Laura-Isobel McCall, PhD, holds an Investigators&#160;in the Pathogenesis of Infectious Disease Award from the Burroughs Wellcome Fund. The authors further wish to acknowledge support from NIH award number R21AI148886, a pilot grant from the Oklahoma Center for Respiratory and Infectious Diseases (OCRID) under NIH award number P20GM103648, and start-up funds from the University of Oklahoma (to LIM). The content is solely the authors&#39; responsibility and does not necessarily represent the official views of the funders. The authors also wish to thank the developers of the tools used in this protocol. All relevant publications have been cited, where applicable.

No conflicts of interest to report.

Understanding trypanosomatid infections is essential to guide novel drug development and treatment approaches. This chemical cartography method is uniquely poised to provide actionable insights into the relationship between metabolism and trypanosomatid disease pathogenesis, thus addressing this translational need.
Only LC-MS grade solvents are recommended during metabolite extraction and MS analyses, to lessen background contamination. Polymeric contamination35, commonly derived from paraffin film and/or other plastics36,37,38, must be avoided where possible. Parafilm, in particular, must never be used. These aspects are crucial since LC-MS data quality depends on the materials used during sample preparation and metabolite extraction. Data quality should be ensured before generating &#39;ili plots. In addition, generating these comprehensive spatial metabolomics maps requires the collection of all adjacent tissue samples and metabolite extraction from all collected samples to avoid gaps in these maps. Collection procedures, logistics of metabolite extraction and LC-MS analysis, and costs should thus be considered and planned accordingly.
This protocol can be modified to meet user needs in multiple ways. For example, the polarity and solubility of solvents used during metabolite extraction will influence what metabolites are detected39. To maximize the diversity of detected metabolite features for untargeted chemical cartography analyses, combining multiple extraction steps and solvents is recommended. For example, this method utilizes dichloromethane, methanol, and water as extraction solvents because they enable accurate detection of nonpolar and polar molecules20,40. However, these solvents are not universally suitable for every MS experiment, and researchers should select extraction solvents based on the goals of their project. Likewise, different LC-MS/MS conditions can be used, such as replacing reversed-phase chromatography with normal phase chromatography. Alternative columns can also be used for reversed-phase data collection instead of C8 chromatography, though empirically, C8 chromatography is more robust to tissue lipids and has a lower clogging frequency. Conceptually, these protocols can also be applied to other mass spectrometry methods such as gas chromatography-mass spectrometry, etc.
An alternative approach is mass spectrometry imaging. Indeed, unlike mass spectrometry imaging approaches, liquid chromatography-mass spectrometry does not inherently preserve spatial information10. Chemical cartography approaches bridge this gap by including sampling location at the time of project conceptualization, in the sample metadata, and at data processing steps. A strength of this chemical cartography approach, unlike mass spectrometry imaging, is the ability to provide confident annotations (Metabolomics Standards Initiative level 1 or level 2 annotation confidence41), unlike mass spectrometry imaging where the bulk of applications rely on accurate mass only for annotation. Mass spectrometry imaging will enable fine-grained spatial mapping, sometimes down to the single-cell level, e.g.,42,43. In contrast, chemical cartography approaches enable large-scale cross-organ mapping of metabolite distribution without requiring highly specialized whole-animal cryosectioning skills. Chemical cartography provides complementary evidence to the many spatial transcriptomic approaches being developed, e.g.,44, with the advantage of focusing on the &#39;omics layer closest to the phenotype&#39;45. Alternative methods for parasite load quantification include measuring bioluminescence at the time of sample collection6. Fine segments could also be collected to enable confocal or electron microscopy to assess localized parasite burden and tissue damage. The water homogenate, which is used for cytokine quantification in this protocol and prior publications13, could also be used to quantify protein-based markers of tissue damage.
There are also multiple ways to obtain 3D models suitable to plot the resulting LC-MS data. In addition to the method suggested here, models can be purchased pre-made from various online vendors. Ensure that the terms of use match with the intended usage, especially concerning publication. Models for large organs can be generated de novo using 3D scanners according to scanner instructions. Alternatives such as MATLAB exist for generating and visualizing 3D models for chemical cartography46, but they were primarily implemented before the development of &#39;ili16. MATLAB is a data analysis and programming tool suite offering a wide variety of applications across many fields. However, MATLAB is neither free nor open-source, and it requires familiarity with MATLAB interfaces, especially considering MATLAB was not developed for processing mass spectrometry data. This proposed method&#39;s alternatives, namely, SketchUp, Meshlab, and &#39;ili, are freely accessible, user-friendly, and offer similar functions as MATLAB for chemical cartography purposes.
This method is robust concerning sample preparation and metabolite extraction. Troubleshooting is most often necessary at the LC-MS data acquisition step. This is beyond the scope of this article. Readers are directed to excellent publications on LC-MS data acquisition troubleshooting, including20,47. Likewise, the complexities of metabolite annotation are beyond the scope of this method&#39;s focus on 3D model generation. Useful references on this topic include24,25,48,49.
While this method effectively explores disease pathogenesis, there are limitations to this approach, some of which are common across any metabolomics experiment. One such limitation is the low annotation rate of LC-MS features50, which is contingent upon reference spectral libraries&#39; availability and quality. A further limitation is that this protocol does not preserve mRNA due to the incompatibility of RNA preservation reagents such as RNAlater with LC-MS/MS analysis. However, the protein quality is adequate for downstream analyses and thus can replace mRNA-based analyses.
A chemical cartography approach to infection pathogenesis directly reflects how bacterial, viral, or parasitic infections develop in organ systems and cause localized disease. Analyzing these regional subsamples and generating 3D models ultimately conveys how metabolites function across three-dimensional space, shedding light on these previously unrecognized spatial dimensions of molecular biology. Using this protocol, for example, metabolite localization was compared to Trypanosoma cruzi parasite load. Results clarified the relationship between the pathogen and host tissue and also demonstrated the metabolic dynamics of Chagas disease symptom progression6. Chemical cartography methods have also been applied to various topics, such as human-built environment interaction51,52,53, the chemical makeup of organ systems like human skin46 and lungs54, and plant metabolism and environment interactions55. Future applications can involve assessing localized disease tolerance and resilience, or the relationship between local metabolite levels, pathogen tropism, and disease tropism in models beyond trypanosomatid infection. This approach should also have broad applicability to expand current pharmacokinetics protocols, to assess the relationship between local tissue drug levels and drug metabolism vs. overall metabolic context, tissue damage, and pathogen clearance. Overall, chemical cartography allows unique explorations of metabolite distributions in various sample types, with applications&#160;including disease pathogenesis, human health, human-environment interactions, and microbial dynamics.

Trypanosomatid parasites consist of Leishmania species, African trypanosomes (Trypanosoma brucei), and American trypanosomes (Trypanosoma cruzi). Leishmania protozoa cause leishmaniasis, which includes self-healing and self-limited localized cutaneous leishmaniasis, mucocutaneous leishmaniasis in which the mucosal tissues of the mouth, nose, and throat become damaged, and visceral leishmaniasis with parasite tropism to the visceral organs causing fever and hepatosplenomegaly1,2. T. brucei causes Human African trypanosomiasis (HAT), also known as sleeping sickness, mainly reported in African countries3. The clinical signs and symptoms include hepatosplenomegaly, fever, headache, musculoskeletal pains, lymphadenopathies, and anemia in the hemo-lymphatic stage when parasites localize to the bloodstream and lymphatics. This is followed by the meningo-encephalitic stage, where parasites localize to the central nervous system and cause sleep disturbance, behavioral alteration, and eventually fatal comas4. T. cruzi causes Chagas disease, endemic in the Americas. Infected individuals experience an initial acute stage, usually asymptomatic, with broad parasite tropism. About 10%-30% of infected individuals experience chronic stage symptoms after decades of infection, characterized by megaoesophagus, megacolon, and cardiovascular complications5,6.
Metabolomics studies small molecular species (50-1,500 Da), including biological compounds from primary or secondary metabolism and externally-derived compounds such as drugs or food-derived molecules. In the context of host-pathogen interactions, metabolomics can explore the impact of infection on host metabolite environments, crucial in accessing the effect of the pathogen on the host. It can also assess pathogen adaptations to the host nutritional and immunological environment7,8,9. Mass spectrometry (MS) and nuclear magnetic resonance (NMR) spectroscopy are common metabolomics tools used to identify, quantify, and characterize metabolites. This &#34;omics&#34; approach can also be applied to biomarker discovery and drug development10,11.
Given the specific tissue tropism of trypanosomatid parasites, spatial metabolomics analyses can enable significant insight into the pathogenesis of the diseases they cause. Mapping the spatial distribution of metabolites revealed metabolites locally affected by chronic Trypanosoma cruzi infection in mouse heart tissue and acute and long-term Trypanosoma cruzi infection in the mouse gastrointestinal tract6,12,13. Specifically, 3D chemical cartography demonstrated a disconnect between parasite persistence and metabolic alterations in the heart tissue of chronically Trypanosoma cruzi-infected mice. Metabolism was most perturbed in lower and apical segments of the heart, matching with sites of Chagas disease symptoms (cardiac apical aneurysms). Metabolite families perturbed by infection at specific cardiac sites and correlated to disease severity include acylcarnitines and glycerophosphocholines12,13,14. In the gastrointestinal tract, persistent metabolic alterations concurred with sites of Chagas disease symptoms: esophagus and colon. In contrast, metabolism is re-normalized at sites not associated with Chagas disease symptoms, such as the small intestine. Metabolites locally perturbed by infection in the gastrointestinal tract include acylcarnitines, glycerophosphocholines, kynurenine, tryptophan, and cholic acid. In addition, these analyses enabled the identification of a new metabolic mechanism of tolerance to Chagas disease6. Applying these methods to the study of cutaneous leishmaniasis revealed significant metabolic perturbations at the site of the lesion, but also specific metabolic changes in lesion-adjacent, macroscopically healthy tissue. For example, glutamine was depleted at the lesion site, whereas glycerophosphocholines in the m/z (mass to charge ratio) 200-299, 400-499, 500-599, and 600-699 were significantly increased at the lesion site. PC (O-34:1) was only increased at lesion-adjacent sites15.
The goal of this manuscript is to demonstrate the steps necessary to generate 3D models of metabolite distribution (&#34;chemical cartography&#34;) as applied to trypanosomatid parasite infection models (Figure 1). This approach builds on several critical advances in the context of metabolomics and metabolomics data processing, particularly the development of &#39;ili software to plot metabolomics data onto 3D models easily16.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>1.5 mL Eppendorf tubes</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>1 L bottle, pyrex</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>1 L graduated cylinder, pyrex</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>2 mL SafeLock Eppendorf tubes</td>
			<td>VWR</td>
			<td>20901-540</td>
			<td>use the appropriate tube model for the available tissue homogenizer</td>
		</tr>
		<tr>
			<td>3D model (de-novo generated according to protocol steps, or purchased)</td>
			<td>NA</td>
			<td>NA</td>
			<td>as appropriate for system under investigation</td>
		</tr>
		<tr>
			<td>5 mm stainless steel bead</td>
			<td>Qiagen</td>
			<td>69989</td>
			<td></td>
		</tr>
		<tr>
			<td>96 well plate</td>
			<td>Fisher</td>
			<td>3252449</td>
			<td></td>
		</tr>
		<tr>
			<td>AATTCCTCCAAGCAGCGGATA primer</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available; published in Piron, M. et al. Development of a real-time PCR assay for Trypanosoma cruzi detection in blood samples. Acta tropica. 103 (3), 195&#8211;200 (2007).</td>
		</tr>
		<tr>
			<td>analytical balance</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>ASTCGGCTGATCGTTTTCGA primer</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available; published in Piron, M. et al. Development of a real-time PCR assay for Trypanosoma cruzi detection in blood samples. Acta tropica. 103 (3), 195&#8211;200 (2007).</td>
		</tr>
		<tr>
			<td>benchtop centrifuge with microcentrifuge, falcon tube and 96-well-plate capacity</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>biosafety cabinet</td>
			<td>NA</td>
			<td>NA</td>
			<td>class II, type A2; any brand, as available</td>
		</tr>
		<tr>
			<td>CAGCAAGCATCTATGCACTTAG 
			ACCCC primer</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available; published in Cummings, K.L., Tarleton, R.L. Rapid quantitation of Trypanosoma cruzi in host tissue by real-time PCR. Molecular and biochemical parasitology. 129 (1), 53&#8211;59 (2003).</td>
		</tr>
		<tr>
			<td>camera</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available. A cellphone camera is adequate for this protocol</td>
		</tr>
		<tr>
			<td>chemiluminescent-capable imaging system</td>
			<td>NA</td>
			<td>NA</td>
			<td>any system, as available</td>
		</tr>
		<tr>
			<td>cotton balls</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>cryogloves</td>
			<td>VWR</td>
			<td>97008-208</td>
			<td>replace with any brand, as available</td>
		</tr>
		<tr>
			<td>dissection scissors</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>dry ice</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>extra-length forceps</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>flammable-grade refrigerator</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>freezer storage boxes for microcentrifuge tubes</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>fume hood</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>high-resolution mass spectrometer</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available, such as ThermoFisher Q-Exactive Plus (catalog number 0726030)</td>
		</tr>
		<tr>
			<td>ice bucket</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>ili software</td>
			<td>ili.embl.de</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>isoflurane</td>
			<td>Covetrus</td>
			<td>29405</td>
			<td></td>
		</tr>
		<tr>
			<td>large tupperware</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available; large enough to comfortably contain mouse, cotton ball</td>
		</tr>
		<tr>
			<td>LC-MS grade acetonitrile</td>
			<td>Fisher Optima</td>
			<td>A955-4</td>
			<td></td>
		</tr>
		<tr>
			<td>LC-MS grade dicholoromethane</td>
			<td>Fisher Optima</td>
			<td>D151-4</td>
			<td></td>
		</tr>
		<tr>
			<td>LC-MS grade formic acid</td>
			<td>Fisher Optima</td>
			<td>A11750</td>
			<td></td>
		</tr>
		<tr>
			<td>LC-MS grade methanol</td>
			<td>Fisher Optima</td>
			<td>A456-4</td>
			<td></td>
		</tr>
		<tr>
			<td>LC-MS grade water</td>
			<td>Fisher Optima</td>
			<td>W64</td>
			<td></td>
		</tr>
		<tr>
			<td>liquid chromatography column</td>
			<td>Phenomenex</td>
			<td>00B-4499-AN</td>
			<td>may be changed to other brands and models as appropriate for the metabolites of interest</td>
		</tr>
		<tr>
			<td>liquid chromatography column guard cartridge</td>
			<td>Phenomenex</td>
			<td>AJ0-8784</td>
			<td>may be changed to other brands and models as appropriate for the metabolites of interest</td>
		</tr>
		<tr>
			<td>liquid chromatography column guard cartridge holder</td>
			<td>Phenomenex</td>
			<td>AJ0-9000</td>
			<td>may be changed to other brands and models as appropriate for the metabolites of interest</td>
		</tr>
		<tr>
			<td>liquid nitrogen</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>luciferin</td>
			<td>Goldbio</td>
			<td>LUCK-1G</td>
			<td></td>
		</tr>
		<tr>
			<td>MeshLab software</td>
			<td>https://www.meshlab.net/</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Meshmixer software</td>
			<td>https://www.meshmixer.com/</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>MS calibrant</td>
			<td>NA</td>
			<td>NA</td>
			<td>appropriate one for available instrument</td>
		</tr>
		<tr>
			<td>MS data processing software</td>
			<td>NA</td>
			<td>NA</td>
			<td>multiple options available; authors recommend MZmine</td>
		</tr>
		<tr>
			<td>MSConvert software</td>
			<td>http://proteowizard.sourceforge.net/</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Nanodrop</td>
			<td>ThermoFisher</td>
			<td>ND-ONE-W</td>
			<td>other nanodrop models are also suitable</td>
		</tr>
		<tr>
			<td>p1000 pipet tips</td>
			<td>NA</td>
			<td>NA</td>
			<td>use the appropriate brand to fit available pipettors</td>
		</tr>
		<tr>
			<td>p1000 pipettor</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>p20 pipette tips</td>
			<td>NA</td>
			<td>NA</td>
			<td>use the appropriate brand to fit available pipettors</td>
		</tr>
		<tr>
			<td>p20 pipettor</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>p200 pipette tips</td>
			<td>NA</td>
			<td>NA</td>
			<td>use the appropriate brand to fit available pipettors</td>
		</tr>
		<tr>
			<td>p200 pipettor</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>personal protective equipment (gloves, lab coat, safety glasses/goggles; faceshield)</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>Q-Plex Mouse Cytokine - Screen (16-Plex)</td>
			<td>Quansys biosciences</td>
			<td>110949MS</td>
			<td>can replace with other protein-based cytokine assays such as other commercial cytokine ELISA kits</td>
		</tr>
		<tr>
			<td>Quick-DNA Miniprep Plus Kit (200 preps)</td>
			<td>Zymo</td>
			<td>D4069</td>
			<td>replace with any brand of mammalian DNA extraction kit, as available</td>
		</tr>
		<tr>
			<td>real-time thermocycler</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>salt shaker or tea infuser</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand; to contain isoflurane-soaked cotton ball and prevent contact with mouse skin</td>
		</tr>
		<tr>
			<td>SketchUp software</td>
			<td>https://www.sketchup.com/</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>specimen forceps</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>speedvac with microcentrifuge tube and 96-well-plate capacity</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>spreadsheet software</td>
			<td>https://www.microsoft.com/en-us/microsoft-365/excel</td>
			<td>NA</td>
			<td>can replace with other spreadsheet management software, as applicable</td>
		</tr>
		<tr>
			<td>sulfachloropyridazine</td>
			<td>Sigma</td>
			<td>S9882-100G</td>
			<td></td>
		</tr>
		<tr>
			<td>sulfadimethoxine</td>
			<td>Sigma</td>
			<td>S7007-10G</td>
			<td></td>
		</tr>
		<tr>
			<td>Sybr green qPCR reaction mix</td>
			<td>Fisher</td>
			<td>A25780</td>
			<td>can replace with other Sybr green qPCR reaction mixes, as desired</td>
		</tr>
		<tr>
			<td>TCCCTCTCATCAGTTCTAT 
			GGCCCA primer</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available; published in Cummings, K.L., Tarleton, R.L. Rapid quantitation of Trypanosoma cruzi in host tissue by real-time PCR. Molecular and biochemical parasitology. 129 (1), 53&#8211;59 (2003).</td>
		</tr>
		<tr>
			<td>tissue homogenizer</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available; for example, Qiagen TissueLyser II, catalog number 85300, with TissueLyser Adapter Set (2 x 24), catalog number 69982</td>
		</tr>
		<tr>
			<td>tissue samples</td>
			<td>NA</td>
			<td>NA</td>
			<td>from appropriate infection model</td>
		</tr>
		<tr>
			<td>TissueLyser single-bead dispenser</td>
			<td>Qiagen</td>
			<td>69965</td>
			<td></td>
		</tr>
		<tr>
			<td>UHPLC</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available, such as ThermoFisher Vanquish (catalog number IQLAAAGABHFAPUMBHV)</td>
		</tr>
		<tr>
			<td>ultra-low temperature freezer (-80)</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>ultrasonic bath</td>
			<td>NA</td>
			<td>NA</td>
			<td>any system, as available</td>
		</tr>
		<tr>
			<td>wet ice</td>
			<td>NA</td>
			<td>NA</td>
			<td>any brand, as available</td>
		</tr>
		<tr>
			<td>zone-free sealing film</td>
			<td>VWR</td>
			<td>&#160;490007-390</td>
			<td></td>
		</tr>
	</tbody>
</table>

chemical cartography approaches to study trypanosomatid infection

Pathogen tropism and disease tropism refer to the tissue locations selectively colonized or damaged by pathogens, leading to localized disease symptoms. Human-infective trypanosomatid parasites include Trypanosoma cruzi, the causative agent of Chagas disease; Trypanosoma brucei, the&#160;causative agent of sleeping sickness; and Leishmania species, causative agents of leishmaniasis. Jointly, they affect 20 million people across the globe. These parasites show specific tropism: heart, esophagus, colon for T. cruzi, adipose tissue, pancreas, skin, circulatory system and central nervous system for T. brucei, skin for dermotropic Leishmania strains, and liver, spleen, and bone marrow for viscerotropic Leishmania strains. A spatial perspective is therefore essential to understand trypanosomatid disease pathogenesis. Chemical cartography generates 3D visualizations of small molecule abundance generated via liquid chromatography-mass spectrometry, in comparison to microbiological and immunological parameters. This protocol demonstrates how chemical cartography can be applied to study pathogenic processes during trypanosomatid infection, beginning from systematic tissue sampling and metabolite extraction, followed by liquid chromatography-tandem mass spectrometry data acquisition, and concluding with the generation of 3D maps of metabolite distribution. This method can be used for multiple research questions, such as nutrient requirements for tissue colonization by T. cruzi, T. brucei, or Leishmania, immunometabolism at sites of infection, and the relationship between local tissue metabolic perturbation and clinical disease symptoms, leading to comprehensive insight into trypanosomatid disease pathogenesis.

The number of metabolite features obtained depends on the tissue type analyzed and data processing parameters. For example, this protocol has been&#160;used to analyze the spatial impact of T. cruzi infection on the gastrointestinal tract metabolome in a mouse model of T. cruzi infection. In prior work, male C3H/HeJ were injected intraperitoneally with 1,000 CL + luc T. cruzi parasites32,6. Animals were euthanized 12 or 89 days post-infection, and a chemical cartography analysis of 13 contiguous segments of the gastrointestinal tract was performed as described in this protocol. This analysis led to a feature table of 5,502 features, which were then visualized into 3D using the steps described in this protocol. This approach enables the visualization of metabolite features in individual animals that are high at the site of high parasite load (kynurenine, Figure 2B vs. parasite load, Figure 2A), of metabolites with differential distribution across tissue regions (glutamine, Figure 2C) and metabolite features that are found at comparable levels across small and large intestines (LPE 16:0 Figure 2D). Kynurenine was selected for visualization because of its known relationship to inflammation and prior publications on the ability of kynurenine-derived metabolites to regulate&#160;T. cruzi load33. Random forest-based machine learning models had previously revealed an association between kynurenine levels and infection status6. Glutamine was selected for a visualization based on previous publications demonstrating a relationship between in vitro glutamine availability and T. cruzi drug sensitivity34. Differential distribution was confirmed using logistic regression, p &#60; 0.05. LPE 16:0 was selected after visual inspection of the data to discover metabolite features found at comparable levels across tissue sites.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/63255/63255fig01.jpg" /> 
Figure 1: Protocol overview. The illustration was created with BioRender.com. <a href="https://www.jove.com/files/ftp_upload/63255/63255fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/63255/63255fig02.jpg" /> 
Figure 2: Chemical cartography analysis. Male C3H/HeJ mice were injected intraperitoneally with 1,000 CL+luc T. cruzi parasites32. Animals were euthanized 12 or 89 days post-infection, and the gastrointestinal tract was collected and sectioned systematically (step 1)6. Metabolites were extracted as in step 2 and analyzed by LC-MS/MS. 3D model generation was performed using the SketchUp software (step 5), and data were plotted in 3D as in step 6. (A) Parasite distribution in a specific mouse, 12 days post-infection. (B) Kynurenine metabolite distribution in the same mouse, 12 days post-infection. (C) Mean glutamine distribution across infected mice, 89 days post-infection. (D) Comparable levels of m/z 454.292 retention time 2.929 min, annotated as 2-hexadecanoyl-sn-glycero-3-phosphoethanolamine (LPE 16:0), in the same mouse as in A and B in the small intestine and colon. Samples and data were generated in6. <a href="https://www.jove.com/files/ftp_upload/63255/63255fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Chemical Cartography Approaches to Study Trypanosomatid Infection at JoVE.com

Chemical Cartography Approaches to Study Trypanosomatid Infection

This protocol describes the steps to generate a 3D model of metabolite distribution during trypanosomatid infection, including sample collection, metabolite extraction, an overview of liquid chromatography-tandem mass spectrometry data acquisition, 3D model generation, and finally, data visualization.

Pathogen tropism and disease tropism refer to the tissue locations selectively colonized or damaged by pathogens, leading to localized disease symptoms. ...

chemical-cartography-approaches-to-study-trypanosomatid-infection

Research

JoVE Journal

Immunology and Infection

2.2K Views.  University of Oklahoma, Norman. This protocol describes the steps to generate a 3D model of metabolite distribution during trypanosomatid infection, including sample collection, metabolite extraction, an overview of liquid chromatography-tandem mass spectrometry data acquisition, 3D model generation, and finally, data visualization.

Video: Chemical Cartography Approaches to Study Trypanosomatid Infection

Neutrophil Extracellular Traps: How to Generate and Visualize Them

Neutrophil granulocytes are the most abundant group of leukocytes in the peripheral blood. As professional phagocytes, they engulf bacteria and kill them intracellularly when their antimicrobial granules fuse with the phagosome. We found that neutrophils have an additional way of killing microorganisms: upon activation, they release granule proteins and chromatin that together form extracellular fibers that bind pathogens. These novel structures, or Neutrophil Extracellular Traps (NETs), degrade virulence factors and kill bacteria1, fungi2 and parasites3. The structural backbone of NETs is DNA, and they are quickly degraded in the presence of DNases. Thus, bacteria expressing DNases are more virulent4. Using correlative microscopy combining TEM, SEM, immunofluorescence and live cell imaging techniques, we could show that upon stimulation, the nuclei of neutrophils lose their shape and the eu- and heterochromatin homogenize. Later, the nuclear envelope and the granule membranes disintegrate allowing the mixing of NET components. Finally, the NETs are released as the cell membrane breaks. This cell death program (NETosis) is distinct from apoptosis and necrosis and depends on the generation of Reactive Oxygen Species by NADPH oxidase5. 
Neutrophil extracellular traps are abundant at sites of acute inflammation. NETs appear to be a form of innate immune response that bind microorganisms, prevent them from spreading, and ensure a high local concentration of antimicrobial agents to degrade virulence factors and kill pathogens thus allowing neutrophils to fulfill their antimicrobial function even beyond their life span. There is increasing evidence, however, that NETs are also involved in diseases that range from auto-immune syndromes to infertility6.
We describe methods to isolate Neutrophil Granulocytes from peripheral human blood7 and stimulate them to form NETs. Also we include protocols to visualize the NETs in light and electron microscopy.

Neutrophil Extracellular Traps (NETs) are an important innate immune mechanism to fight pathogenic bacteria, fungi and parasites. Here we describe methods to isolate neutrophil granulocytes from human blood and to activate them to form NETs. We present preparation techniques to visualize NETs in light and electron microscopy.

Neutrophil granulocytes are the most abundant group of leukocytes in the peripheral blood. As professional phagocytes, they engulf bacteria and kill them ...

Introducing Shear Stress in the Study of Bacterial Adhesion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the initial and determining step of the pathogenesis. Although experimentally adhesion is mostly studied in static conditions adhesion actually takes place in the presence of flowing liquid. First encounters between bacteria and their host often occur at the mucosal level, mouth, lung, gut, eye, etc. where mucus flows along the surface of epithelial cells. Later in infection, pathogens occasionally access the blood circulation causing life-threatening illnesses such as septicemia, sepsis and meningitis. A defining feature of these infections is the ability of these pathogens to interact with endothelial cells in presence of circulating blood. The presence of flowing liquid, mucus or blood for instance, determines adhesion because it generates a mechanical force on the pathogen. To characterize the effect of flowing liquid one usually refers to the notion of shear stress, which is the tangential force exerted per unit area by a fluid moving near a stationary wall, expressed in dynes/cm2. Intensities of shear stress vary widely according to the different vessels type, size, organ, location etc. (0-100 dynes/cm2). Circulation in capillaries can reach very low shear stress values and even temporarily stop during periods ranging between a few seconds to several minutes 1. On the other end of the spectrum shear stress in arterioles can reach 100 dynes/cm2 2. The impact of shear stress on different biological processes has been clearly demonstrated as for instance during the interaction of leukocytes with the endothelium 3. To take into account this mechanical parameter in the process of bacterial adhesion we took advantage of an experimental procedure based on the use of a disposable flow chamber 4. Host cells are grown in the flow chamber and fluorescent bacteria are introduced in the flow controlled by a syringe pump. We initially focused our investigations on the bacterial pathogen Neisseria meningitidis, a Gram-negative bacterium responsible for septicemia and meningitis. The procedure described here allowed us to study the impact of shear stress on the ability of the bacteria to: adhere to cells 1, to proliferate on the cell surface 5and to detach to colonize new sites 6 (Figure 1). Complementary technical information can be found in reference 7. Shear stress values presented here were chosen based on our previous experience1 and to represent values found in the literature. The protocol should be applicable to a wide range of pathogens with specific adjustments depending on the objectives of the study.

During the infection process, a key step is the adhesion of pathogens with host cells. In most instances this adhesion step occurs in the presence of mechanical stress generated by flowing liquid. We describe a technique that introduces shear stress as an important parameter in the study of bacterial adhesion.

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the ...

Forward Genetic Approaches in Chlamydia trachomatis

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its intractability to experimental transformation with recombinant DNA. We developed an approach to perform genetic analysis in C. trachomatis&#160;despite the lack of molecular genetic tools. Our method involves: i.) chemical mutagenesis to rapidly generate comprehensive libraries of genetically-defined mutants with distinct phenotypes; ii.) whole-genome sequencing (WGS) to map the underlying genetic lesions and to find associations between mutated gene(s) and a common phenotype; iii.) generation of recombinant strains through co-infection of mammalian cells with mutant and wild type bacteria. Accordingly, we were able to establish causal relationships between genotypes and phenotypes. The coupling of chemically-induced gene variation and WGS to establish correlative genotype&#8211;phenotype associations should be broadly applicable to the large list of medically and environmentally important microorganisms currently intractable to genetic analysis.

Forward Genetic Approaches in Chlamydia trachomatis

We describe a methodology to perform genetic analysis in Chlamydia based on chemical mutagenesis and whole genome sequencing. In addition, a system for DNA exchange within infected cells is described that can be used for genetic mapping. This method may be broadly applicable to microbial systems lacking transformation systems and molecular genetic tools.

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its ...

Use of Galleria mellonella as a Model Organism to Study Legionella pneumophila Infection

Legionella pneumophila, the causative agent of a severe pneumonia named Legionnaires&#39; disease, is an important human pathogen that infects and replicates within alveolar macrophages. Its virulence depends on the Dot/Icm type IV secretion system (T4SS), which is essential to establish a replication permissive vacuole known as the Legionella containing vacuole (LCV). L. pneumophila infection can be modeled in mice however most mouse strains are not permissive, leading to the search for novel infection models. We have recently shown that the larvae of the wax moth Galleria mellonella are suitable for investigation of L. pneumophila infection. G. mellonella is increasingly used as an infection model for human pathogens and a good correlation exists between virulence of several bacterial species in the insect and in mammalian models. A key component of the larvae&#39;s immune defenses are hemocytes, professional phagocytes, which take up and destroy invaders. L. pneumophila is able to infect, form a LCV and replicate within these cells. Here we demonstrate protocols for analyzing L. pneumophila virulence in the G. mellonella model, including how to grow infectious L. pneumophila, pretreat the larvae with inhibitors, infect the larvae and how to extract infected cells for quantification and immunofluorescence microscopy. We also describe how to quantify bacterial replication and fitness in competition assays. These approaches allow for the rapid screening of mutants to determine factors important in L. pneumophila virulence, describing a new tool to aid our understanding of this complex pathogen.

Use of Galleria mellonella as a Model Organism to Study Legionella pneumophila Infection

The larva of the wax moth Galleria mellonella was recently established as an in vivo model to study Legionella pneumophila infection. Here, we demonstrate fundamental techniques to characterize the pathogenesis of Legionella in the larvae, including inoculation, measurement of bacterial virulence and replication as well as extraction and analysis of infected hemocytes.

Legionella pneumophila, the causative agent of a severe pneumonia named Legionnaires&#39; disease, is an important human pathogen that infects and ...

Discovery of New Intracellular Pathogens by Amoebal Coculture and Amoebal Enrichment Approaches

Intracellular pathogens such as legionella, mycobacteria and Chlamydia-like organisms are difficult to isolate because they often grow poorly or not at all on selective media that are usually used to cultivate bacteria. For this reason, many of these pathogens were discovered only recently or following important outbreaks. These pathogens are often associated with amoebae, which serve as host-cell and allow the survival and growth of the bacteria. We intend here to provide a demonstration of two techniques that allow isolation and characterization of intracellular pathogens present in clinical or environmental samples: the amoebal coculture and the amoebal enrichment. Amoebal coculture allows recovery of intracellular bacteria by inoculating the investigated sample onto an amoebal lawn that can be infected and lysed by the intracellular bacteria present in the sample. Amoebal enrichment allows recovery of amoebae present in a clinical or environmental sample. This can lead to discovery of new amoebal species but also of new intracellular bacteria growing specifically in these amoebae. Together, these two techniques help to discover new intracellular bacteria able to grow in amoebae. Because of their ability to infect amoebae and resist phagocytosis, these intracellular bacteria might also escape phagocytosis by macrophages and thus, be pathogenic for higher eukaryotes.

Amoebal coculture is a cell culture system using adherent amoebae to selectively grow intracellular pathogens able to resist phagocytic cells such as amoebae and macrophages. It thus represents a key tool to discover new infectious agents. Amoebal enrichment allows discovery of new amoebal species and of their specific intracellular bacteria.

Intracellular pathogens such as legionella, mycobacteria and Chlamydia-like organisms are difficult to isolate because they often grow poorly or not at ...

Study of Phagolysosome Biogenesis in Live Macrophages

Phagocytic cells play a major role in the innate immune system by removing and eliminating invading microorganisms in their phagosomes. Phagosome maturation is the complex and tightly regulated process during which a nascent phagosome undergoes drastic transformation through well-orchestrated interactions with various cellular organelles and compartments in the cytoplasm. This process, which is essential for the physiological function of phagocytic cells by endowing phagosomes with their lytic and bactericidal properties, culminates in fusion of phagosomes with lysosomes and biogenesis of phagolysosomes which is considered to be the last and critical stage of maturation for phagosomes. In this report, we describe a live cell imaging based method for qualitative and quantitative analysis of the dynamic process of lysosome to phagosome content delivery, which is a hallmark of phagolysosome biogenesis. This approach uses IgG-coated microbeads as a model for phagocytosis and fluorophore-conjugated dextran molecules as a luminal lysosomal cargo probe, in order to follow the dynamic delivery of lysosmal content to the phagosomes in real time in live macrophages using time-lapse imaging and confocal laser scanning microscopy. Here we describe in detail the background, the preparation steps and the step-by-step experimental setup to enable easy and precise deployment of this method in other labs. Our described method is simple, robust, and most importantly, can be easily adapted to study phagosomal interactions and maturation in different systems and under various experimental settings such as use of various phagocytic cells types, loss-of-function experiments, different probes, and phagocytic particles.

Phagocytic cells play a major role in the innate immune system by removing and eliminating invading microorganisms in their phagosomes. Phagosome ...

A Flow Adhesion Assay to Study Leucocyte Recruitment to Human Hepatic Sinusoidal Endothelium Under Conditions of Shear Stress

Leucocyte infiltration into human liver tissue is a common process in all adult inflammatory liver diseases. Chronic infiltration can drive the development of fibrosis and progression to cirrhosis. Understanding the molecular mechanisms that mediate leucocyte recruitment to the liver could identify important therapeutic targets for liver disease. The key interaction during leucocyte recruitment is that of inflammatory cells with endothelium under conditions of shear stress. Recruitment to the liver occurs within the low shear channels of the hepatic sinusoids which are lined by hepatic sinusoidal endothelial cells (HSEC). The conditions within the hepatic sinusoids can be recapitulated by perfusing leucocytes through channels lined by human HSEC monolayers at specific flow rates. In these conditions leucocytes undergo a brief tethering step followed by activation and firm adhesion, followed by a crawling step and subsequent transmigration across the endothelial layer. Using phase contrast microscopy, each step of this &#39;adhesion cascade&#39; can be visualized and recorded followed by offline analysis. Endothelial cells or leucocytes can be pretreated with inhibitors to determine the role of specific molecules during this process.

Leucocyte recruitment to the liver occurs within the specialized channels of the hepatic sinusoids which are lined by unique hepatic sinusoidal endothelial cells. Phase contrast microscopy of leucocyte recruitment across human hepatic sinusoidal endothelium under conditions of physiological shear stress can facilitate the elucidation of the molecular mechanisms which underlie this process.

Leucocyte infiltration into human liver tissue is a common process in all adult inflammatory liver diseases. Chronic infiltration can drive the ...

Use of Shigella flexneri to Study Autophagy-Cytoskeleton Interactions

Shigella flexneri is an intracellular pathogen that can escape from phagosomes to reach the cytosol, and polymerize the host actin cytoskeleton to promote its motility and dissemination. New work has shown that proteins involved in actin-based motility are also linked to autophagy, an intracellular degradation process crucial for cell autonomous immunity. Strikingly, host cells may prevent actin-based motility of S. flexneri by compartmentalizing bacteria inside &#8216;septin cages&#8217; and targeting them to autophagy. These observations indicate that a more complete understanding of septins, a family of filamentous GTP-binding proteins, will provide new insights into the process of autophagy. This report describes protocols to monitor autophagy-cytoskeleton interactions caused by S. flexneri in vitro using tissue culture cells and in vivo using zebrafish larvae. These protocols enable investigation of intracellular mechanisms that control bacterial dissemination at the molecular, cellular, and whole organism level.

Use of Shigella flexneri to Study Autophagy-Cytoskeleton Interactions

To counteract pathogen dissemination, host cells reorganize their cytoskeleton to compartmentalize bacteria and induce autophagy. Using Shigella infection of tissue culture cells, host and pathogen determinants underlying this process are identified and characterized. Using zebrafish models of Shigella infection, the role of discovered molecules and mechanisms are investigated in vivo.

Shigella flexneri is an intracellular pathogen that can escape from phagosomes to reach the cytosol, and polymerize the host actin cytoskeleton to promote ...

Phage Phenomics: Physiological Approaches to Characterize Novel Viral Proteins

Current investigations into phage-host interactions are dependent on extrapolating knowledge from (meta)genomes. Interestingly, 60 - 95% of all phage sequences share no homology to current annotated proteins. As a result, a large proportion of phage genes are annotated as hypothetical. This reality heavily affects the annotation of both structural and auxiliary metabolic genes. Here we present phenomic methods designed to capture the physiological response(s) of a selected host during expression of one of these unknown phage genes. Multi-phenotype Assay Plates (MAPs) are used to monitor the diversity of host substrate utilization and subsequent biomass formation, while metabolomics provides bi-product analysis by monitoring metabolite abundance and diversity. Both tools are used simultaneously to provide a phenotypic profile associated with expression of a single putative phage open reading frame (ORF). Representative results for both methods are compared, highlighting the phenotypic profile differences of a host carrying either putative structural or metabolic phage genes. In addition, the visualization techniques and high throughput computational pipelines that facilitated experimental analysis are presented.

Here, we present phenomic approaches for the functional characterization of putative phage genes. Techniques include a developed assay capable of monitoring host anabolic metabolism, the Multi-phenotype Assay Plates (MAPs), in addition to the established method of metabolomics, capable of measuring effects to catabolic metabolism.

Current investigations into phage-host interactions are dependent on extrapolating knowledge from (meta)genomes. Interestingly, 60 - 95% of all phage ...

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

Cutaneous antigen-recall models allow for studies of human memory responses in vivo. When combined with skin suction blister (SB) induction, this model offers accessibility to rare populations of antigen-specific T-cells representative of the cellular memory response as well as the cytokine microenvironment in situ.
This report describes the practical procedure of a cutaneous recall, an SB induction, and a harvest of antigen-specific T-cells. To exemplify the method, the tuberculin skin test is used for antigenic recall in individuals who, prior to this study, underwent a Bacillus Calmette-Gu&#233;rin vaccination against an infection with Mycobacterium tuberculosis. Finally, examples of multiplex and flow cytometric analyses of SB specimens are provided, illustrating high fractions of antigen-specific polyfunctional CD4+ T-cells available by this sampling method compared with cells isolated from the blood.
The method described here is safe and minimally invasive, provides a unique opportunity to study both innate and adaptive immune responses in vivo, and may be beneficial to a broad community of researchers working with cell-mediated immunity and human memory responses, in the context of vaccine development.

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

Here, we provide a demonstration of the suction blister cutaneous recall model. The model allows a simple access to study human in vivo adaptive immune responses, for instance in the context of vaccine development.

Cutaneous antigen-recall models allow for studies of human memory responses in vivo. When combined with skin suction blister (SB) induction, this model ...