This work was supported by the National Natural Science Foundation of China (Grant No. 81902094, 81600497), and the Science and Technology Plan Project of Hunan Province (2019RS1036).

1. Midgut dissection and cultivable bacteria isolation
<ol>
	<li>Prepare the mosquito for dissection.
	<ol>
		<li>Collect the mosquitoes 7&#8211;9 days after emergence with an aspirator. Anesthetize the collected mosquitoes by subjecting them to a temperature of 4 &#176;C for 3&#8211;5 min and keep the mosquitoes anesthetized in an ice-cold Petri dish until dissection.</li>
	</ol>
	</li>
	<li>Sterilize laboratory instruments and the mosquito surface.
	<ol>
		<li>Sterilize the experiment bench, dissecting microscope, forceps, and glass slide by spraying 75% ethanol to avoid contamination by bacteria from the environment.</li>
		<li>Prepare a sterile Petri dish containing 75% ethanol and two Petri dishes containing sterile 1x phosphate buffered saline (1x PBS).</li>
		<li>Surface-sterilize the mosquito by dipping and shaking them in 75% ethanol for 3 min, and rinse twice with 1x PBS buffer in case the ethanol affects the dissected gut flora.</li>
	</ol>
	</li>
	<li>Dissect the mosquito midgut.
	<ol>
		<li>Transfer the surface-sterilized mosquito onto the glass slide with a drop of sterile 1x PBS buffer. Dissect under the dissecting microscope.</li>
		<li>Under the lower magnification of the dissecting microscope, carefully remove the legs, wings, and head of the mosquito to prevent escape. Remove the last somite of the mosquito by cutting directly, rather than pulling it, to prevent the digestive tract from breaking.</li>
		<li>Clamp the mosquito&#39;s thorax and the end of the abdomen with forceps. Gently pull out the mosquito&#39;s digestive tract. The acquired digestive tract usually contains the crop, foregut, midgut, hindgut, and the Malpighian tubes.</li>
		<li>Adjust the dissecting microscope to a higher magnification. Remove the crop, foregut, hindgut, and the Malpighian tubes from the dissected digestive tract to get the midgut of the mosquito.</li>
		<li>Take care while removing the crop, as the crop inflates and resembles the midgut after the mosquito takes a sugar meal. The Malpighian tubes, a group of long and thin excretory tubes, are located at the boundary between the midgut and the hindgut.</li>
	</ol>
	</li>
	<li>Isolate gut bacteria.
	<ol>
		<li>Transfer the dissected midgut to a sterile 1.5 mL tube with 200 &#181;L of sterile 1x PBS buffer.</li>
		<li>Grind the midgut on a sterile bench thoroughly with a sterile pestle to allow complete releasing of gut bacteria to the buffer.</li>
		<li>Serial dilute the homogenate to three 10-fold dilutions. Add 50 &#181;L of each dilution to the LB (Luria broth) agar plate, and then spread it on the plate. If the midgut contains a high concentration of gut flora, it is essential to make more serial dilutions to pick out single colonies.</li>
		<li>Incubate the plate at 37 &#176;C for 1&#8211;2 days until single colonies are visible.</li>
	</ol>
	</li>
	<li>Species identification
	<ol>
		<li>Pick single colonies and inoculate them respectively into a 150 mL conical flask containing 50 mL of LB broth medium.</li>
		<li>Shake the bacteria at 37 &#176;C overnight.</li>
		<li>Extract total DNA by bacterial genomic DNA extraction kit. Amplify 16S rDNA by polymerase chain reaction (PCR). 
		NOTE: There are multiple segments in 16S rDNA that are conserved. Based on these conserved regions, universal primers for bacteria can be designed to amplify 16S rDNA fragments of all bacteria. These primers are specific to bacteria, and the difference in the variable region of 16S rDNA can be used to distinguish different bacteria. Therefore, 16S rDNA is widely used for bacterial identification.</li>
		<li>Recover and purify DNA fragments from PCR products by agarose gel electrophoresis and a commercial gel recovery kit.</li>
		<li>Perform DNA sequencing on the purified DNA fragments to obtain bacterial gene sequences.</li>
		<li>Compare the 16S rRNA gene sequence with the bacterial sequence available in GenBank. Select the Bacteria and Archaea database. 
		NOTE: Identification to the species level was defined as &#8805;99% 16S rDNA sequence similarity to the closest GenBank entry. The isolate was assigned to the corresponding genus when its 16S rDNA sequence similarity was &#60;99% and &#8805;95%.</li>
	</ol>
	</li>
</ol>
2. Antibiotic treatment and bacterium reintroduction
<ol>
	<li>Prepare the antibiotic solution.
	<ol>
		<li>Weigh the required amount of sucrose, penicillin, and streptomycin to prepare a 10% sucrose solution including 20 units of penicillin and 20 &#181;g of streptomycin per mL.</li>
	</ol>
	</li>
	<li>Feed mosquitoes with the antibiotic solution.
	<ol>
		<li>Anesthetize the mosquitoes in 4 &#176;C for 3&#8211;5 min. Transfer the mosquitoes to a paper cup. Cover the top with gauze and enwind the gauze with tape to prevent mosquitoes from escaping.</li>
		<li>Dip sterile cotton balls into the antibiotic solution and place them carefully on the mosquito cup. Squeeze the cotton balls before use to prevent mosquitoes from drowning in the dripping cotton balls.</li>
		<li>Cover the cotton balls with a 10 cm Petri dish to prevent moisture evaporation. Replace the cotton balls twice a day for three consecutive days.</li>
	</ol>
	</li>
	<li>Confirm the effectiveness of the antibiotic treatment.
	<ol>
		<li>According to the above method, dissect the midgut of antibiotic-treated mosquitoes.</li>
		<li>Transfer the dissected midguts to a sterile 1.5 mL tube with 200 &#181;L of sterile 1x PBS buffer.</li>
		<li>Grind midguts in a sterile bench thoroughly with a sterile pestle to allow complete release of gut bacteria to the buffer.</li>
		<li>Extract the gut microbial DNA by bacterial genomic DNA extraction kit.</li>
		<li>Perform bacterial quantitation by real-time quantitative PCR (qPCR) on genomic DNA using universal eubacteria primers (16S rRNA F: TCCTACGGGAGGCAGCAGT and R: GGACTACCAGGGTATCTAATCCTGTT).</li>
	</ol>
	</li>
	<li>Preparation of bacterial suspension
	<ol>
		<li>Measure the bacterial solution with a spectrophotometer. Add 1 OD (OD600) bacterial suspension into a 1 mL tube. Centrifuge the suspension at 5,000 x g for 5 min at 4 &#176;C.</li>
		<li>Discard the supernatant and add 1 mL of sterile 1x PBS buffer to 1.5 mL tube for&#160;suspension precipitation.</li>
		<li>Centrifuge at 5,000 x g for 5 min at 4 &#176;C; discard the supernatant.</li>
		<li>Repeat steps 2.4.2 and 2.4.3.</li>
		<li>Add 200 &#181;L of sterile 1x PBS buffer to the bacterial precipitation.</li>
		<li>Add 600 &#181;L of 10% sucrose solution, 200 &#181;L of 10 mm ATP (which acts as a phagostimulant), and 200 &#181;L of bacterial suspension into a sterile 1.5 mL tube. Mix by vortexing. Alternatively, suspend bacterial pelleted in heat-inactivated blood.</li>
		<li>Preparation of heat-inactivated blood
		<ol>
			<li>Collect fresh blood with an anticoagulant tube.</li>
			<li>Take 2&#8211;3 mL of fresh blood. Centrifuge at 1,000 x g for 10 min at 4 &#176;C to separate plasma and blood cells. Note that the blood will be lost during the centrifugation and washing process; there is a need to calculate the usage in advance.</li>
			<li>Collect the plasma into a new 1.5 mL tube and heat-inactivate at 56 &#176;C for 1 h.</li>
			<li>Add 500 &#181;L of sterile 1x PBS buffer to 1.5 mL tube for&#160;suspension of blood cells. Centrifuge at 1,000 x g for 10 min at 4 &#176;C and then discard the supernatant.</li>
			<li>Repeat step 2.4.7.4 twice.</li>
			<li>Resuspend blood cells with heat-inactivated plasma to obtain heat-inactivated blood.</li>
			<li>Follow steps 2.4.1 to 2.4.4 to get 1 OD bacterial pelleted.</li>
			<li>Resuspend the bacteria pelleted with 1 mL of heat-inactivated blood.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Feed the mosquito with bacteria suspension.
	<ol>
		<li>Starve the mosquitoes for 24 h, allowing antibiotics to metabolize before feeding bacteria.</li>
		<li>Assemble the membrane-feeding system.</li>
		<li>Seal the sterilized feeder unit with a parafilm, alternatively a&#160;collagen membrane.</li>
		<li>Put on a plastic ring and fix it with parafilm to avoid breaking due to friction during feeding.</li>
		<li>Slowly add the prepared bacterial solution to the feeder unit. Note that only one well of the two-well feeder unit can be filled with the solution and cover the feeder unit only from the reagent dropping side.</li>
		<li>Connect the feeder unit to a feeding system preheated to 37 &#176;C, which simulates human temperature to attract mosquitoes. Place the feeding device on a paper cup filled with mosquitoes and feed for 90 min.</li>
		<li>After feeding, anesthetize the mosquitoes by subjecting them to a temperature of 4 &#176;C for 3&#8211;5 min and keep the mosquitoes anesthetized in an ice-cold Petri dish.</li>
		<li>Pick the fully engorged mosquitoes for further studies.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Tolle, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosquito-borne+diseases.">Mosquito-borne diseases.</a> Current Problems in Pediatric and Adolescent Health Care. 39 (4), 97-140 (2009).</li><li>Wu, P., Yu, X., Wang, P., Cheng, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arbovirus+lifecycle+in+mosquito:+acquisition,+propagation+and+transmission.">Arbovirus lifecycle in mosquito: acquisition, propagation and transmission.</a> Expert Reviews in Molecular Medicine. 21, 1 (2019).</li><li>Jayakrishnan, L., Sudhikumar, A. V., Aneesh, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+gut+inhabitants+on+vectorial+capacity+of+mosquitoes.">Role of gut inhabitants on vectorial capacity of mosquitoes.</a> Journal of Vector Borne Diseases. 55 (2), 69 (2018).</li><li>Jupatanakul, N., Sim, S., Dimopoulos, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+insect+microbiome+modulates+vector+competence+for+arboviruses.">The insect microbiome modulates vector competence for arboviruses.</a> Viruses. 6 (11), 4294-4313 (2014).</li><li>Moro, C. V., Tran, F. H., Raharimalala, F. N., Ravelonandro, P., Mavingui, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diversity+of+culturable+bacteria+including+Pantoea+in+wild+mosquito+Aedes+albopictus.">Diversity of culturable bacteria including Pantoea in wild mosquito Aedes albopictus.</a> BMC Microbiology. 13 (1), 70 (2013).</li><li>Chouaia, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+evidence+for+multiple+infections+as+revealed+by+typing+of+Asaia+bacterial+symbionts+of+four+mosquito+species.">Molecular evidence for multiple infections as revealed by typing of Asaia bacterial symbionts of four mosquito species.</a> Applied and Environmental Microbiology. 76 (22), 7444-7450 (2010).</li><li>Terenius, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Midgut+bacterial+dynamics+in+Aedes+aegypti.">Midgut bacterial dynamics in Aedes aegypti.</a> FEMS Microbiology Ecology. 80 (3), 556-565 (2012).</li><li>Bando, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intra-specific+diversity+of+Serratia+marcescens+in+Anopheles+mosquito+midgut+defines+Plasmodium+transmission+capacity.">Intra-specific diversity of Serratia marcescens in Anopheles mosquito midgut defines Plasmodium transmission capacity.</a> Scientific Reports. 3, 1641 (2013).</li><li>Telang, A., Skinner, J., Nemitz, R. Z., McClure, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metagenome+and+culture-based+methods+reveal+candidate+bacterial+mutualists+in+the+Southern+house+mosquito+(Diptera:+Culicidae).">Metagenome and culture-based methods reveal candidate bacterial mutualists in the Southern house mosquito (Diptera: Culicidae).</a> Journal of Medical Entomology. 55 (5), 1170-1181 (2018).</li><li>Wang, Y., Gilbreath, T. M., Kukutla, P., Yan, G., Xu, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+gut+microbiome+across+life+history+of+the+malaria+mosquito+Anopheles+gambiae+in+Kenya.">Dynamic gut microbiome across life history of the malaria mosquito Anopheles gambiae in Kenya.</a> PloS One. 6 (9), (2011).</li><li>Xiao, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Mesh-Duox+pathway+regulates+homeostasis+in+the+insect+gut.">A Mesh-Duox pathway regulates homeostasis in the insect gut.</a> Nature Microbiology. 2 (5), 17020 (2017).</li><li>Gu&#233;gan, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Short-term+impacts+of+anthropogenic+stressors+on+Aedes+albopictus+mosquito+vector+microbiota.">Short-term impacts of anthropogenic stressors on Aedes albopictus mosquito vector microbiota.</a> FEMS Microbiology Ecology. 94 (12), 188 (2018).</li><li>Valzania, L., Coon, K. L., Vogel, K. J., Brown, M. R., Strand, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypoxia-induced+transcription+factor+signaling+is+essential+for+larval+growth+of+the+mosquito+Aedes+aegypti.">Hypoxia-induced transcription factor signaling is essential for larval growth of the mosquito Aedes aegypti.</a> Proceedings of the National Academy of Sciences of the United States of America. 115 (3), 457-465 (2018).</li><li>Coon, K. L., Vogel, K. J., Brown, M. R., Strand, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosquitoes+rely+on+their+gut+microbiota+for+development.">Mosquitoes rely on their gut microbiota for development.</a> Molecular Ecology. 23 (11), 2727-2739 (2014).</li><li>de O Gaio, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Contribution+of+midgut+bacteria+to+blood+digestion+and+egg+production+in+Aedes+aegypti+(diptera:+culicidae)(L).">Contribution of midgut bacteria to blood digestion and egg production in Aedes aegypti (diptera: culicidae)(L).</a> Parasites &amp; Vectors. 4 (1), 105 (2011).</li><li>Ramirez, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reciprocal+tripartite+interactions+between+the+Aedes+aegypti+midgut+microbiota,+innate+immune+system+and+dengue+virus+influences+vector+competence.">Reciprocal tripartite interactions between the Aedes aegypti midgut microbiota, innate immune system and dengue virus influences vector competence.</a> PLoS Neglected Tropical Diseases. 6 (3), 1561 (2012).</li><li>Dong, Y., Morton, J. C., Ramirez, J. L., Souza-Neto, J. A., Dimopoulos, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+entomopathogenic+fungus+Beauveria+bassiana+activate+toll+and+JAK-STAT+pathway-controlled+effector+genes+and+anti-dengue+activity+in+Aedes+aegypti.">The entomopathogenic fungus Beauveria bassiana activate toll and JAK-STAT pathway-controlled effector genes and anti-dengue activity in Aedes aegypti.</a> Insect Biochemistry and Molecular Biology. 42 (2), 126-132 (2012).</li><li>Anglero-Rodriguez, Y. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Aedes+aegypti-associated+fungus+increases+susceptibility+to+dengue+virus+by+modulating+gut+trypsin+activity.">An Aedes aegypti-associated fungus increases susceptibility to dengue virus by modulating gut trypsin activity.</a> Elife. 6, 28844 (2017).</li><li>Wu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+gut+commensal+bacterium+promotes+mosquito+permissiveness+to+arboviruses.">A gut commensal bacterium promotes mosquito permissiveness to arboviruses.</a> Cell Host &amp; Microbe. 25 (1), 101-112 (2019).</li><li>M&#246;hlmann, T. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+gut+bacteria+on+the+infection+and+transmission+of+pathogenic+arboviruses+by+biting+midges+and+mosquitoes.">Impact of gut bacteria on the infection and transmission of pathogenic arboviruses by biting midges and mosquitoes.</a> Microbial Ecology. , (2020).</li><li>Llorca, M., Gros, M., Rodr&#237;guez-Mozaz, S., Barcel&#243;, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sample+preservation+for+the+analysis+of+antibiotics+in+water.">Sample preservation for the analysis of antibiotics in water.</a> Journal of Chromatography. A. 1369, 43-51 (2014).</li><li>Berendsen, B., Elbers, I., Stolker, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+the+stability+of+antibiotics+in+matrix+and+reference+solutions+using+a+straightforward+procedure+applying+mass+spectrometric+detection.">Determination of the stability of antibiotics in matrix and reference solutions using a straightforward procedure applying mass spectrometric detection.</a> Food Additives &amp; Contaminants: Part A, Chemistry, Analysis, Control, Exposure &amp; Risk Assessment. 28 (12), 1657-1666 (2011).</li><li>Hill, C. L., Sharma, A., Shouche, Y., Severson, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+midgut+microflora+and+dengue+virus+impact+on+life+history+traits+in+Aedes+aegypti.">Dynamics of midgut microflora and dengue virus impact on life history traits in Aedes aegypti.</a> Acta Tropica. 140, 151-157 (2014).</li><li>Eng, M. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multifaceted+functional+implications+of+an+endogenously+expressed+tRNA+fragment+in+the+vector+mosquito+Aedes+aegypti.">Multifaceted functional implications of an endogenously expressed tRNA fragment in the vector mosquito Aedes aegypti.</a> PLoS Neglected Tropical Diseases. 12 (1), 0006186 (2018).</li><li>Kajla, M. K., Barrett-Wilt, G. A., Paskewitz, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacteria:+A+novel+source+for+potent+mosquito+feeding-deterrents.">Bacteria: A novel source for potent mosquito feeding-deterrents.</a> Science Advances. 5 (1), 6141 (2019).</li><li>Gon&#231;alves, G. G. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+MALDI-TOF+MS+to+identify+the+culturable+midgut+microbiota+of+laboratory+and+wild+mosquitoes.">Use of MALDI-TOF MS to identify the culturable midgut microbiota of laboratory and wild mosquitoes.</a> Acta Tropica. 200, 105174 (2019).</li><li>Kuss, S. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+microbiota+promote+enteric+virus+replication+and+systemic+pathogenesis.">Intestinal microbiota promote enteric virus replication and systemic pathogenesis.</a> Science. 334 (6053), 249-252 (2011).</li><li>Rani, A., Sharma, A., Rajagopal, R., Adak, T., Bhatnagar, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+diversity+analysis+of+larvae+and+adult+midgut+microflora+using+culture-dependent+and+culture-independent+methods+in+lab-reared+and+field-collected+Anopheles+stephensi-an+Asian+malarial+vector.">Bacterial diversity analysis of larvae and adult midgut microflora using culture-dependent and culture-independent methods in lab-reared and field-collected Anopheles stephensi-an Asian malarial vector.</a> BMC Microbiology. 9 (1), (2009).</li><li>Apte-Deshpande, A., Paingankar, M., Gokhale, M. D., Deobagkar, D. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serratia+odorifera+a+midgut+inhabitant+of+Aedes+aegypti+mosquito+enhances+its+susceptibility+to+dengue-2+virus.">Serratia odorifera a midgut inhabitant of Aedes aegypti mosquito enhances its susceptibility to dengue-2 virus.</a> PLoS One. 7 (7), 40401 (2012).</li><li>Behura, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosquito+microbiota+and+metagenomics,+and+its+relevance+to+disease+transmission.">Mosquito microbiota and metagenomics, and its relevance to disease transmission.</a> Nature. 436, 257-260 (2013).</li><li>Dickson, L. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diverse+laboratory+colonies+of+Aedes+aegypti+harbor+the+same+adult+midgut+bacterial+microbiome.">Diverse laboratory colonies of Aedes aegypti harbor the same adult midgut bacterial microbiome.</a> Parasites &amp; Vectors. 11 (1), 1-8 (2018).</li></ol>

The authors have no conflicts of interest to disclose.

Research on host-microbe interactions have found that different gut microbes affect their host physiology via divergent mechanisms. This article introduces the method to investigate the respective role of mosquito gut microbe, including dissecting mosquito midgut, culturing cultivable gut bacteria, antibiotic treatment, and reintroducing the bacteria of interest.
For successful antibiotic treatment, the following details must be considered in conducting the experiment. In this protocol, mosqui...

Mosquitoes are considered to be the most important vectors of human pathogenic diseases, transmitting over a hundred pathogens including Zika virus, Dengue virus, and Plasmodium parasites1. When mosquitoes take a blood meal to acquire nutrients for oviposition, they can accidentally ingest pathogens from an infected host via the digestive tract2. Importantly, the mosquito midgut, which plays a pivotal role in both blood meal digestion and pathogen entrance, harbors a highly dynamic microbiome3.
Several studies have characterized lab-reared and field-collected mosquito microbiota using either a culture-dependent method or a bacteria sequencing assay4,5,6. Species including Pantoea, Serratia, Klebsiella, Elizabethkingia, and Enterococcus are commonly isolated from mosquitoes in various studies5,7,8,9. Interestingly, mosquito gut microbiota fluctuates dynamically in both the community diversity and the amount of bacteria species, affected by the development stage, species, geographical origin, and feeding behavior4. Studies show that blood feeding dramatically increases the total bacterial load with rapid expansion of species from Enterobacteriaceae and a reduction in overall diversity10,11. In addition, mosquito gut microbiota of the larval stage is usually eradicated when the insect undergoes metamorphosis during pupation and eclosion; thus, newly emerged adult mosquitoes need to repopulate their microbiota4.
Gut microbiota modulates insect physiology in various aspects, including nutrient absorption, immunity, development, reproduction, and vector competence12. Axenic mosquito larvae fail to develop beyond the first instar while a bacteria oral supply rescues development, indicating that the mosquito gut microbe is essential for larval development13,14. Besides, depletion of gut bacteria retards blood meal digestion and nutrient absorption, affects oocyte maturation, and decreases oviposition15. In addition, mosquitoes with gut microflora elicit higher immune responses compared to antibiotic-treated mosquitoes, with constantly elevated antimicrobial peptide expression against other pathogens to infect16. Antibiotics are usually orally administered to remove pan gut bacteria in these studies, and then experiments are conducted to compare the difference between axenic mosquitoes and mosquitoes with commensal microbes. However, the mosquito midgut harbors a diverse community of microbes, and each bacteria species could exert a distinct effect toward the host physiology.
Mosquito microbiota regulates vector competence with divergent effects. Colonization by Proteus isolated from field-derived mosquitoes of dengue-endemic areas confers upregulated antimicrobial peptide expression and resistance against dengue virus infection16. The entomopathogenic fungus Beauveria bassiana activates the Toll and JAK-STAT immune pathway against arbovirus infection17. By contrast, the fungus Talaromyces isolated from Aedes aegypti midgut facilitates dengue virus infection by modulating gut trypsin activity18. In addition, Serratia marcescens promotes arbovirus transmission through a secretory protein called SmEnhancin, which digests the mucin layer on the intestinal epithelium of mosquitoes19.
This procedure provides a systematic and intuitive method for dissection of the mosquito midgut, isolation of cultivable bacteria colonies, identification of the bacteria species, and reintroduction via oral feeding. It provides representative results of blood feeding with a commensal bacterium, Chryseobacterium meningosepticum, on mosquito ovary development and oviposition.

<table><tbody><tr><td>Adenosine 5&amp;prime;-triphosphate disodium salt hydrate</td><td>Sigma</td><td>A2383</td><td>Adenosine 5&amp;prime;-triphosphate disodium salt hydrate has been used to prepare adenosine triphosphate (ATP) standard solutions</td></tr><tr><td>Aedes aegypti</td><td></td><td></td><td>Female mosquitoes</td></tr><tr><td>Anticoagulant tube</td><td>BD Vacutainer</td><td>363095</td><td>Collect fresh blood</td></tr><tr><td>Centrifuge tube</td><td>Sangon Biotech</td><td>F601620-0010</td><td>1.5 ml, Natural, Graduated, Sterile</td></tr><tr><td>Cotton balls</td><td></td><td></td><td></td></tr><tr><td>Disposable Tissue Grinding Pestle</td><td>Sangon Biotech</td><td>F619072-0001</td><td>70 mm Long, Conical, Blue, Sterile</td></tr><tr><td>Ethanol absolute</td><td>Paini</td><td></td><td>Dilute it to 75% ethanol</td></tr><tr><td>Forceps</td><td>RWD</td><td>F11029</td><td>Dissection</td></tr><tr><td>Hemotek Membrane Feeding System</td><td>Hemotek</td><td></td><td>Components of the feeding system, including&amp;nbsp; Hemotek temperature controller, feeder-housing assembly, metal feeder assembled.</td></tr><tr><td>Incubator shaker</td><td></td><td>ZQZY-78AN</td><td></td></tr><tr><td>Inoculation Loops</td><td>Sangon Biotech</td><td>F619312-0001</td><td>10 &amp;mu;l, Yellow</td></tr><tr><td>LB Agar Powder</td><td>Sangon Biotech</td><td>A507003</td><td>Tryptone 10.0 g, Yeast Extract 5.0 g, NaCl 10.0 g, Agar 15.0 g.</td></tr><tr><td>LB Broth Powder</td><td>Sangon Biotech</td><td>A507002</td><td>Tryptone 10.0 g, Yeast Extract 5.0 g, NaCl 10.0 g.</td></tr><tr><td>Microscope</td><td>Zeiss</td><td>Stemi508</td><td></td></tr><tr><td>Paper cup</td><td></td><td></td><td>Place mosquito</td></tr><tr><td>Parafilm</td><td>Sangon Biotech</td><td>F104002</td><td>4 inx 125 ft</td></tr><tr><td>Petri dish</td><td>Sangon Biotech</td><td>F611203</td><td></td></tr><tr><td>Penicillin G procaine salt hydrate</td><td>Sangon Biotech</td><td>A606248</td><td>White powder. Soluble in water, soluble in methanol, slightly soluble in water, ethanol</td></tr><tr><td>Single Channal Pipettor</td><td>Gilson</td><td></td><td></td></tr><tr><td>Streptomycin sulfate</td><td>Sangon Biotech</td><td>A610494</td><td>Streptomycin sulfate is a glucosamine antibiotic that interferes with the synthesis of prokaryotic proteins.</td></tr><tr><td>Sucrose</td><td>Sangon Biotech</td><td>A502792</td><td>Soluble in water, ethanol and methanol, slightly soluble in glycerol and pyridine.</td></tr><tr><td>TIANamp Bacteria DNA Kit</td><td>TIANGEN</td><td>DP302</td><td>Extract DNA&amp;nbsp;</td></tr><tr><td>Utility Fabric-Mosquito Netting White</td><td></td><td></td><td></td></tr><tr><td>Vortex mixer</td><td>Scintic Industries</td><td>S1-0246</td><td></td></tr><tr><td>1.5ml EP tube</td><td>Sangon Biotech</td><td>F600620</td><td></td></tr><tr><td>10X PBS buffer</td><td>Sangon Biotech</td><td>E607016</td><td>This product is a 10X solution. Please dilute it 10 times before use. The pH value is 7.4.</td></tr></tbody></table>

a bacterial oral feeding assay with antibiotic-treated mosquitoes

The mosquito midgut harbors a highly dynamic microbiome that affects the host metabolism, reproduction, fitness, and vector competence. Studies have been conducted to investigate the effect of gut microbes as a whole; however, different microbes could exert distinct effects toward the host. This article provides the methodology to study the effect of each specific mosquito gut microbe and the potential mechanism.
This protocol contains two parts. The first part introduces how to dissect the mosquito midgut, isolate cultivable bacteria colonies, and identify bacteria species. The second part provides the procedure to generate antibiotic-treated mosquitoes and reintroduce one specific bacteria species.

The midguts of mosquitoes treated with antibiotics and without antibiotics were taken out for DNA extraction, and qPCR was performed with universal bacterial primers. Figure 1 shows the expression of bacterial 16S rRNA in the control group and antibiotic treatment group. The results show that about 98% of the gut bacteria have been removed, and the gut sterilization of penicillin and streptomycin was successful.
With the methods described, bacteria strains were isolated and id...

Watch this Scientific Journal Video about A Bacterial Oral Feeding Assay with Antibiotic-Treated Mosquitoes at JoVE.com

A Bacterial Oral Feeding Assay with Antibiotic-Treated Mosquitoes

This article presents a protocol to investigate the effect of individual mosquito gut bacteria, including isolation and identification of mosquito midgut cultivable microbes, antibiotic depletion of mosquito gut bacteria, and reintroduce one specific bacteria species.

The mosquito midgut harbors a highly dynamic microbiome that affects the host metabolism, reproduction, fitness, and vector competence. Studies have been ...

a-bacterial-oral-feeding-assay-with-antibiotic-treated-mosquitoes

Research

JoVE Journal

Biology

6.2K Views.  Hunan Normal University. Mosquito midgut herbergt een complexe gemeenschap van microben die invloed hebben op de gastheer metabolisme, reproductie, fitness, en dierenarts competentie. Bij elke darmmicrobe is een ander effect. Deze video introduceert de procedure om de respectieve rol van elke bacteriestam of gastheerfysiologie te bestuderen.Om een cultuur van darmbacteriële kolonies te verwerven, ontleden de mug midgut onder steriele toestand. Bezoedelde de ontleed midgut, serotologinaat, en verspreid over de...

Video: A Bacterial Oral Feeding Assay with Antibiotic-Treated Mosquitoes

Alphavirus Transducing System:  Tools for Visualizing Infection in Mosquito Vectors

Alphavirus transducing systems (ATSs) are important tools for expressing genes of interest (GOI) during infection. ATSs are derived from cDNA clones of mosquito-borne RNA viruses (genus Alphavirus; family Togaviridae). The Alphavirus genus contains about 30 different mosquito-borne virus species. Alphaviruses are enveloped viruses and contain single-stranded RNA genomes (~11.7 Kb). Alphaviruses transcribe a subgenomic mRNA that encodes the structural proteins of the virus required for encapsidation of the genome and maturation of the virus. Alphaviruses are usually highly lytic in vertebrate cells, but persistently infect susceptible mosquito cells with minimal cytopathology. These attributes make them excellent tools for gene expression in mosquito vectors. The most common ATSs in use are derived from Sindbis virus (SINV). The broad species tropism of SINV allows for infection of insect, avian, and mammalian cells8. However, ATSs have been derived from other alphaviruses as well9,10,20. Foreign gene expression is made possible by the insertion of an additional viral subgenomic RNA initiation site or promoter. ATSs in which an exogenous gene sequence is positioned 5' to the viral structural genes is used for stable protein expression in insects. ATSs, in which a gene sequence is positioned 3' to the structural genes, is used to trigger RNAi and silence expression of that gene in the insect.
ATSs have proven to be valuable tools for understanding vector-pathogen interactions, molecular details of viral replication and maintenance infectious cycles3,4,11,19,21. In particular, the expression of fluorescent and bioluminescent reporters has been instrumental tracking the viral infection in the vector and virus transmission5,14-16,18. Additionally, the vector immune response has been described using two strains of SINV engineered to express GFP2,9.
Here, we present a method for the production of SINV containing a fluorescent reporter (GFP) from the cDNA infectious clone. Infectious, full-length RNA is transcribed from the linearized cDNA clone. Infectious RNA is introduced into permissive target cells by electroporation. Transfected cells generate infectious virus particles expressing the GOI. Harvested virus is used to infect mosquitoes, as described here, or other host species (not shown herein). Vector competence is assessed by detecting fluorescence outside the midgut or by monitoring virus transmission7. Use of a fluorescent reporter as the GOI allows for convenient estimation of virus spread throughout a cell culture, for determination of rate of infection, dissemination in exposed mosquitoes, virus transmission from the mosquito and provides a rapid gauge of vector competence.

Methods for using alphavirus transducing systems to express fluorescent reporters in vitro and in adult mosquitoes are described. This technique may be adapted to express any protein of interest in lieu of or in addition to a reporter.

Alphavirus transducing systems (ATSs) are important tools for expressing genes of interest (GOI) during infection.  ATSs are derived from cDNA clones of ...

Immunology and Infection

Phenotypic Analysis of Rodent Malaria Parasite Asexual and Sexual Blood Stages and Mosquito Stages

Recent advances in genetics and systems biology technologies have promoted our understanding of the biology of malaria parasites on the molecular level. However, effective malaria parasite targets for vaccine and chemotherapy development are still limited. This is largely due to the unavailability of relevant and practical in vivo infection models for human Plasmodium species, most notably for P.&#160;falciparum and P. vivax. Therefore, rodent malaria species have been extensively used as practical alternative in vivo models for malaria vaccine, drug targeting, immune response, and functional characterization studies of conserved Plasmodiumspp. genes. Indeed, rodent malaria models have proven to be invaluable, especially for exploring mosquito transmission and liver stage biology, and were indispensable for immunological studies. However, there are discrepancies in the methods used to evaluate the phenotypes of transgenic and wild-type asexual and sexual blood-stage parasites.&#160;Examples of these discrepancies are the choice of an intravenous vs. intraperitoneal infection of rodents with blood-stage parasites and the evaluation of male gamete exflagellation. Herein, we detail standardized experimental methods to evaluate the phenotypes of asexual and sexual blood stages in transgenic parasites expressing reporter-gene or wild-type rodent malaria parasite species. We also detail the methods to evaluate the phenotypes of malaria parasite mosquito stages (gametes, ookinetes, oocysts, and sporozoites) inside Anopheles mosquito vectors. These methods are detailed and simplified here for the lethal and non-lethal strains of P. berghei and P. yoelii but can also be applied with some adjustments to P. chabaudi and P. vinckei rodent malaria species.

Due to the striking similarities of the life cycle and biology of rodent malaria parasites to human malaria parasites, rodent malaria models have become indispensable for malaria research. Herein, we standardized some of the most important techniques used in the phenotypic analysis of wild-type and transgenic rodent malaria species.

Recent advances in genetics and systems biology technologies have promoted our understanding of the biology of malaria parasites on the molecular level. ...

Vector Competence Analyses on Aedes aegypti Mosquitoes using Zika Virus

The procedures presented describe a generalized methodology to infect Aedes aegypti mosquitoes with Zika virus under laboratory conditions to determine the rate of infection, disseminated infection, and potential transmission of the virus in the mosquito population in question. These procedures are widely utilized with various modifications in vector competence evaluations globally. They are important in determining the potential role that a given mosquito (i.e., species, population, individual) may play in the transmission of a given agent.

Vector Competence Analyses on Aedes aegypti Mosquitoes using Zika Virus

The presented protocol can determine the vector competence of Aedes aegypti mosquito populations for a given virus, such as Zika, in a containment setting.

The procedures presented describe a generalized methodology to infect Aedes aegypti mosquitoes with Zika virus under laboratory conditions to determine ...

Feeding and Quantifying Animal-Derived Blood and Artificial Meals in Aedes aegypti Mosquitoes

Females of certain mosquito species can spread diseases while biting vertebrate hosts to obtain protein-rich blood meals required for egg development. In the laboratory, researchers can deliver animal-derived and artificial blood meals to mosquitoes via membrane feeders, which allow for manipulation of meal composition. Here, we present methods for feeding blood and artificial blood meals to Aedes aegypti mosquitoes and quantifying the volume consumed by individual females.
Targeted feeding and quantification of artificial/blood meals have broad uses, including testing the effects of meal components on mosquito behavior and physiology, delivering pharmacological compounds without injection, and infecting mosquitoes with specific pathogens. Adding fluorescein dye to the meal prior to feeding allows for subsequent meal size quantification. The meal volume consumed by mosquitoes can be measured either by weight, if the females are to be used later for behavioral experiments, or by homogenizing individual females in 96-well plates and measuring fluorescence levels using a plate reader as an endpoint assay. Meal size quantification can be used to determine whether changing the meal components alters the meal volume ingested or if meal consumption differs between mosquito strains. Precise meal size quantification is also critical for downstream assays, such as those measuring effects on host attraction or fecundity. The methods presented here can be further adapted to track meal digestion over the course of days or to include multiple distinguishable markers added to different meals (like nectar and blood) to quantify the consumption of each meal by a single mosquito.
These methods allow researchers to singlehandedly perform high-throughput measurements to compare the meal volume consumed by hundreds of individual mosquitoes. These tools will therefore be broadly useful to the community of mosquito researchers for answering diverse biological questions.

Feeding and Quantifying Animal-Derived Blood and Artificial Meals in Aedes aegypti Mosquitoes

The goal of this protocol is to deliver animal-derived and artificial blood meals to Aedes aegypti mosquitoes through an artificial membrane feeder and precisely quantify the volume of meal ingested.

Females of certain mosquito species can spread diseases while biting vertebrate hosts to obtain protein-rich blood meals required for egg development. In ...

Standard Membrane Feeding Assay for the Detection of Plasmodium falciparum Infection in Anopheles Mosquito Vectors

Malaria remains one of the most devastating diseases worldwide and, to date, the African region is still responsible for 94% of all cases worldwide. This parasitic disease requires a protozoan parasite, an Anopheles mosquito vector, and a vertebrate host. The Anopheles genus comprises more than 500 species, of which 60 are known as vectors of the parasite. The Plasmodium parasite genus consists of 250 species, and 48 of these are involved in disease transmission. Furthermore, the Plasmodium falciparum parasite has contributed toward an estimated 99.7% of malaria cases in sub-Saharan Africa in recent years. 
Gametocytes form part of the sexual stage of the parasite and are ingested by the female mosquito upon feeding on an infected human host. Further development of the parasite within the mosquito is enhanced by favorable environmental conditions in the midgut of the mosquito. Here, the fusion of the female and male gametes takes place, and the motile ookinetes originate. The ookinetes enter the midgut epithelium of the mosquito, and mature ookinetes form oocysts, which, in turn, produce motile sporozoites. These sporozoites migrate to the mosquito's salivary glands and are injected as a mosquito takes a blood meal. 
For drug discovery purposes, mosquitoes were artificially infected with gametocyte-infected blood in the standard membrane feeding assay (SMFA). To detect infection within the mosquito and/or to assess the efficacy of antimalarial compounds, the midguts of the female mosquitoes were removed post infection and were stained with mercurochrome. This method was used to enhance the visual detection of oocysts under the microscope for the accurate determination of oocyst prevalence and intensity.

Standard Membrane Feeding Assay for the Detection of Plasmodium falciparum Infection in Anopheles Mosquito Vectors

The standard membrane feeding assay (SMFA) is regarded as the gold standard for the assessment and identification of potential antimalarial compounds. This artificial feeding system is used to infect mosquitoes to further evaluate the effects of such compounds on the intensity and prevalence of the Plasmodium falciparum parasite.

Malaria remains one of the most devastating diseases worldwide and, to date, the African region is still responsible for 94% of all cases worldwide. This ...

Experimental Viral Infection in Adult Mosquitoes by Oral Feeding and Microinjection

Mosquito-borne viruses (MBVs), which are infectious pathogens to vertebrates, are spread by many mosquito species, posing a severe threat to public health. Once ingested, the viruses must overcome the mosquito midgut barrier to reach the hemolymph, from where they might potentially spread to the salivary glands. When a mosquito bites, these viruses are spread to new vertebrate hosts. Similarly, the mosquito may pick up different viruses. In general, only a tiny portion of viruses may enter the salivary glands via the gut. The transmission efficiency of these viruses to the glands is be affected by the two physical barriers found in different mosquito species: midgut barriers and salivary glands barriers. This protocol presents a method for virus detection in salivary glands of Aedes aegypti&#39;s&#160;following oral feeding and intrathoracic injection infection. Furthermore, determining whether the guts and/or salivary glands hinder viral spread can aid in the risk assessments of MBVs transmitted by Aedes aegypti.

This methodology, which included oral feeding and intrathoracic injection infection, could effectively assess the influence of midgut and/or salivary gland barriers on arbovirus infection.

Mosquito-borne viruses (MBVs), which are infectious pathogens to vertebrates, are spread by many mosquito species, posing a severe threat to public ...

Protocols for Testing the Toxicity of Novel Insecticidal Chemistries to Mosquitoes

New classes of insecticides with novel modes of action are needed to control insecticide resistant populations of mosquitoes that transmit diseases such as Zika, dengue and malaria. Assays for rapid, high-throughput analyses of unformulated novel chemistries against mosquito larvae and adults are presented. We describe protocols for single point-dose and dose response assays to evaluate the toxicity of small molecule chemistries to the Aedes aegypti vector of Zika, dengue and yellow fever,&#160;the malaria vector, Anopheles gambiae and the northern house mosquito, Culex quinquefasciatus, on contact and via ingestion. As an example, we evaluated the toxicity of amitriptyline, a small molecule antagonist of G protein-coupled receptors, via larval, adult topical and adult blood-feeding assay. The protocols provide a starting point to investigate insecticide potential. Results are discussed in the context of additional experiments to explore product applications and mechanisms for delivery.

Protocols are described for assessing the toxicity of chemistries to immature and adult mosquitoes for development as new classes of larvicides, adulticides and endectocides. The protocols enable high-throughput testing of multiple chemistries at single-point dose and subsequent evaluation via dose response assay to determine toxicity on contact or via ingestion.

New classes of insecticides with novel modes of action are needed to control insecticide resistant populations of mosquitoes that transmit diseases such ...

Forced Salivation As a Method to Analyze Vector Competence of Mosquitoes

Vector competence is defined as the potential of a mosquito species to transmit a mosquito-borne virus (mobovirus) to a vertebrate host. Viable virus particles are transmitted during a blood meal via the saliva of an infected mosquito. Forced salivation assays allow determining the vector potential on the basis of single mosquitoes, avoiding the use of animal experiments. The method is suitable to analyze a large number of mosquitoes in one experiment within a short period of time. Forced salivation assays were used to analyze 856 individual mosquitoes trapped in Germany, including two different Culex pipiens pipiens biotypes, Culex torrentium as well as Aedes albopictus, which were experimentally infected with Zika virus (ZIKV) and incubated at 18 &#176;C or 27 &#176;C for two and three weeks. The results indicated the lack of vector competence of the different Culex taxa for ZIKV. In contrast, Aedes albopictus was susceptible to ZIKV, but only at 27 &#176;C, with transmission rates similar to an Aedes aegypti laboratory colony tested in parallel.

For efficient control of mosquito borne virus transmission, the knowledge of the vector potential of respective mosquitoes is of particular interest. We describe forced salivation as a method to analyze vector competence of Aedes albopictus and three different Culex taxa for the transmission of Zika virus.

Vector competence is defined as the potential of a mosquito species to transmit a mosquito-borne virus (mobovirus) to a vertebrate host. Viable virus ...

A Blood-Free Diet to Rear Anopheline Mosquitoes

Malaria research requires large-scale breeding and production conditions for mosquitoes (Anopheles spp.) in captivity. The sustainable and reliable production of mosquitoes is currently inhibited by the supply of fresh vertebrate blood. Alternatives to blood are required to promote efficient control strategies for malaria and other vector borne diseases that are transmitted by blood feeding insects. With this in mind, artificial liquid diets were formulated as substitutes for fresh vertebrate blood. Herein we report a blood-free artificial liquid diet that delivers feeding rates similar to blood and mimics the physiological effects of a fresh vertebrate blood meal. The diet induces ovarian and egg maturation of Anopheles mosquitoes and also produces good larval survival and development of functional adults. The formulated blood-free liquid diet is an important advance towards sustainable mosquito breeding in captivity and will reduce the maintenance costs of mosquito colonies and eliminate the need for fresh vertebrate blood.

A protocol is presented for formulation of a blood-free artificial diet to feed Anopheles mosquitoes in captivity. This diet has a similar performance to vertebrate blood and triggers oogenesis and egg maturation and produces viable adult progeny.

Malaria research requires large-scale breeding and production conditions for mosquitoes (Anopheles spp.) in captivity. The sustainable and reliable ...

Effective Oral RNA Interference (RNAi) Administration to Adult Anopheles gambiae Mosquitoes

RNA interference has been a heavily utilized tool for reverse genetic analysis for two decades. In adult mosquitoes, double-stranded RNA (dsRNA) administration has been accomplished primarily via injection, which requires significant time and is not suitable for field applications. To overcome these limitations, here we present a more efficient method for robust activation of RNAi by oral delivery of dsRNA to adult Anopheles gambiae. Long dsRNAs were produced in Escherichia coli strain HT115 (DE3), and a concentrated suspension of heat-killed dsRNA-containing bacteria in 10% sucrose was offered on cotton balls ad-libitum to adult mosquitoes. Cotton balls were replaced every 2 days for the duration of the treatment. Use of this method to target doublesex (a gene involved in sex differentiation) or fork head (which encodes a salivary gland transcription factor) resulted in reduced target gene expression and/or protein immunofluorescence signal, as measured by quantitative Real-Time PCR (qRT-PCR) or fluorescence confocal microscopy, respectively. Defects in salivary gland morphology were also observed. This highly flexible, user-friendly, low-cost, time-efficient method of dsRNA delivery could be broadly applicable to target genes important for insect vector physiology and beyond.

Effective Oral RNA Interference RNAi Administration to Adult Anopheles gambiae Mosquitoes

The oral administration of dsRNA produced by bacteria, a delivery method for RNA interference (RNAi) that is routinely used in Caenorhabditis elegans, was successfully applied here to adult mosquitoes. Our method allows for robust reverse genetics studies and transmission-blocking vector studies without the use of injection.

A Bacterial Oral Feeding Assay with Antibiotic-Treated Mosquitoes

Samenvatting

Meer video's verkennen