cells are available, only few allow reliable and efficient transfection of macrophages, but reduced cell vitality and severely altered cell behavior like diminished capability for differentiation or polarization are frequently observed. Therefore a transfection protocol is required that is capable of transferring siRNA and plasmid DNA into macrophages without causing serious side-effects thus allowing the investigation of the effect of the siRNA or plasmid in the context of normal cell behavior. The protocol presented here provides a method for reliably and efficiently transfecting human THP-1 macrophages and monocytes with high cell vitality, high transfection efficiency, and minimal effects on cell behavior. This approach is based on Nucleofection and the protocol has been optimized to maintain maximum capability for cell activation after transfection. The protocol is adequate for adherent cells after detachment as well as cells in suspension, and can be used for small to medium sample numbers. Thus, the method presented is useful for investigating gene regulatory effects during macrophage differentiation and polarization. Apart from presenting results characterizing macrophages transfected according to this protocol in comparison to an alternative chemical method, the impact of cell culture medium selection after transfection on cell behavior is also discussed. The presented data indicate the importance of validating the selection for different experimental settings.

This protocol presents an efficient and reliable method to transfect human THP-1 macrophages with siRNA or plasmid DNA by electroporation with high transfection efficiency while maintaining high cell vitality and full macrophage capacity for differentiation and polarization.

Macrophages, as key players of the innate immune response, are at the focus of research dealing with tissue homeostasis or various pathologies. ...

Quantification of Cytosolic vs. Vacuolar Salmonella in Primary Macrophages by Differential Permeabilization

Intracellular bacterial pathogens can replicate in the cytosol or in specialized pathogen-containing vacuoles (PCVs). To reach the cytosol, bacteria like Shigella flexneri and Francisella novicida need to induce the rupture of the phagosome. In contrast, Salmonella typhimurium replicates in a vacuolar compartment, known as Salmonella-containing vacuole (SCV). However certain mutants of Salmonella fail to maintain SCV integrity and are thus released into the cytosol. The percentage of cytosolic vs. vacuolar bacteria on the level of single bacteria can be measured by differential permeabilization, also known as phagosome-protection assay. The approach makes use of the property of detergent digitonin to selectively bind cholesterol. Since the plasma membrane contains more cholesterol than other cellular membranes, digitonin can be used to selectively permeabilize the plasma membrane while leaving intracellular membranes intact. In brief, following infection with the pathogen expressing a fluorescent marker protein (e.g. mCherry among others), the plasma membrane of host cells is permeabilized with a short incubation in digitonin containing buffer. Cells are then washed and incubated with a primary antibody (coupled to a fluorophore of choice) directed against the bacterium of choice (e.g. anti-Salmonella-FITC) and washed again. If unmarked bacteria are used, an additional step can be done, in which all membranes are permeabilized and all bacteria stained with a corresponding antibody. Following the staining, the percentage of vacuolar and cytosolic bacteria can be quantified by FACS or microscopy by counting single or double-positive events. Here we provide experimental details for use of this technique with the bacterium Salmonella typhimurium. The advantage of this assay is that, in contrast to other assay, it provides a quantification on the level of single bacteria, and if analyzed by microscopy provides the exact number of cytosolic and vacuolar bacteria in a given cell.

Quantification of Cytosolic vs. Vacuolar Salmonella in Primary Macrophages by Differential Permeabilization

We describe the quantification of cytosolic and vacuolar Salmonella typhimurium in bone-marrow derived macrophages using differential digitonin permeabilization.

Intracellular bacterial pathogens can replicate in the cytosol or in specialized pathogen-containing vacuoles (PCVs). To reach the cytosol, bacteria like ...

Phagosome Migration and Velocity Measured in Live Primary Human Macrophages Infected with HIV-1

Macrophages are phagocytic cells that play a major role at the crossroads between innate and specific immunity. They can be infected by the human immunodeficiency virus (HIV)-1 and because of their resistance to its cytopathic effects they can be considered to be persistent viral reservoirs. In addition, HIV-infected macrophages exhibit defective functions that contribute to the development of opportunistic diseases.
The exact mechanism by which HIV-1 impairs the phagocytic response of macrophages was unknown. We had previously shown that the uptake of various particulate material by macrophages was inhibited when they were infected with HIV-1. This inhibition was only partial and phagosomes did form within HIV-infected macrophages. Therefore, we focused on analyzing the fate of these phagosomes. Phagosome maturation is accompanied by migration of these compartments towards the cell center, where they fuse with lysosomes, generating phagolysosomes, responsible for degradation of the ingested material. We used IgG-opsonized Sheep Red Blood Cells as a target for phagocytosis. To measure the speed of centripetal movement of phagosomes in individual HIV-infected macrophages, we used a combination of bright field and fluorescence confocal microscopy. We established a method to calculate the distance of phagosomes towards the nucleus, and then to calculate the velocity of the phagosomes. HIV-infected cells were identified thanks to a GFP-expressing virus, but the method is applicable to non-infected cells or any type of infection or treatment.

We describe a method to measure the velocity of phagosomes moving towards the cell center in living cells infected with or without the human immunodeficiency virus (HIV) type 1, using spinning disk confocal fluorescence microscopy to identify fluorescent infected cells and bright field microscopy to detect phagosomes.

Macrophages are phagocytic cells that play a major role at the crossroads between innate and specific immunity. They can be infected by the human ...

Analysis of Lymphocyte Extravasation Using an In Vitro Model of the Human Blood-brain Barrier

Lymphocyte extravasation into the central nervous system (CNS) is critical for immune surveillance. Disease-related alterations of lymphocyte extravasation might result in pathophysiological changes in the CNS. Thus, investigation of lymphocyte migration into the CNS is important to understand inflammatory CNS diseases and to develop new therapy approaches. Here we present an in vitro model of the human blood-brain barrier to study lymphocyte extravasation. Human brain microvascular endothelial cells (HBMEC) are confluently grown on a porous polyethylene terephthalate transwell insert to mimic the endothelium of the blood-brain barrier. Barrier function is validated by zonula occludens immunohistochemistry, transendothelial electrical resistance (TEER) measurements as well as analysis of evans blue permeation. This model allows investigation of the diapedesis of rare lymphocyte subsets such as CD56brightCD16dim/- NK cells. Furthermore, the effects of other cells, cytokines and chemokines, disease-related alterations, and distinct treatment regimens on the migratory capacity of lymphocytes can be studied. Finally, the impact of inflammatory stimuli as well as different treatment regimens on the endothelial barrier can be analyzed.

Analysis of Lymphocyte Extravasation Using an In Vitro Model of the Human Blood-brain Barrier

Here, we describe a human blood-brain barrier model enabling to investigate lymphocyte transmigration into the central nervous system in vitro.

Lymphocyte extravasation into the central nervous system (CNS) is critical for immune surveillance. Disease-related alterations of lymphocyte ...

Small RNA Transfection in Primary Human Th17 Cells by Next Generation Electroporation

CD4+ T cells can differentiate into several subsets of effector T helper cells depending on the surrounding cytokine milieu. Th17 cells can be generated from na&#239;ve CD4+ T cells in vitro by activating them in the presence of the polarizing cytokines IL-1&#946;, IL-6, IL-23, and TGF&#946;. Th17 cells orchestrate immunity against extracellular bacteria and fungi, but their aberrant activity has also been associated with several autoimmune and inflammatory diseases. Th17 cells are identified by the chemokine receptor CCR6 and defined by their master transcription factor, ROR&#947;t, and characteristic effector cytokine, IL-17A. Optimized culture conditions for Th17 cell differentiation facilitate mechanistic studies of human T cell biology in a controlled environment. They also provide a setting for studying the importance of specific genes and gene expression programs through RNA interference or the introduction of microRNA (miRNA) mimics or inhibitors. This protocol provides an easy to use, reproducible, and highly efficient method for transient transfection of differentiating primary human Th17 cells with small RNAs using a next generation electroporation device.

Next generation electroporation is an efficient method for transfecting human Th17 cells with small RNAs to alter gene expression and cell behavior.

CD4+ T cells can differentiate into several subsets of effector T helper cells depending on the surrounding cytokine milieu. Th17 cells can be generated ...

Isolation of Salmonella typhimurium-containing Phagosomes from Macrophages

Salmonella typhimurium is a facultative intracellular bacterium that causes gastroenteritis in humans. After invasion of the lamina propria, S. typhimurium bacteria are quickly detected and phagocytized by macrophages, and contained in vesicles known as phagosomes in order to be degraded. Isolation of S. typhimurium-containing phagosomes have been widely used to study how S. typhimurium infection alters the process of phagosome maturation to prevent bacterial degradation. Classically, the isolation of bacteria-containing phagosomes has been performed by sucrose gradient centrifugation. However, this process is time-consuming, and requires specialized equipment and a certain degree of dexterity. Described here is a simple and quick method for the isolation of S. typhimurium-containing phagosomes from macrophages by coating the bacteria with biotin-streptavidin-conjugated magnetic beads. Phagosomes obtained by this method can be suspended in any buffer of choice, allowing the utilization of isolated phagosomes for a broad range of assays, such as protein, metabolite, and lipid analysis. In summary, this method for the isolation of S. typhimurium-containing phagosomes is specific, efficient, rapid, requires minimum equipment, and is more versatile than the classical method of isolation by sucrose gradient-ultracentrifugation.

Isolation of Salmonella typhimurium-containing Phagosomes from Macrophages

We describe here a simple and quick method for the isolation of Salmonella typhimurium-containing phagosomes from macrophages by coating the bacteria with biotin and streptavidin.

Salmonella typhimurium is a facultative intracellular bacterium that causes gastroenteritis in humans. After invasion of the lamina propria, S. ...

Isolation and In Vitro Culture of Murine and Human Alveolar Macrophages

Alveolar macrophages are terminally differentiated, lung-resident macrophages of prenatal origin. Alveolar macrophages are unique in their long life and their important role in lung development and function, as well as their lung-localized responses to infection and inflammation. To date, no unified method for identification, isolation, and handling of alveolar macrophages from humans and mice exists. Such a method is needed for studies on these important innate immune cells in various experimental settings. The method described here, which can be easily adopted by any laboratory, is a simplified approach to harvesting alveolar macrophages from bronchoalveolar lavage fluid or from lung tissue and maintaining them in vitro. Because alveolar macrophages primarily occur as adherent cells in the alveoli, the focus of this method is on dislodging them prior to harvest and identification. The lung is a highly vascularized organ, and various cell types of myeloid and lymphoid origin inhabit, interact, and are influenced by the lung microenvironment. By using the set of surface markers described here, researchers can easily and unambiguously distinguish alveolar macrophages from other leukocytes, and purify them for downstream applications. The culture method developed herein supports both human and mouse alveolar macrophages for in vitro growth, and is compatible with cellular and molecular studies.

Isolation and In Vitro Culture of Murine and Human Alveolar Macrophages

This communication describes methodologies for isolation and culture of alveolar macrophages from humans and murine models for experimental purposes.

Alveolar macrophages are terminally differentiated, lung-resident macrophages of prenatal origin. Alveolar macrophages are unique in their long life and ...