Laura-Isobel McCall, PhD, holds an Investigators&#160;in the Pathogenesis of Infectious Disease Award from the Burroughs Wellcome Fund. The authors further wish to acknowledge support from NIH award number R21AI148886, a pilot grant from the Oklahoma Center for Respiratory and Infectious Diseases (OCRID) under NIH award number P20GM103648, and start-up funds from the University of Oklahoma (to LIM). The content is solely the authors&#39; responsibility and does not necessarily represent the official views of the funders. The authors also wish to thank the developers of the tools used in this protocol. All relevant publications have been cited, where applicable.

No conflicts of interest to report.

Understanding trypanosomatid infections is essential to guide novel drug development and treatment approaches. This chemical cartography method is uniquely poised to provide actionable insights into the relationship between metabolism and trypanosomatid disease pathogenesis, thus addressing this translational need.
Only LC-MS grade solvents are recommended during metabolite extraction and MS analyses, to lessen background contamination. Polymeric contamination35, commonly derived from paraffin film and/or other plastics36,37,38, must be avoided where possible. Parafilm, in particular, must never be used. These aspects are crucial since LC-MS data quality depends on the materials used during sample preparation and metabolite extraction. Data quality should be ensured before generating &#39;ili plots. In addition, generating these comprehensive spatial metabolomics maps requires the collection of all adjacent tissue samples and metabolite extraction from all collected samples to avoid gaps in these maps. Collection procedures, logistics of metabolite extraction and LC-MS analysis, and costs should thus be considered and planned accordingly.
This protocol can be modified to meet user needs in multiple ways. For example, the polarity and solubility of solvents used during metabolite extraction will influence what metabolites are detected39. To maximize the diversity of detected metabolite features for untargeted chemical cartography analyses, combining multiple extraction steps and solvents is recommended. For example, this method utilizes dichloromethane, methanol, and water as extraction solvents because they enable accurate detection of nonpolar and polar molecules20,40. However, these solvents are not universally suitable for every MS experiment, and researchers should select extraction solvents based on the goals of their project. Likewise, different LC-MS/MS conditions can be used, such as replacing reversed-phase chromatography with normal phase chromatography. Alternative columns can also be used for reversed-phase data collection instead of C8 chromatography, though empirically, C8 chromatography is more robust to tissue lipids and has a lower clogging frequency. Conceptually, these protocols can also be applied to other mass spectrometry methods such as gas chromatography-mass spectrometry, etc.
An alternative approach is mass spectrometry imaging. Indeed, unlike mass spectrometry imaging approaches, liquid chromatography-mass spectrometry does not inherently preserve spatial information10. Chemical cartography approaches bridge this gap by including sampling location at the time of project conceptualization, in the sample metadata, and at data processing steps. A strength of this chemical cartography approach, unlike mass spectrometry imaging, is the ability to provide confident annotations (Metabolomics Standards Initiative level 1 or level 2 annotation confidence41), unlike mass spectrometry imaging where the bulk of applications rely on accurate mass only for annotation. Mass spectrometry imaging will enable fine-grained spatial mapping, sometimes down to the single-cell level, e.g.,42,43. In contrast, chemical cartography approaches enable large-scale cross-organ mapping of metabolite distribution without requiring highly specialized whole-animal cryosectioning skills. Chemical cartography provides complementary evidence to the many spatial transcriptomic approaches being developed, e.g.,44, with the advantage of focusing on the &#39;omics layer closest to the phenotype&#39;45. Alternative methods for parasite load quantification include measuring bioluminescence at the time of sample collection6. Fine segments could also be collected to enable confocal or electron microscopy to assess localized parasite burden and tissue damage. The water homogenate, which is used for cytokine quantification in this protocol and prior publications13, could also be used to quantify protein-based markers of tissue damage.
There are also multiple ways to obtain 3D models suitable to plot the resulting LC-MS data. In addition to the method suggested here, models can be purchased pre-made from various online vendors. Ensure that the terms of use match with the intended usage, especially concerning publication. Models for large organs can be generated de novo using 3D scanners according to scanner instructions. Alternatives such as MATLAB exist for generating and visualizing 3D models for chemical cartography46, but they were primarily implemented before the development of &#39;ili16. MATLAB is a data analysis and programming tool suite offering a wide variety of applications across many fields. However, MATLAB is neither free nor open-source, and it requires familiarity with MATLAB interfaces, especially considering MATLAB was not developed for processing mass spectrometry data. This proposed method&#39;s alternatives, namely, SketchUp, Meshlab, and &#39;ili, are freely accessible, user-friendly, and offer similar functions as MATLAB for chemical cartography purposes.
This method is robust concerning sample preparation and metabolite extraction. Troubleshooting is most often necessary at the LC-MS data acquisition step. This is beyond the scope of this article. Readers are directed to excellent publications on LC-MS data acquisition troubleshooting, including20,47. Likewise, the complexities of metabolite annotation are beyond the scope of this method&#39;s focus on 3D model generation. Useful references on this topic include24,25,48,49.
While this method effectively explores disease pathogenesis, there are limitations to this approach, some of which are common across any metabolomics experiment. One such limitation is the low annotation rate of LC-MS features50, which is contingent upon reference spectral libraries&#39; availability and quality. A further limitation is that this protocol does not preserve mRNA due to the incompatibility of RNA preservation reagents such as RNAlater with LC-MS/MS analysis. However, the protein quality is adequate for downstream analyses and thus can replace mRNA-based analyses.
A chemical cartography approach to infection pathogenesis directly reflects how bacterial, viral, or parasitic infections develop in organ systems and cause localized disease. Analyzing these regional subsamples and generating 3D models ultimately conveys how metabolites function across three-dimensional space, shedding light on these previously unrecognized spatial dimensions of molecular biology. Using this protocol, for example, metabolite localization was compared to Trypanosoma cruzi parasite load. Results clarified the relationship between the pathogen and host tissue and also demonstrated the metabolic dynamics of Chagas disease symptom progression6. Chemical cartography methods have also been applied to various topics, such as human-built environment interaction51,52,53, the chemical makeup of organ systems like human skin46 and lungs54, and plant metabolism and environment interactions55. Future applications can involve assessing localized disease tolerance and resilience, or the relationship between local metabolite levels, pathogen tropism, and disease tropism in models beyond trypanosomatid infection. This approach should also have broad applicability to expand current pharmacokinetics protocols, to assess the relationship between local tissue drug levels and drug metabolism vs. overall metabolic context, tissue damage, and pathogen clearance. Overall, chemical cartography allows unique explorations of metabolite distributions in various sample types, with applications&#160;including disease pathogenesis, human health, human-environment interactions, and microbial dynamics.

Trypanosomatid parasites consist of Leishmania species, African trypanosomes (Trypanosoma brucei), and American trypanosomes (Trypanosoma cruzi). Leishmania protozoa cause leishmaniasis, which includes self-healing and self-limited localized cutaneous leishmaniasis, mucocutaneous leishmaniasis in which the mucosal tissues of the mouth, nose, and throat become damaged, and visceral leishmaniasis with parasite tropism to the visceral organs causing fever and hepatosplenomegaly1,2. T. brucei causes Human African trypanosomiasis (HAT), also known as sleeping sickness, mainly reported in African countries3. The clinical signs and symptoms include hepatosplenomegaly, fever, headache, musculoskeletal pains, lymphadenopathies, and anemia in the hemo-lymphatic stage when parasites localize to the bloodstream and lymphatics. This is followed by the meningo-encephalitic stage, where parasites localize to the central nervous system and cause sleep disturbance, behavioral alteration, and eventually fatal comas4. T. cruzi causes Chagas disease, endemic in the Americas. Infected individuals experience an initial acute stage, usually asymptomatic, with broad parasite tropism. About 10%-30% of infected individuals experience chronic stage symptoms after decades of infection, characterized by megaoesophagus, megacolon, and cardiovascular complications5,6.
Metabolomics studies small molecular species (50-1,500 Da), including biological compounds from primary or secondary metabolism and externally-derived compounds such as drugs or food-derived molecules. In the context of host-pathogen interactions, metabolomics can explore the impact of infection on host metabolite environments, crucial in accessing the effect of the pathogen on the host. It can also assess pathogen adaptations to the host nutritional and immunological environment7,8,9. Mass spectrometry (MS) and nuclear magnetic resonance (NMR) spectroscopy are common metabolomics tools used to identify, quantify, and characterize metabolites. This &#34;omics&#34; approach can also be applied to biomarker discovery and drug development10,11.
Given the specific tissue tropism of trypanosomatid parasites, spatial metabolomics analyses can enable significant insight into the pathogenesis of the diseases they cause. Mapping the spatial distribution of metabolites revealed metabolites locally affected by chronic Trypanosoma cruzi infection in mouse heart tissue and acute and long-term Trypanosoma cruzi infection in the mouse gastrointestinal tract6,12,13. Specifically, 3D chemical cartography demonstrated a disconnect between parasite persistence and metabolic alterations in the heart tissue of chronically Trypanosoma cruzi-infected mice. Metabolism was most perturbed in lower and apical segments of the heart, matching with sites of Chagas disease symptoms (cardiac apical aneurysms). Metabolite families perturbed by infection at specific cardiac sites and correlated to disease severity include acylcarnitines and glycerophosphocholines12,13,14. In the gastrointestinal tract, persistent metabolic alterations concurred with sites of Chagas disease symptoms: esophagus and colon. In contrast, metabolism is re-normalized at sites not associated with Chagas disease symptoms, such as the small intestine. Metabolites locally perturbed by infection in the gastrointestinal tract include acylcarnitines, glycerophosphocholines, kynurenine, tryptophan, and cholic acid. In addition, these analyses enabled the identification of a new metabolic mechanism of tolerance to Chagas disease6. Applying these methods to the study of cutaneous leishmaniasis revealed significant metabolic perturbations at the site of the lesion, but also specific metabolic changes in lesion-adjacent, macroscopically healthy tissue. For example, glutamine was depleted at the lesion site, whereas glycerophosphocholines in the m/z (mass to charge ratio) 200-299, 400-499, 500-599, and 600-699 were significantly increased at the lesion site. PC (O-34:1) was only increased at lesion-adjacent sites15.
The goal of this manuscript is to demonstrate the steps necessary to generate 3D models of metabolite distribution (&#34;chemical cartography&#34;) as applied to trypanosomatid parasite infection models (Figure 1). This approach builds on several critical advances in the context of metabolomics and metabolomics data processing, particularly the development of &#39;ili software to plot metabolomics data onto 3D models easily16.

<table><tbody><tr><td>1.5 mL Eppendorf tubes</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>1 L bottle, pyrex</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>1 L graduated cylinder, pyrex</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>2 mL SafeLock Eppendorf tubes</td><td>VWR</td><td>20901-540</td><td>use the appropriate tube model for the available tissue homogenizer</td></tr><tr><td>3D model (de-novo generated according to protocol steps, or purchased)</td><td>NA</td><td>NA</td><td>as appropriate for system under investigation</td></tr><tr><td>5 mm stainless steel bead</td><td>Qiagen</td><td>69989</td><td></td></tr><tr><td>96 well plate</td><td>Fisher</td><td>3252449</td><td></td></tr><tr><td>AATTCCTCCAAGCAGCGGATA primer</td><td>NA</td><td>NA</td><td>any brand, as available; published in Piron, M. et al. Development of a real-time PCR assay for &lt;i&gt; Trypanosoma cruzi &lt;/i&gt; detection in blood samples. Acta tropica. 103 (3), 195&amp;ndash;200 (2007).</td></tr><tr><td>analytical balance</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>ASTCGGCTGATCGTTTTCGA primer</td><td>NA</td><td>NA</td><td>any brand, as available; published in Piron, M. et al. Development of a real-time PCR assay for &lt;i&gt; Trypanosoma cruzi &lt;/i&gt; detection in blood samples. Acta tropica. 103 (3), 195&amp;ndash;200 (2007).</td></tr><tr><td>benchtop centrifuge with microcentrifuge, falcon tube and 96-well-plate capacity</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>biosafety cabinet</td><td>NA</td><td>NA</td><td>class II, type A2; any brand, as available</td></tr><tr><td>CAGCAAGCATCTATGCACTTAG&lt;br/&gt; ACCCC primer</td><td>NA</td><td>NA</td><td>any brand, as available; published in Cummings, K.L., Tarleton, R.L. Rapid quantitation of &lt;i&gt; Trypanosoma cruzi &lt;/i&gt; in host tissue by real-time PCR. Molecular and biochemical parasitology. 129 (1), 53&amp;ndash;59 (2003).</td></tr><tr><td>camera</td><td>NA</td><td>NA</td><td>any brand, as available. A cellphone camera is adequate for this protocol</td></tr><tr><td>chemiluminescent-capable imaging system</td><td>NA</td><td>NA</td><td>any system, as available</td></tr><tr><td>cotton balls</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>cryogloves</td><td>VWR</td><td>97008-208</td><td>replace with any brand, as available</td></tr><tr><td>dissection scissors</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>dry ice</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>extra-length forceps</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>flammable-grade refrigerator</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>freezer storage boxes for microcentrifuge tubes</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>fume hood</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>high-resolution mass spectrometer</td><td>NA</td><td>NA</td><td>any brand, as available, such as ThermoFisher Q-Exactive Plus (catalog number 0726030)</td></tr><tr><td>ice bucket</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>ili software</td><td>ili.embl.de</td><td>NA</td><td></td></tr><tr><td>isoflurane</td><td>Covetrus</td><td>29405</td><td></td></tr><tr><td>large tupperware</td><td>NA</td><td>NA</td><td>any brand, as available; large enough to comfortably contain mouse, cotton ball</td></tr><tr><td>LC-MS grade acetonitrile</td><td>Fisher Optima</td><td>A955-4</td><td></td></tr><tr><td>LC-MS grade dicholoromethane</td><td>Fisher Optima</td><td>D151-4</td><td></td></tr><tr><td>LC-MS grade formic acid</td><td>Fisher Optima</td><td>A11750</td><td></td></tr><tr><td>LC-MS grade methanol</td><td>Fisher Optima</td><td>A456-4</td><td></td></tr><tr><td>LC-MS grade water</td><td>Fisher Optima</td><td>W64</td><td></td></tr><tr><td>liquid chromatography column</td><td>Phenomenex</td><td>00B-4499-AN</td><td>may be changed to other brands and models as appropriate for the metabolites of interest</td></tr><tr><td>liquid chromatography column guard cartridge</td><td>Phenomenex</td><td>AJ0-8784</td><td>may be changed to other brands and models as appropriate for the metabolites of interest</td></tr><tr><td>liquid chromatography column guard cartridge holder</td><td>Phenomenex</td><td>AJ0-9000</td><td>may be changed to other brands and models as appropriate for the metabolites of interest</td></tr><tr><td>liquid nitrogen</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>luciferin</td><td>Goldbio</td><td>LUCK-1G</td><td></td></tr><tr><td>MeshLab software</td><td>https://www.meshlab.net/</td><td>NA</td><td></td></tr><tr><td>Meshmixer software</td><td>https://www.meshmixer.com/</td><td>NA</td><td></td></tr><tr><td>MS calibrant</td><td>NA</td><td>NA</td><td>appropriate one for available instrument</td></tr><tr><td>MS data processing software</td><td>NA</td><td>NA</td><td>multiple options available; authors recommend MZmine</td></tr><tr><td>MSConvert software</td><td>http://proteowizard.sourceforge.net/</td><td>NA</td><td></td></tr><tr><td>Nanodrop</td><td>ThermoFisher</td><td>ND-ONE-W</td><td>other nanodrop models are also suitable</td></tr><tr><td>p1000 pipet tips</td><td>NA</td><td>NA</td><td>use the appropriate brand to fit available pipettors</td></tr><tr><td>p1000 pipettor</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>p20 pipette tips</td><td>NA</td><td>NA</td><td>use the appropriate brand to fit available pipettors</td></tr><tr><td>p20 pipettor</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>p200 pipette tips</td><td>NA</td><td>NA</td><td>use the appropriate brand to fit available pipettors</td></tr><tr><td>p200 pipettor</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>personal protective equipment (gloves, lab coat, safety glasses/goggles; faceshield)</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>Q-Plex Mouse Cytokine - Screen (16-Plex)</td><td>Quansys biosciences</td><td>110949MS</td><td>can replace with other protein-based cytokine assays such as other commercial cytokine ELISA kits</td></tr><tr><td>Quick-DNA Miniprep Plus Kit (200 preps)</td><td>Zymo</td><td>D4069</td><td>replace with any brand of mammalian DNA extraction kit, as available</td></tr><tr><td>real-time thermocycler</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>salt shaker or tea infuser</td><td>NA</td><td>NA</td><td>any brand; to contain isoflurane-soaked cotton ball and prevent contact with mouse skin</td></tr><tr><td>SketchUp software</td><td>https://www.sketchup.com/</td><td>NA</td><td></td></tr><tr><td>specimen forceps</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>speedvac with microcentrifuge tube and 96-well-plate capacity</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>spreadsheet software</td><td>https://www.microsoft.com/en-us/microsoft-365/excel</td><td>NA</td><td>can replace with other spreadsheet management software, as applicable</td></tr><tr><td>sulfachloropyridazine</td><td>Sigma</td><td>S9882-100G</td><td></td></tr><tr><td>sulfadimethoxine</td><td>Sigma</td><td>S7007-10G</td><td></td></tr><tr><td>Sybr green qPCR reaction mix</td><td>Fisher</td><td>A25780</td><td>can replace with other Sybr green qPCR reaction mixes, as desired</td></tr><tr><td>TCCCTCTCATCAGTTCTAT&lt;br/&gt; GGCCCA primer</td><td>NA</td><td>NA</td><td>any brand, as available; published in Cummings, K.L., Tarleton, R.L. Rapid quantitation of &lt;i&gt; Trypanosoma cruzi &lt;/i&gt; in host tissue by real-time PCR. Molecular and biochemical parasitology. 129 (1), 53&amp;ndash;59 (2003).</td></tr><tr><td>tissue homogenizer</td><td>NA</td><td>NA</td><td>any brand, as available; for example, Qiagen TissueLyser II, catalog number 85300, with TissueLyser Adapter Set (2 x 24), catalog number 69982</td></tr><tr><td>tissue samples</td><td>NA</td><td>NA</td><td>from appropriate infection model</td></tr><tr><td>TissueLyser single-bead dispenser</td><td>Qiagen</td><td>69965</td><td></td></tr><tr><td>UHPLC</td><td>NA</td><td>NA</td><td>any brand, as available, such as ThermoFisher Vanquish (catalog number IQLAAAGABHFAPUMBHV)</td></tr><tr><td>ultra-low temperature freezer (-80)</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>ultrasonic bath</td><td>NA</td><td>NA</td><td>any system, as available</td></tr><tr><td>wet ice</td><td>NA</td><td>NA</td><td>any brand, as available</td></tr><tr><td>zone-free sealing film</td><td>VWR</td><td>&amp;nbsp;490007-390</td><td></td></tr></tbody></table>

chemical cartography approaches to study trypanosomatid infection

Pathogen tropism and disease tropism refer to the tissue locations selectively colonized or damaged by pathogens, leading to localized disease symptoms. Human-infective trypanosomatid parasites include Trypanosoma cruzi, the causative agent of Chagas disease; Trypanosoma brucei, the&#160;causative agent of sleeping sickness; and Leishmania species, causative agents of leishmaniasis. Jointly, they affect 20 million people across the globe. These parasites show specific tropism: heart, esophagus, colon for T. cruzi, adipose tissue, pancreas, skin, circulatory system and central nervous system for T. brucei, skin for dermotropic Leishmania strains, and liver, spleen, and bone marrow for viscerotropic Leishmania strains. A spatial perspective is therefore essential to understand trypanosomatid disease pathogenesis. Chemical cartography generates 3D visualizations of small molecule abundance generated via liquid chromatography-mass spectrometry, in comparison to microbiological and immunological parameters. This protocol demonstrates how chemical cartography can be applied to study pathogenic processes during trypanosomatid infection, beginning from systematic tissue sampling and metabolite extraction, followed by liquid chromatography-tandem mass spectrometry data acquisition, and concluding with the generation of 3D maps of metabolite distribution. This method can be used for multiple research questions, such as nutrient requirements for tissue colonization by T. cruzi, T. brucei, or Leishmania, immunometabolism at sites of infection, and the relationship between local tissue metabolic perturbation and clinical disease symptoms, leading to comprehensive insight into trypanosomatid disease pathogenesis.

The number of metabolite features obtained depends on the tissue type analyzed and data processing parameters. For example, this protocol has been&#160;used to analyze the spatial impact of T. cruzi infection on the gastrointestinal tract metabolome in a mouse model of T. cruzi infection. In prior work, male C3H/HeJ were injected intraperitoneally with 1,000 CL + luc T. cruzi parasites32,6. Animals were euthanized 12 or 89 days post-infection, and a chemical cartography analysis of 13 contiguous segments of the gastrointestinal tract was performed as described in this protocol. This analysis led to a feature table of 5,502 features, which were then visualized into 3D using the steps described in this protocol. This approach enables the visualization of metabolite features in individual animals that are high at the site of high parasite load (kynurenine, Figure 2B vs. parasite load, Figure 2A), of metabolites with differential distribution across tissue regions (glutamine, Figure 2C) and metabolite features that are found at comparable levels across small and large intestines (LPE 16:0 Figure 2D). Kynurenine was selected for visualization because of its known relationship to inflammation and prior publications on the ability of kynurenine-derived metabolites to regulate&#160;T. cruzi load33. Random forest-based machine learning models had previously revealed an association between kynurenine levels and infection status6. Glutamine was selected for a visualization based on previous publications demonstrating a relationship between in vitro glutamine availability and T. cruzi drug sensitivity34. Differential distribution was confirmed using logistic regression, p &#60; 0.05. LPE 16:0 was selected after visual inspection of the data to discover metabolite features found at comparable levels across tissue sites.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/63255/63255fig01.jpg" /> 
Figure 1: Protocol overview. The illustration was created with BioRender.com. <a href="https://www.jove.com/files/ftp_upload/63255/63255fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/63255/63255fig02.jpg" /> 
Figure 2: Chemical cartography analysis. Male C3H/HeJ mice were injected intraperitoneally with 1,000 CL+luc T. cruzi parasites32. Animals were euthanized 12 or 89 days post-infection, and the gastrointestinal tract was collected and sectioned systematically (step 1)6. Metabolites were extracted as in step 2 and analyzed by LC-MS/MS. 3D model generation was performed using the SketchUp software (step 5), and data were plotted in 3D as in step 6. (A) Parasite distribution in a specific mouse, 12 days post-infection. (B) Kynurenine metabolite distribution in the same mouse, 12 days post-infection. (C) Mean glutamine distribution across infected mice, 89 days post-infection. (D) Comparable levels of m/z 454.292 retention time 2.929 min, annotated as 2-hexadecanoyl-sn-glycero-3-phosphoethanolamine (LPE 16:0), in the same mouse as in A and B in the small intestine and colon. Samples and data were generated in6. <a href="https://www.jove.com/files/ftp_upload/63255/63255fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Chemical Cartography Approaches to Study Trypanosomatid Infection at JoVE.com

Chemical Cartography Approaches to Study Trypanosomatid Infection

This protocol describes the steps to generate a 3D model of metabolite distribution during trypanosomatid infection, including sample collection, metabolite extraction, an overview of liquid chromatography-tandem mass spectrometry data acquisition, 3D model generation, and finally, data visualization.

Pathogen tropism and disease tropism refer to the tissue locations selectively colonized or damaged by pathogens, leading to localized disease symptoms. ...

chemical-cartography-approaches-to-study-trypanosomatid-infection

Research

JoVE Journal

Immunology and Infection

2.3K Views.  University of Oklahoma, Norman. Dit protocol kan worden gebruikt om 3D-modellen van metaboliet- en parasietverdeling te bouwen. Dit kan helpen bij het begrijpen van de relatie tussen lokale weefsel metabole verstoring, parasiet distributie, en klinische ziekte symptomen. Het belangrijkste voordeel van deze methode is dat het live schaal cross-organ mapping van metabolietverdeling versus pathogene distributie en de statistische analyse ervan mogelijk maakt.Theoretisch kan chemische cartografie de ontwikkeling en impac...

Video: Chemical Cartography Approaches to Study Trypanosomatid Infection

Establishment of Larval Zebrafish as an Animal Model to Investigate Trypanosoma cruzi Motility In Vivo

Chagas disease is a parasitic infection caused by Trypanosoma cruzi, whose motility is not only important for localization, but also for cellular binding and invasion. Current animal models for the study of T. cruzi allow limited observation of parasites in vivo, representing a challenge for understanding parasite behavior during the initial stages of infection in humans. This protozoan has a flagellar stage in both vector and mammalian hosts, but there are no studies describing its motility in vivo.The objective of this project was to establish a live vertebrate zebrafish model to evaluate T. cruzi motility in the vascular system. Transparent zebrafish larvae were injected with fluorescently labeled trypomastigotes and observed using light sheet fluorescence microscopy (LSFM), a noninvasive method to visualize live organisms with high optical resolution. The parasites could be visualized for extended periods of time due to this technique&#39;s relatively low risk of photodamage compared to confocal or epifluorescence microscopy. T. cruzi parasites were observed traveling in the circulatory system of live zebrafish in different-sized blood vessels and the yolk. They could also be seen attached to the yolk sac wall and to the atrioventricular valve despite the strong forces associated with heart contractions. LSFM of T. cruzi-inoculated zebrafish larvae is a valuable method that can be used to visualize circulating parasites and evaluate their tropism, migration patterns, and motility in the dynamic environment of the cardiovascular system of a live animal.

Establishment of Larval Zebrafish as an Animal Model to Investigate Trypanosoma cruzi Motility In Vivo

In this protocol, fluorescently labeled T. cruzi&#160;were injected into transparent zebrafish larvae, and parasite motility was observed in vivo using light sheet fluorescence microscopy.

Chagas disease is a parasitic infection caused by Trypanosoma cruzi, whose motility is not only important for localization, but also for cellular binding ...

Developmental Biology

In Vitro Drug Screening Against All Life Cycle Stages of Trypanosoma cruzi Using Parasites Expressing &#946;-galactosidase

Trypanosoma cruzi is the causative agent of Chagas disease (ChD), an endemic disease of public health importance in Latin America that also affects many non-endemic countries due to the increase in migration. This disease affects nearly 8 million people, with new cases estimated at 50,000 per year. In the 1960s and 70s, two drugs for ChD treatment were introduced: nifurtimox and benznidazole (BZN). Both are effective in newborns and during the acute phase of the disease but not in the chronic phase, and their use is associated with important side effects. These facts underscore the urgent need to intensify the search for new drugs against T. cruzi.
T. cruzi is transmitted through hematophagous insect vectors of the Reduviidae and Hemiptera families. Once in the mammalian host, it multiplies intracellularly as the non-flagellated amastigote form and differentiates into the trypomastigote, the bloodstream non-replicative infective form. Inside the insect vector, trypomastigotes transform into the epimastigote stage and multiply through binary fission.
This paper describes an assay based on measuring the activity of the cytoplasmic &#946;-galactosidase released into the culture due to parasites lysis by using the substrate, chlorophenol red &#946;-D-galactopyranoside (CPRG). For this, the T. cruzi Dm28c strain was transfected with a &#946;-galactosidase-overexpressing plasmid and used for in vitro pharmacological screening in epimastigote, trypomastigote, and amastigote stages. This paper also describes how to measure the enzymatic activity in cultured epimastigotes, infected Vero cells with amastigotes, and trypomastigotes released from the cultured cells using the reference drug, benznidazole, as an example. This colorimetric assay is easily performed and can be scaled to a high-throughput format and applied to other T. cruzi strains.

In Vitro Drug Screening Against All Life Cycle Stages of Trypanosoma cruzi Using Parasites Expressing &#946;-galactosidase

We describe a high-throughput colorimetric assay measuring &#946;-galactosidase activity in three life cycle stages of Trypanosoma cruzi, the causative agent of Chagas disease. This assay can be used to identify trypanocidal compounds in an easy, fast, and reproducible manner.

Trypanosoma cruzi is the causative agent of Chagas disease (ChD), an endemic disease of public health importance in Latin America that also affects many ...

Biochemistry

Bioluminescence Imaging to Detect Late Stage Infection of African Trypanosomiasis

Human African trypanosomiasis (HAT) is a multi-stage disease that manifests in two stages; an early blood stage and a late stage when the parasite invades the central nervous system (CNS). In vivo study of the late stage has been limited as traditional methodologies require the removal of the brain to determine the presence of the parasites.
Bioluminescence imaging is a non-invasive, highly sensitive form of optical imaging that enables the visualization of a luciferase-transfected pathogen in real-time. By using a transfected trypanosome strain that has the ability to produce late stage disease in mice we are able to study the kinetics of a CNS infection in a single animal throughout the course of infection, as well as observe the movement and dissemination of a systemic infection.
Here we describe a robust protocol to study CNS infections using a bioluminescence model of African trypanosomiasis, providing real time non-invasive observations which can be further analyzed with optional downstream approaches.

This manuscript describes the use of a bioluminescent strain of African trypanosomes to enable the tracking of late stage infection and demonstrates how in vivo live imaging can be used to visualize infections within the central nervous system in real-time.

Human African trypanosomiasis (HAT) is a multi-stage disease that manifests in two stages; an early blood stage and a late stage when the parasite invades ...

Detection of Trypanosoma brucei Variant Surface Glycoprotein Switching by Magnetic Activated Cell Sorting and Flow Cytometry

Trypanosoma brucei, a protozoan parasite that causes both Human and Animal African Trypanosomiasis (known as sleeping sickness and nagana, respectively) cycles between a tsetse vector and a mammalian host. It evades the mammalian host immune system by periodically switching the dense, variant surface glycoprotein (VSG) that covers its surface. The detection of antigenic variation in Trypanosoma brucei can be both cumbersome and labor intensive. Here, we present a method for quantifying the number of parasites that have 'switched' to express a new VSG in a given population. The parasites are first stained with an antibody against the starting VSG, and then stained with a secondary antibody attached to a magnetic bead. Parasites expressing the starting VSG are then separated from the rest of the population by running the parasites over a column attached to a magnet. Parasites expressing the dominant, starting VSG are retained on the column, while the flow-through contains parasites that express a new VSG as well as some contaminants expressing the starting VSG. This flow-through population is stained again with a fluorescently labeled antibody against the starting VSG to label contaminants, and propidium iodide (PI), which labels dead cells. A known number of absolute counting beads that are visible by flow cytometry are added to the flow-through population. The ratio of beads to number of cells collected can then be used to extrapolate the number of cells in the entire sample. Flow cytometry is used to quantify the population of switchers by counting the number of PI negative cells that do not stain positively for the starting, dominant VSG. The proportion of switchers in the population can then be calculated using the flow cytometry data.

Detection of Trypanosoma brucei Variant Surface Glycoprotein Switching by Magnetic Activated Cell Sorting and Flow Cytometry

African trypanosomes grown in vitro undergo antigenic variation at a low rate, such that populations are made up of parasites expressing a dominant variant surface glycoprotein (VSG) type and a small population of "switched" variants. This protocol describes a fast method for detecting and quantifying these populations.

Trypanosoma brucei, a protozoan parasite that causes both Human and Animal African Trypanosomiasis (known as sleeping sickness and nagana, respectively) ...

Sexual Transmission of American Trypanosomes from Males and Females to Naive Mates

American trypanosomiasis is transmitted to humans by triatomine bugs through the ingestion of contaminated food, by blood transfusions or accidently in hospitals and research laboratories. In addition, the Trypanosoma cruzi infection is transmitted congenitally from a&#160;chagasic mother to her offspring, but the male partner&#39;s contribution to in utero contamination is unknown. The findings of nests and clumps of amastigotes and of trypomastigotes in the theca cells of the ovary, in the goniablasts and in the lumen of seminiferous tubules suggest that T. cruzi infections are sexually transmitted. The research protocol herein presents the results of a family study population showing parasite nuclear DNA in the diploid blood mononuclear cells and in the haploid gametes of human subjects. Thus, three independent biological samples collected one year apart confirmed that T. cruzi infections were sexually transmitted to progeny. Interestingly, the specific T. cruzi antibody was absent in the majority of family progeny that bore immune tolerance to the parasite antigen. Immune tolerance was demonstrated in chicken refractory to T. cruzi after the first week of embryonic growth, and chicks hatched from the flagellate-inoculated eggs were unable to produce the specific antibody.&#160;Moreover, the instillation of the human semen ejaculates intraperitoneally or into the vagina of naive mice yielded T. cruzi amastigotes in the epididymis, seminiferous tubule, vas deferens and uterine tube with an absence of inflammatory reactions in the immune privileged organs of reproduction. The breeding of T. cruzi-infected male and female mice with naive mates resulted in acquisition of the infections, which were later transmitted to the progeny. Therefore, a robust education, information and communication program that involves the population and social organizations is deemed necessary to prevent Chagas disease.

The Trypanosoma cruzi agent of Chagas disease produces long-lasting asymptomatic infections that abruptly develop into clinically recognized pathology. The following research protocol describes a short-run family-based epidemiological study to unravel the T. cruzi infection transmitted sexually from parent to progeny.

American trypanosomiasis is transmitted to humans by triatomine bugs through the ingestion of contaminated food, by blood transfusions or accidently in ...

Purification of Extracellular Trypanosomes, Including African, from Blood by Anion-Exchangers (Diethylaminoethyl-cellulose Columns)

This method allows the separation of trypanosomes, parasites responsible for animal and human African trypanosomiasis (HAT), from infected blood. This is the best method for diagnosis of first stage HAT and furthermore this parasite purification method permits serological and research investigations.
HAT is caused by Tsetse fly transmitted Trypanosoma brucei gambiense and T. b. rhodesiense. Related trypanosomes are the causative agents of animal trypanosomiasis. Trypanosome detection is essential for HAT diagnosis, treatment and follow-up. The technique described here is the most sensitive parasite detection technique, adapted to field conditions for the diagnosis of T. b. gambiense HAT and can be completed within one hour. Blood is layered onto an anion-exchanger column (DEAE cellulose) previously adjusted to pH 8, and elution buffer is added. Highly negatively charged blood cells are adsorbed onto the column whereas the less negatively charged trypanosomes pass through. Collected trypanosomes are pelleted by centrifugation and observed by microscopy. Moreover, parasites are prepared without cellular damage whilst maintaining their infectivity.
Purified trypanosomes are required for immunological testing; they are used in the trypanolysis assay, the gold standard in HAT serology. Stained parasites are utilized in the card agglutination test (CATT) for field serology. Antigens from purified trypanosomes, such as variant surface glycoprotein, exoantigens, are also used in various immunoassays. The procedure described here is designed for African trypanosomes; consequently, chromatography conditions have to be adapted to each trypanosome strain, and more generally, to the blood of each species of host mammal.
These fascinating pathogens are easily purified and available to use in biochemical, molecular and cell biology studies including co-culture with host cells to investigate host-parasite relationships at the level of membrane receptors, signaling, and gene expression; drug testing in vitro; investigation of gene deletion, mutation, or overexpression on metabolic processes, cytoskeletal biogenesis and parasite survival.

Purification of Extracellular Trypanosomes, Including African, from Blood by Anion-Exchangers Diethylaminoethyl-cellulose Columns

This method of trypanosome separation from blood depends on their surface charge being less negative than mammalian blood cells. Infected blood is placed and treated on an anion-exchanger column. This method, the most fitting diagnostic for African trypanosomiasis, provides purified parasites for immunological, biological, biochemical, pharmaceutical and molecular biology investigations.

This method allows the separation of trypanosomes, parasites responsible for animal and human African trypanosomiasis (HAT), from infected blood. This is ...

AI Program for Trypanosomiasis Detection and Classification

Superior Auto-Identification of Trypanosome Parasites by Using a Hybrid Deep-Learning Model

Trypanosomiasis is a significant public health problem in several regions across the world, including South Asia and Southeast Asia. The identification of hotspot areas under active surveillance is a fundamental procedure for controlling disease transmission. Microscopic examination is a commonly used diagnostic method. It is, nevertheless, primarily reliant on skilled and experienced personnel. To address this issue, an artificial intelligence (AI) program was introduced that makes use of a hybrid deep learning technique of object identification and object classification neural network backbones on the in-house low-code AI platform (CiRA CORE). The program can identify and classify the protozoan trypanosome species, namely Trypanosoma cruzi, T. brucei, and T. evansi, from oil-immersion microscopic images. The AI program utilizes pattern recognition to observe and analyze multiple protozoa within a single blood sample and highlights the nucleus and kinetoplast of each parasite as specific characteristic features using an attention map.
To assess the AI program&#39;s performance, two unique modules are created that provide a variety of statistical measures such as accuracy, recall, specificity, precision, F1 score, misclassification rate, receiver operating characteristics (ROC) curves, and precision versus recall (PR) curves. The assessment findings show that the AI algorithm is effective at identifying and categorizing parasites. By delivering a speedy, automated, and accurate screening tool, this technology has the potential to transform disease surveillance and control. It could also assist local officials in making more informed decisions on disease transmission-blocking strategies.

Author Spotlight: AI-Driven Trypanosome Species Detection from Microscopic Images 

Worldwide medical blood parasites were automatically screened using simple steps on a low-code AI platform. The prospective diagnosis of blood films was improved by using an object detection and classification method in a hybrid deep learning model. The collaboration of active monitoring and well-trained models helps to identify hotspots of trypanosome transmission.

Trypanosomiasis is a significant public health problem in several regions across the world, including South Asia and Southeast Asia. The identification of ...

Bioengineering

Quantitative 3D Imaging of Trypanosoma cruzi-Infected Cells, Dormant Amastigotes, and T Cells in Intact Clarified Organs

Chagas disease is a neglected pathology that affects millions of people worldwide, mainly in Latin America. The Chagas disease agent, Trypanosoma cruzi (T. cruzi), is an obligate intracellular parasite with a diverse biology that infects several mammalian species, including humans, causing cardiac and digestive pathologies. Reliable detection of T. cruzi in vivo infections has long been needed to understand Chagas disease&#39;s complex biology and accurately evaluate the outcome of treatment regimens. The current protocol demonstrates an integrated pipeline for automated quantification of T. cruzi-infected cells in 3D-reconstructed, cleared organs. Light-sheet fluorescent microscopy allows for accurately visualizing and quantifying of actively proliferating and dormant T. cruzi parasites and immune effector cells in whole organs or tissues. Also, the CUBIC-HistoVision pipeline to obtain uniform labeling of cleared organs with antibodies and nuclear stains was successfully adopted. Tissue clearing coupled with 3D immunostaining provides an unbiased approach to comprehensively evaluate drug treatment protocols, improve the understanding of the cellular organization of T. cruzi-infected tissues, and is expected to advance discoveries related to anti-T. cruzi immune responses, tissue damage, and repair in Chagas disease.

Quantitative 3D Imaging of Trypanosoma cruzi-Infected Cells, Dormant Amastigotes, and T Cells in Intact Clarified Organs

The present protocol describes light-sheet fluorescent microscopy and automated software-assisted methods to visualize and precisely quantify proliferating and dormant Trypanosoma cruzi parasites and T cells in intact, cleared organs and tissues. These techniques provide a reliable way to evaluate treatment outcomes and offer new insights into parasite-host interactions.

Chagas disease is a neglected pathology that affects millions of people worldwide, mainly in Latin America. The Chagas disease agent, Trypanosoma cruzi ...

Development of pHluorin2-Based Sensor for Glycosomal pH in Trypanosoma brucei

Measuring Dynamic Glycosomal pH Changes in Living Trypanosoma brucei

Glucose metabolism is critical for the African trypanosome, Trypanosoma brucei, as an essential metabolic process and regulator of parasite development. Little is known about the cellular responses generated when environmental glucose levels change. In both bloodstream and procyclic form (insect stage) parasites, glycosomes house most of glycolysis. These organelles are rapidly acidified in response to glucose deprivation, which likely results in the allosteric regulation of glycolytic enzymes such as hexokinase. In previous work, localizing the chemical probe used to make pH measurements was challenging, limiting its utility in other applications.
This paper describes the development and use of parasites that express glycosomally localized pHluorin2, a heritable protein pH biosensor. pHluorin2 is a ratiometric pHluorin variant that displays a pH (acid)-dependent decrease in excitation at 395 nm while simultaneously yielding an increase in excitation at 475 nm. Transgenic parasites were generated by cloning the pHluorin2 open reading frame into the trypanosome expression vector pLEW100v5, enabling inducible protein expression in either lifecycle stage. Immunofluorescence was used to confirm the glycosomal localization of the pHluorin2 biosensor, comparing the localization of the biosensor to the glycosomal resident protein aldolase. The sensor responsiveness was calibrated at differing pH levels by incubating cells in a series of buffers that ranged in pH from 4 to 8, an approach we have previously used to calibrate a fluorescein-based pH sensor. We then measured pHluorin2 fluorescence at 405 nm and 488 nm using flow cytometry to determine glycosomal pH. We validated the performance of the live transgenic pHluorin2-expressing parasites, monitoring pH over time in response to glucose deprivation, a known trigger of glycosomal acidification in PF parasites. This tool has a range of potential applications, including potentially being used in high-throughput drug screening. Beyond glycosomal pH, the sensor could be adapted to other organelles or used in other trypanosomatids to understand pH dynamics&#160;in the live cell setting.

Author Spotlight: Advancements in Glycosomal pH Monitoring in Trypanosoma brucei Using pHluorin2 Biosensor

We describe a method to study how pH responds to environmental cues in the glycosomes of the bloodstream form of African trypanosomes. This approach involves a pH-sensitive heritable protein sensor in combination with flow cytometry to measure pH dynamics, both as a time-course assay and in a high-throughput screen format.

Glucose metabolism is critical for the African trypanosome, Trypanosoma brucei, as an essential metabolic process and regulator of parasite development. ...

In Vivo Bioluminescent Model of Chagas Disease for Drug Evaluation

Demystifying In Vivo Bioluminescence Imaging of a Chagas Disease Mouse Model for Drug Efficacy Studies

To control and decrease the public health impact of human protozoan diseases such as Chagas disease, leishmaniasis, and human African trypanosomiasis, expediting the development of new drugs and vaccines is necessary. However, this process is filled with difficulties such as highly complex parasite biology and disease pathogenesis and, as typical for neglected tropical diseases, comparatively limited funding for research and development. Thus, in vitro and in vivo study models that can sufficiently reproduce infection and disease key features while providing rational use of resources are essential for progressing research for these conditions. One example is the in vivo bioluminescence imaging (BLI) mouse model for Chagas disease, which provides highly sensitive detection of long wavelength light generated by Trypanosoma cruzi parasites expressing luciferase. Despite this technique becoming the standard approach for drug efficacy in vivo studies, research groups might still struggle to implement it due to a lack of proper practical training on equipment handling and application of quality control procedures, even when suitable BLI equipment is readily available. Considering this scenario, this protocol aims to guide from planning experiments to data acquisition and analysis, with details that facilitate the implementation of protocols in research groups with little or no experience with BLI, either for Chagas disease or for other infectious disease mouse models.

Author Spotlight: Real-Time Monitoring of Parasite Burden and Host Response

The protocol provided here describes the detailed steps to perform drug efficacy studies in a bioluminescent model of Trypanosoma cruzi infection, with a focus on data acquisition, analysis, and interpretation. Troubleshooting and quality control procedures to minimize technical issues are also provided.

To control and decrease the public health impact of human protozoan diseases such as Chagas disease, leishmaniasis, and human African trypanosomiasis, ...

Chemical Cartography Approaches to Study Trypanosomatid Infection

Samenvatting

Meer video's verkennen