The authors acknowledge that this work was supported by grants from the Science and Technology Commission of Shanghai Municipality (20ZR1411700), the National Natural Science Foundation of China (81771971), and Shanghai Sailing Program (22YF1406600).

Human aortic specimens were utilized for primary HASMC isolation under the approval of Zhongshan Hospital, Fudan University Ethics Committee (NO. B2020-158). Aortic specimens were collected from patients who underwent ascending aorta surgery at Zhongshan Hospital, Fudan University. Written informed consent was obtained from all patients before participation.
1. Primary human aortic smooth muscle cell isolation
<ol>
	<li>Wash the right lateral region of the ascending aorta with sterile PBS, 1x-2x.</li>
	<li>Remove the intima and adventitia layers of the tissue with two ophthalmic forceps and retain the media layer to harvest the cells.</li>
	<li>Place the media layer onto a 10 cm culture dish and cut it into small pieces (2-3 mm) with scissors. Add 5 mL of smooth muscle cell culture medium (SMCM) containing 10% FBS and 1% penicillin-streptomycin.</li>
	<li>Move the small tissue into the culture bottle with a sterile dropper, spreading the tissue evenly. Discard the culture medium as much as possible, then invert the bottle upside down.</li>
	<li>Add 2 mL of SMCM into the inverted culture bottle and place it in the incubator (5% CO2) at 37 &#176;C for 1-2 h, then slowly turn it right side up and add another 2 mL of SMCM.</li>
	<li>After 5-7 days of incubation, exchange the SMCM with 4 mL of fresh SMCM. Generally, sporadic smooth muscle cells climb out in approximately 2 weeks.</li>
	<li>Slowly discard the SMCM and add it slowly when changing the medium. Transport the culture bottle slowly when moving to a microscope station; otherwise, the tissues will float, and the cells will grow slowly.</li>
	<li>When the cells reach approximately 80% confluency, wash with 2 mL of PBS, digest with 2 mL of 0.25% trypsin, and divide them into two new culture bottles with 4 mL of fresh SMCM.</li>
	<li>Identify the cells through an immunofluorescence analysis of four different specific markers for smooth muscle cells (CNN1, SM22)14.</li>
</ol>
2. Preparation of PDMS chip
<ol>
	<li>To polymerize PDMS, add curing agent (B component) to base (A component) at a weight ratio of A: B = 10:1 w/w and mix the complex completely for 5 min; the volume depends on the need of the study.</li>
	<li>Place the prepared PDMS gel in a vacuum extraction tank for 30-60 min and maintain the pressure below -0.8 mPa. 
	NOTE: High pressure will lead to insufficient extraction of small bubbles inside the PDMS gel that will affect the next step of chip fabrication.</li>
	<li>Using computer-aided design (CAD) software, design the mold with a 100 mm &#215; 40 mm &#215; 8&#160;mm external frame structure and a 70 mm &#215; 6 mm &#215; 4 mm channel.</li>
	<li>Custom make the molds of the three layers using a high-precision computer numerical control engraving machine. Carve out the frame of the molds and the microchannels using polymethyl methacrylate (PMMA) plates, and then glue them onto another PMMA plate.</li>
	<li>Pour the prepared PDMS gel onto a mold with a 100 mm &#215; 40 mm &#215; 6 mm outer frame and 70 mm &#215; 6 mm &#215; 4 mm channel, and then cross-link at 70 &#176;C for 1-2 h.</li>
	<li>Peel off the cross-linked PDMS slabs from the mold and cut the commercialized PDMS membranes into 100 mm &#215; 40 mm sections.</li>
	<li>Treat the three prepared PDMS slabs and two PDMS membranes with oxygen plasma for 5 min for PDMS surface activation. Apply the following specific settings: room air as the process gas; pressure set to -100 kPa; current set to 180--200 Ma; voltage set to 200 V; process time to 5 min.</li>
	<li>Punch holes on the three PDMS slabs using a 1 mm hole puncher to make the inlet and outlet of air and medium microchannels on the PDMS chip.</li>
	<li>Bond three PDMS slabs and two PDMS membranes together in the order: air channel PDMS slab (top layer) - PDMS membrane - medium channel PDMS slab (middle layer) - PDMS membrane- air channel PDMS slab (bottom layer). Perform this step under a stereoscopic microscope at 4x to fully overlap the air microchannels with the medium microchannels.</li>
	<li>Place the assembled PDMS chip in a 70 &#176;C incubator for 1 h.</li>
	<li>Prepare several 1 mm inner diameter and 3 cm length latex hoses. Insert a 1 mm outer diameter and 1 cm long stainless-steel needle into one end of the prepared hose, and then insert a Luer into the other end of the hose to create the tube connected to the air and medium microchannels of the PDMS chip.</li>
	<li>Insert the prepared tubes into the outlets and inlets of the air and medium microchannels on the PDMS chip.</li>
</ol>
3. PDMS chip surface treatment and sterilization
<ol>
	<li>Infuse 2 mL of 80 mg/mL mouse collagen into the medium microchannel of the PDMS chip using a 2 mL syringe and incubate at room temperature for 30 min.</li>
	<li>After incubation, remove the collagen from the channel and recollect with a 2 mL syringe. Place the collagen-coated PDMS chips in a 60 &#176;C incubator overnight.</li>
	<li>Place the PDMS chips in a UV sterilizer for more than 1 h. Place the sterilized PDMS chips on an ultraclean bench in preparation for the cell experiment.</li>
</ol>
4. Cell seeding on the PDMS chip and cell stretching process
<ol>
	<li>Culture 4 x 105 primary human smooth muscle cells (HASMCs) from patients using smooth muscle cell medium (SMCM) containing 2% fetal bovine serum (FBS) and 1% penicillin-streptomycin in an 5% CO2 incubator at 37 &#176;C.</li>
	<li>When the HASMC density reaches 80%, discard the SMCM and wash the cells with 2 mL of PBS.</li>
	<li>Digest the cells using 1 mL of 0.25% trypsin for 2 min and centrifuge at 100 x g for 5 min. Remove the supernatant and resuspend the cell pellet in 1 mL of fresh SMCM. Use 8 mL of SMCM to culture the cells on a 10 cm culture dish.</li>
	<li>Calculate the cell number using a cytometer and use the cells at a final concentration of 2 x 105 cells/mL.</li>
	<li>Slowly pour 2 mL of PBS into the collagen-coated and sterilized PDMS chip medium microchannel and later discard using a 2 mL syringe.</li>
	<li>Slowly pour a total of 2 mL of 2 x 105 cells/mL HASMC suspension into the medium microchannel of the PDMS chip using a 2 mL syringe. Then, close the Luer at the entrance and exit of the PDMS chip. Place the PDMS chip in an incubator (5% CO2) at 37 &#176;C for 1 day.</li>
	<li>After the cells are attached to the PDMS membrane in the PDMS chip, nearly after 24 h, connect the outlet of the air microchannel on the PDMS chip to the vacuum controller system. When the cell is attached, an elongated, normal cellular form can be seen under the microscope, contrasting with the suspended round cells.</li>
	<li>Turn on the solenoid valve and the vacuum pump. Open the vacuum regulator and adjust the pressure level to 10 kPa for 7.18 &#177; 0.44% strain and 15 kPa for 17.28 &#177; 0.91% strain.</li>
	<li>After the parameters of the control system are set, place the PDMS chips in an incubator (5% CO2)&#160;at 37 &#176;C and stretch for 24 h.</li>
</ol>
5. Preparation of the mechanical control system
<ol>
	<li>Prepare several solenoid valves, vacuum filters, vacuum regulators, a vacuum pump, a peristaltic pump, and a programmable logic controller (PLC) controlling the solenoid valve.</li>
	<li>Program the PLC controller and set the on/off time interval to 1 Hz. Connect the solenoid valves to the programmed controller.</li>
	<li>Connect the inlet of the vacuum pump to the vacuum filters, and then connect the outlet of the vacuum filters to the vacuum regulators. Connect the outlet of the vacuum regulators to solenoid valves, and finally, connect the outlet of the solenoid valves to the outlets of the air microchannels of the PDMS chips.</li>
	<li>Connect the outlet of the peristaltic pump to the inlet of the medium microchannel of the PDMS chip and the inlet of the peristaltic pump to the outlet of the medium microchannel PDMS chip for culture medium replacement and drug handling.</li>
	<li>Adjust the amplitude of the strain by the regulator and the strain frequency by the microcontroller.</li>
</ol>

<ol>
	<li>Olsson, C., Thelin, S., St&#229;hle, E., Ekbom, A., Granath, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thoracic+aortic+aneurysm+and+dissection:+increasing+prevalence+and+improved+outcomes+reported+in+a+nationwide+population-based+study+of+more+than+14,000+cases+from+1987+to+2002.">Thoracic aortic aneurysm and dissection: increasing prevalence and improved outcomes reported in a nationwide population-based study of more than 14,000 cases from 1987 to 2002.</a> Circulation. 114 (24), 2611-2618 (2006).</li><li>van Varik, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+arterial+remodeling:+lessons+from+genetic+diseases.">Mechanisms of arterial remodeling: lessons from genetic diseases.</a> Frontiers in Genetics. 3 (290), 1-10 (2012).</li><li>Halka, A. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effects+of+stretch+on+vascular+smooth+muscle+cell+phenotype+in+vitro.">The effects of stretch on vascular smooth muscle cell phenotype in vitro.</a> Cardiovascular Pathology. 17 (2), 98-102 (2008).</li><li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arterial+wall+stress+induces+phenotypic+switching+of+arterial+smooth+muscle+cells+in+vascular+remodeling+by+activating+the+YAP/TAZ+signaling+pathway.">Arterial wall stress induces phenotypic switching of arterial smooth muscle cells in vascular remodeling by activating the YAP/TAZ signaling pathway.</a> Cellular Physiology and Biochemistry. 51 (2), 842-853 (2018).</li><li>Fabre, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introduction+to+a+manuscript+series+on+the+characterization+and+use+of+microphysiological+systems+(MPS)+in+pharmaceutical+safety+and+ADME+applications.">Introduction to a manuscript series on the characterization and use of microphysiological systems (MPS) in pharmaceutical safety and ADME applications.</a> Lab on a Chip. 20, 1049-1057 (2020).</li><li>Golding, H., Khurana, S., Zaitseva, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+is+the+predictive+value+of+animal+models+for+vaccine+efficacy+in+humans?+The+importance+of+bridging+studies+and+species-independent+correlates+of+protection.">What is the predictive value of animal models for vaccine efficacy in humans? The importance of bridging studies and species-independent correlates of protection.</a> Cold Spring Harbor Perspectives in Biology. 10 (4), 028902 (2018).</li><li>Ingber, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+organs-on-chips+for+disease+modelling,+drug+development+and+personalized+medicine.">Human organs-on-chips for disease modelling, drug development and personalized medicine.</a> Nature Reviews. Genetics. 25, 1-25 (2022).</li><li>Niu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+chip+for+odontoblasts+in+vitro.">Microfluidic chip for odontoblasts in vitro.</a> ACS Biomaterials Science &amp; Engineering. 5 (9), 4844-4851 (2019).</li><li>Huh, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reconstituting+organ-level+lung+functions+on+a+chip.">Reconstituting organ-level lung functions on a chip.</a> Science. 328 (5986), 1662-1668 (2010).</li><li>Musah, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mature+induced-pluripotent-stem-cell-derived+human+podocytes+reconstitute+kidney+glomerular-capillary-wall+function+on+a+chip.">Mature induced-pluripotent-stem-cell-derived human podocytes reconstitute kidney glomerular-capillary-wall function on a chip.</a> Nature Biomedical Engineering. 1 (69), 1-25 (2017).</li><li>Yoon No, D., Lee, K. H., Lee, J., Lee, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3D+liver+models+on+a+microplatform:+well-defined+culture,+engineering+of+liver+tissue+and+liver-on-a-chip.">3D liver models on a microplatform: well-defined culture, engineering of liver tissue and liver-on-a-chip.</a> Lab on a Chip. 15 (19), 3822-3837 (2015).</li><li>Bein, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+organ-on-a-chip+models+of+human+intestine.">Microfluidic organ-on-a-chip models of human intestine.</a> Cellular and Molecular Gastroenterology and Hepatology. 5 (4), 659-668 (2018).</li><li>Jastrzebska, E., Tomecka, E., Jesion, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heart-on-a-chip+based+on+stem+cell+biology.">Heart-on-a-chip based on stem cell biology.</a> Biosensors &amp; Bioelectronics. 75 (1), 67-81 (2016).</li><li>Rensen, S. S., Doevendans, P. A., van Eys, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+and+characteristics+of+vascular+smooth+muscle+cell+phenotypic+diversity.">Regulation and characteristics of vascular smooth muscle cell phenotypic diversity.</a> Netherlands Heart Journal. 15 (3), 100-108 (2007).</li><li>Perestrelo, A. R., &#193;guas, A. C., Rainer, A., Forte, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+organ/body-on-a-chip+devices+at+the+convergence+of+biology+and+microengineering.">Microfluidic organ/body-on-a-chip devices at the convergence of biology and microengineering.</a> Sensors. 15 (12), 31142-31170 (2015).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+cancer-on-a-chip+for+drug+screening.">Construction of cancer-on-a-chip for drug screening.</a> Drug Discovery Today. 26 (8), 1875-1890 (2021).</li><li>Yang, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+of+organ-on-a-chip+to+improve+cell+capture+efficiency.">Design of organ-on-a-chip to improve cell capture efficiency.</a> International Journal of Mechanical Sciences. 209, 106705 (2021).</li><li>Yang, Q., Lian, Q., Xu, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Perspective:+Fabrication+of+integrated+organ-on-a-chip+via+bioprinting.">Perspective: Fabrication of integrated organ-on-a-chip via bioprinting.</a> Biomicrofluidics. 11 (3), 031301 (2017).</li><li>Mohammed, M. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fabrication+of+microfluidic+devices:+improvement+of+surface+quality+of+CO2+laser+machined+poly+(methylmethacrylate)+polymer.">Fabrication of microfluidic devices: improvement of surface quality of CO2 laser machined poly (methylmethacrylate) polymer.</a> Journal of Micromechanics and Microengineering. 27 (1), 015021 (2017).</li><li>Tsao, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymer+microfluidics:+Simple,+low-cost+fabrication+process+bridging+academic+lab+research+to+commercialized+production.">Polymer microfluidics: Simple, low-cost fabrication process bridging academic lab research to commercialized production.</a> Micromachines. 7 (12), 225-236 (2016).</li><li>Kirschbaum, S. E., Baeumner, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+electrochemiluminescence+(ECL)+in+and+for+microfluidic+analytical+devices.">A review of electrochemiluminescence (ECL) in and for microfluidic analytical devices.</a> Analytical and Bioanalytical Chemistry. 407 (14), 3911-3926 (2015).</li><li>Stefanadis, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pressure-diameter+relation+of+the+human+aorta.+A+new+method+of+determination+by+the+application+of+a+special+ultrasonic+dimension+catheter.">Pressure-diameter relation of the human aorta. A new method of determination by the application of a special ultrasonic dimension catheter.</a> Circulation. 92 (8), 2210-2219 (1995).</li><li>Williams, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanical+influences+on+vascular+smooth+muscle+cell+function.">Mechanical influences on vascular smooth muscle cell function.</a> Journal of Hypertension. 16 (12), 1921-1929 (1998).</li><li>Abudupataer, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aorta+smooth+muscle-on-a-chip+reveals+impaired+mitochondrial+dynamics+as+a+therapeutic+target+for+aortic+aneurysm+in+bicuspid+aortic+valve+disease.">Aorta smooth muscle-on-a-chip reveals impaired mitochondrial dynamics as a therapeutic target for aortic aneurysm in bicuspid aortic valve disease.</a> eLife. 10, 69310 (2021).</li><li>Poussin, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3d+human+microvessel-on-a-chip+model+for+studying+monocyte-to-endothelium+adhesion+under+flow+-+application+in+systems+toxicology.">3d human microvessel-on-a-chip model for studying monocyte-to-endothelium adhesion under flow - application in systems toxicology.</a> Altex. 1, 47-63 (2020).</li><li>Yasotharan, S., Pinto, S., Sled, J. G., Bolz, S., Gunther, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Artery-on-a-chip+platform+for+automated,+multimodal+assessment+of+cerebral+blood+vessel+structure+and+function.">Artery-on-a-chip platform for automated, multimodal assessment of cerebral blood vessel structure and function.</a> Lab on a Chip. 15, 2660-2669 (2015).</li></ol>

The authors have nothing to disclose.

With the rapid development of microfluidic technology, OOC models that can replicate the biological function and structure of one or more organs in vitro have emerged in recent years for applications in biology, medicine, and pharmacology15. OOC can simulate key functions of the human physiological microenvironment, essential for exploring disease mechanisms and promoting preclinical drug translation8,16. Although OOC is still in ...

Thoracic aortic aneurysm and dissection (TAAD) is a localized dilatation or delamination of the aortic wall that is associated with high morbidity and mortality1. Human aortic smooth muscle cells (HASMCs) play a vital role in the pathogenesis of TAAD. HASMCs are not terminally differentiated cells, and HASMCs retain high plasticity, allowing them to switch phenotypes in response to different stimuli2. HASMCs are mainly subjected to rhythmic tensile strain in vivo, and this is one of the key factors regulating smooth muscle morphological changes, differentiation and physiological functions3,4. Therefore, the role of cyclic strain in the study of HASMCs cannot be ignored. However, conventional 2D cell cultures cannot replicate the biomechanical stimulation of cyclic strain experienced by HASMCs in vivo. Additionally, the construction of an animal TAAD model is not suitable for some types of TAAD, such as bicuspid aortic valve (BAV)-related TAAD. Moreover, the species gap between clinical human studies and animal experiments cannot be ignored. It hinders pharmaceutical translation in clinical practice. Thus, there is an urgent need for more complex and physiological systems to simulate the in vivo biomechanical environment in the research of aortic diseases.
Animal experiments used in biomedical research and drug development are costly, time-consuming, and ethically questionable. In addition, the results from animal studies frequently fail to predict the results obtained in human clinical trials5,6. The lack of human preclinical models and high failure rate in clinical trials have resulted in few effective drugs for the clinic, which has increased health care costs7. Thus, it is urgent to find other experimental models to complement animal models. Microfabrication and microfluidic techniques have developed greatly in recent years, providing novel techniques for establishing organoids-on-a-chip models that remedy the drawbacks of traditional 2D cell culture techniques and establish a more realistic, low-cost, and efficient in vitro model for physiological studies and drug development. Using microfluidic devices, organs-on-chips are established to culture living cells in micrometer-sized chambers with different stimuli to replicate the key functions of a tissue or organ. The system consists of single or multiple microfluidic microchannels, with either one kind of cell cultured in a perfused chamber replicating functions of one tissue type or different cell types cultured on porous membranes to recreate interfaces between different tissues. Microfluidic-based organoids combined with patient-derived cells have the unique advantage of bridging the large species difference between mouse and human disease models and overcoming the disadvantages of traditional 2D cell culture for disease mechanism research and drug discovery. With the rapid development of microfluidics in the past few years, researchers have realized the usefulness of in vitro organ-on-a-chip (OOC) models replicating complex in vivo biological parameters8. These microfluidic organoids simulate in vitro biomechanical environments, such as cyclic strain, shear stress, and liquid pressure, providing a three-dimensional (3D) cell culture environment. To date, several OOC models have been established to simulate biomechanical stimuli in organs such as the lung9, kidney10, liver11, intestine12, and heart13, but these have not been widely applied to the study of human aortic disease.
In this study, we present a human aorta smooth muscle cell organ-on-a-chip (HASMC-OOC) model that can control the biomimetic mechanical forces and rhythms applied to TAAD patient-derived primary HASMCs. The chip consists of three-layered thick plates of polydimethylsiloxane (PDMS) etched with channels and two commercialized highly flexible PDMS membranes. HASMCs are cultured on the PDMS membranes. The channel in the middle of the chip is filled with a culture medium for cell culture. The top and bottom channels of the chip are connected to a vacuum pressure supply system that can control the rhythm and frequency of mechanical tensile strain of the PDMS membranes. Rhythmic strain experienced by HASMCs can be simulated in HASMC-OOC, replicating the biomechanical microenvironment of tissue or organ not functionally achievable with conventional 2D culture systems. With the advantage of high-resolution, real-time imaging, and biomechanical microenvironment, the biochemical, genetic and metabolic activities of living cells can be studied for tissue development, organ physiology, disease etiology, molecular mechanisms and biomarker identification ,cardiovascular disease and aortic disease. Combined with tissue-specific and patient cells, this system can be used for drug screening, personalized medicine, and toxicity testing. This HASMC-OOC model provides a novel in vitro platform for studying the pathogenesis of the aortic disease.

<table><tbody><tr><td>4% paraformaldehyde</td><td>Beyotime</td><td>P0099-100ml</td><td>Used for cell immobilization</td></tr><tr><td>Alexa Fluor 350-labeled Goat Anti-Rabbit IgG</td><td>Beyotime</td><td>A0408</td><td>Antibodies used for immunostaining</td></tr><tr><td>Bovine serum albumin</td><td>Beyotime</td><td>ST025-20g</td><td></td></tr><tr><td>Calcium AM/PI</td><td>Invitrogen</td><td>L3224</td><td></td></tr><tr><td>Cell culture flask&amp;nbsp;</td><td>Corning</td><td>430639</td><td></td></tr><tr><td>CNN1</td><td>Abcam&amp;nbsp;</td><td>Ab46794</td><td></td></tr><tr><td>Commercial flexible&lt;br/&gt; PDMS membrane</td><td>Hangzhou Bald Advanced Materials</td><td>KYQ-200</td><td></td></tr><tr><td>F-actin</td><td>Invitrogen</td><td>R415</td><td></td></tr><tr><td>FBS</td><td>Sigma</td><td>M8318</td><td></td></tr><tr><td>Hoses</td><td>Runze Fluid</td><td>96410</td><td>1 mm inner diameter; 3 mm outer diameter; 1 mm wall thickness; Official website address: https://www.runzefluidsystem.com</td></tr><tr><td>Human aortic smooth&lt;br/&gt; muscle cell line CRL1999</td><td>ATCC</td><td>Lot Number:70019189</td><td></td></tr><tr><td>Image J</td><td>Imagej.net/fiji/downloads</td><td>Free Download: https://fiji.sc</td><td>Imaging platform that is used to identify fluorescence intensity</td></tr><tr><td>Incubator</td><td>Thermo Fisher Scientific</td><td></td><td>Ensures that the temperature,&lt;br/&gt; humidity, and light exposure is&lt;br/&gt; exactly the same throughout&lt;br/&gt; experiment.</td></tr><tr><td>Luer</td><td>Runze Fluid</td><td>RH-M016</td><td>Official website address: https://www.runzefluidsystem.com.</td></tr><tr><td>Microscope</td><td>Olympus</td><td></td><td></td></tr><tr><td>mouse collagen</td><td>Sigma</td><td>C7661</td><td></td></tr><tr><td>Oxygen plasma&amp;nbsp;</td><td>Changzhou Hongming Instrument</td><td>HM-Plasma5L</td><td></td></tr><tr><td>Pasteur pipette</td><td>Biologix</td><td>30-0138A1</td><td></td></tr><tr><td>PBS</td><td>Beyotime</td><td>C0221A</td><td></td></tr><tr><td>Pen-Strep</td><td>Sigma</td><td>P4458-100ml</td><td>Antibiodics used to prevent bacterial&lt;br/&gt; contamination of cells during culture.</td></tr><tr><td>peristaltic pump</td><td>Kamoer</td><td>F01A-STP-B046</td><td></td></tr><tr><td>Petri dish</td><td>Corning</td><td>430167</td><td></td></tr><tr><td>PLC controller</td><td>Zhejiang Jun Teng (BenT) CNC factory</td><td>BR010-11T8X2M</td><td>The detailed program setting can be found in supplementary. Official website address: files.http://www.btcnc.net</td></tr><tr><td>polydimethylsiloxane (PDMS)</td><td>Dow Corning</td><td>Sylgard 184</td><td></td></tr><tr><td>SM22</td><td>Abcam&amp;nbsp;</td><td>ab14106</td><td></td></tr><tr><td>SMCM</td><td>ScienCell</td><td>Cat 1101</td><td></td></tr><tr><td>solenoid valve</td><td>SMC (China)</td><td>VQZ300</td><td></td></tr><tr><td>Syringe</td><td>Becton,Dickinson and Company</td><td>300841</td><td></td></tr><tr><td>Triton-X 100</td><td>Beyotime</td><td>ST795</td><td>To penetrate cell membranes</td></tr><tr><td>Trizol</td><td>Invitrogen</td><td>10296010</td><td>Used for RNA extraction</td></tr><tr><td>trypsin</td><td>Sigma</td><td>15400054</td><td></td></tr><tr><td>vacuum filter</td><td>SMC (China)</td><td>ZFC5-6</td><td>Official website address: https://www.smc.com.cn</td></tr><tr><td>vacuum pump</td><td>Kamoer</td><td>KVP15-KL-S</td><td></td></tr><tr><td>vacuum regulator</td><td>AirTAC</td><td>GVR-200-06</td><td></td></tr><tr><td>&lt;strong&gt;Primers&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Primer Name</td><td>Forward (5&amp;rsquo; to 3&amp;rsquo;)</td><td>Reverse (5&amp;rsquo; to 3&amp;rsquo;)</td><td></td></tr><tr><td>SM22</td><td>CCGTGGAGATCCCAACTGG</td><td>CCATCTGAAGGCCAATGACAT</td><td></td></tr><tr><td>CNN1</td><td>CTCCATTGACTCGAACGACTC</td><td>CAGGTCTGCGAAACTTCTTAGA</td><td></td></tr></tbody></table>

construction of a human aorta smooth muscle cell organ-on-a-chip model for recapitulating biomechanical strain in the aortic wall

Conventional two-dimensional cell culture techniques and animal models have been used in the study of human thoracic aortic aneurysm and dissection (TAAD). However, human TAAD sometimes cannot be characterized by animal models. There is an apparent species gap between clinical human studies and animal experiments that may hinder the discovery of therapeutic drugs. In contrast, the conventional cell culture model is unable to simulate in vivo biomechanical stimuli. To this end, microfabrication and microfluidic techniques have developed greatly in recent years, providing novel techniques for establishing organoids-on-a-chip models that replicate the biomechanical microenvironment. In this study, a human aorta smooth muscle cell organ-on-a-chip (HASMC-OOC) model was developed to simulate the pathophysiological parameters of aortic biomechanics, including the amplitude and frequency of cyclic strain experienced by human aortic smooth muscle cells (HASMCs) that play a vital role in TAAD. In this model, the morphology of HASMCs became elongated in shape, aligned perpendicularly to the strain direction, and presented a more contractile phenotype under strain conditions than under static conventional conditions. This was consistent with the cell orientation and phenotype in native human aortic walls. Additionally, using bicuspid aortic valve-related TAAD (BAV-TAAD) and tricuspid aortic valve-related TAAD (TAV-TAAD) patient-derived primary HASMCs, we established BAV-TAAD and TAV-TAAD disease models, which replicate HASMC characteristics in TAAD. The HASMC-OOC model provides a novel in vitro platform that is complementary to animal models for further exploring the pathogenesis of TAAD and discovering therapeutic targets.

The HASMC-OOC model consists of a vacuum control system, a circulating system, and PDMS chips, and the schematic design of the HASMC-OOC model (Figure 1). The vacuum control system consists of a vacuum pump, solenoid valves, and a PLC controller. To act as the circulating system, a peristaltic pump was used to refresh the cell culture medium and add drugs. The PDMS chip was composed of two vacuum chambers and a middle chamber filled with SMCM for cell growth. According to the design of the c...

Watch this Scientific Journal Video about Construction of a Human Aorta Smooth Muscle Cell Organ-On-A-Chip Model for Recapitulating Biomechanical Strain in the Aortic Wall at JoVE.com

Construction of a Human Aorta Smooth Muscle Cell Organ-On-A-Chip Model for Recapitulating Biomechanical Strain in the Aortic Wall

Here, we developed a human aorta smooth muscle cell organ-on-a-chip model to replicate the in vivo biomechanical strain of smooth muscle cells in the human aortic wall.

Conventional two-dimensional cell culture techniques and animal models have been used in the study of human thoracic aortic aneurysm and dissection ...

construction-human-aorta-smooth-muscle-cell-organ-on-chip-model-for

Research

JoVE Journal

Bioengineering

3.0K Views.  Fudan University. Dit model stimuleert biomechanische prikkels die worden ervaren door gladde spiercellen in menselijke aorta. In combinatie met van patiënten afgeleide cellen kan dit systeem worden gebruikt voor geneesmiddelenscreening en gepersonaliseerde geneeskunde van aortaziekten. Dit model kan de kale mechanische parameters van de gladde spiercellen in menselijke aorta nabootsen en nauwkeurig regelen, wat een nieuw in vitro platform biedt voor het bestuderen en pathogenese van aortaziekten.Miera...

Video: Construction of a Human Aorta Smooth Muscle Cell Organ-On-A-Chip Model for Recapitulating Biomechanical Strain in the Aortic Wall

Mechanical Testing of Mouse Carotid Arteries: from Newborn to Adult

The large conducting arteries in vertebrates are composed of a specialized extracellular matrix designed to provide pulse dampening and reduce the work performed by the heart. The mix of matrix proteins determines the passive mechanical properties of the arterial wall1. When the matrix proteins are altered in development, aging, disease or injury, the arterial wall remodels, changing the mechanical properties and leading to subsequent cardiac adaptation2. In normal development, the remodeling leads to a functional cardiac and cardiovascular system optimized for the needs of the adult organism. In disease, the remodeling often leads to a negative feedback cycle that can cause cardiac failure and death. By quantifying passive arterial mechanical properties in development and disease, we can begin to understand the normal remodeling process to recreate it in tissue engineering and the pathological remodeling process to test disease treatments.
	Mice are useful models for studying passive arterial mechanics in development and disease. They have a relatively short lifespan (mature adults by 3 months and aged adults by 2 years), so developmental3 and aging studies4 can be carried out over a limited time course. The advances in mouse genetics provide numerous genotypes and phenotypes to study changes in arterial mechanics with disease progression5 and disease treatment6. Mice can also be manipulated experimentally to study the effects of changes in hemodynamic parameters on the arterial remodeling process7. One drawback of the mouse model, especially for examining young ages, is the size of the arteries. 
	We describe a method for passive mechanical testing of carotid arteries from mice aged 3 days to adult (approximately 90 days). We adapt a commercial myograph system to mount the arteries and perform multiple pressure or axial stretch protocols on each specimen. We discuss suitable protocols for each age, the necessary measurements and provide example data. We also include data analysis strategies for rigorous mechanical characterization of the arteries.

Passive mechanical testing of mouse carotid arteries is described, with special consideration for adapting to different specimen ages. The procedures include determining the in vivo length of the artery, mounting it in a pressure myograph, recording data, measuring the unloaded dimensions and analyzing the resulting data.

The large conducting arteries in vertebrates are composed of a specialized extracellular matrix designed to provide pulse dampening and reduce the work ...

Using In Vivo and Tissue and Cell Explant Approaches to Study the Morphogenesis and Pathogenesis of the Embryonic and Perinatal Aorta

The aorta is the largest artery in the body. The aortic wall is composed of an inner layer of endothelial cells, a middle layer of alternating elastic lamellae and smooth muscle cells (SMCs), and an outer layer of fibroblasts and extracellular matrix. In contrast to the widespread study of pathological models (e.g., atherosclerosis) in the adult aorta, much less is known about the embryonic and perinatal aorta. Here, we focus on SMCs and provide protocols for the analysis of the morphogenesis and pathogenesis of embryonic and perinatal aortic SMCs in normal development and disease. Specifically, the four protocols included are: i) in vivo embryonic fate mapping and clonal analysis; ii) explant embryonic aorta culture; iii) SMC isolation from the perinatal aorta; and iv) subcutaneous osmotic mini-pump placement in pregnant (or non-pregnant) mice. Thus, these approaches facilitate the investigation of the origin(s), fate, and clonal architecture of SMCs in the aorta in vivo. They allow for modulating embryonic aorta morphogenesis in utero by continuous exposure to pharmacological agents. In addition, isolated aortic tissue explants or aortic SMCs can be used to gain insights into the role of specific gene targets during fundamental processes such as muscularization, proliferation, and migration. These hypothesis-generating experiments on isolated SMCs and the explanted aorta can then be assessed in the in vivo context through pharmacological and genetic approaches.

Using In Vivo and Tissue and Cell Explant Approaches to Study the Morphogenesis and Pathogenesis of the Embryonic and Perinatal Aorta

Protocols for studying the embryonic and perinatal murine aorta using in vivo clonal analysis and fate mapping, aortic explants, and isolated smooth muscle cells are detailed here. These diverse approaches facilitate the investigation of the morphogenesis of the embryonic and perinatal aorta in normal development and the pathogenesis in disease.

The aorta is the largest artery in the body. The aortic wall is composed of an inner layer of endothelial cells, a middle layer of alternating elastic ...

Developmental Biology

A Novel Stretching Platform for Applications in Cell and Tissue Mechanobiology

Tools that allow the application of mechanical forces to cells and tissues or that can quantify the mechanical properties of biological tissues have contributed dramatically to the understanding of basic mechanobiology. These techniques have been extensively used to demonstrate how the onset and progression of various diseases are heavily influenced by mechanical cues. This article presents a multi-functional biaxial stretching (BAXS) platform that can either mechanically stimulate single cells or quantify the mechanical stiffness of tissues. The BAXS platform consists of four voice coil motors that can be controlled independently. Single cells can be cultured on a flexible substrate that can be attached to the motors allowing one to expose the cells to complex, dynamic, and spatially varying strain fields. Conversely, by incorporating a force load cell, one can also quantify the mechanical properties of primary tissues as they are exposed to deformation cycles. In both cases, a proper set of clamps must be designed and mounted to the BAXS platform motors in order to firmly hold the flexible substrate or the tissue of interest. The BAXS platform can be mounted on an inverted microscope to perform simultaneous transmitted light and/or fluorescence imaging to examine the structural or biochemical response of the sample during stretching experiments. This article provides experimental details of the design and usage of the BAXS platform and presents results for single cell and whole tissue studies. The BAXS platform was used to measure the deformation of nuclei in single mouse myoblast cells in response to substrate strain and to measure the stiffness of isolated mouse aortas. The BAXS platform is a versatile tool that can be combined with various optical microscopies in order to provide novel mechanobiological insights at the sub-cellular, cellular and whole tissue levels.

We present in this article a novel stretching platform that can be used to investigate single cell responses to complex anisotropic biaxial mechanical deformation and quantify the mechanical properties of biological tissues.

Tools that allow the application of mechanical forces to cells and tissues or that can quantify the mechanical properties of biological tissues have ...

Isolation and Excision of Murine Aorta; A Versatile Technique in the Study of Cardiovascular Disease

Cardiovascular disease is a broad term describing disease of the heart and/or blood vessels. The main blood vessel supplying the body with oxygenated blood is the aorta. The aorta may become affected in diseases such as atherosclerosis and aneurysm. Researchers investigating these diseases would benefit from direct observation of the aorta to characterize disease progression as well as to evaluate efficacy of potential therapeutics. The goal of this protocol is to describe proper isolation and excision of the aorta to aid investigators researching cardiovascular disease. Isolation and excision of the aorta allows investigators to look at gross morphometric changes as wells as allowing them to preserve and stain the tissue to look at histologic changes if desired. The aorta may be used for molecular studies to evaluate protein and gene expression to discover targets of interest and mechanisms of action. This technique is superior to imaging modalities as they have inherent limitations in technology and cost. Additionally, primary isolated cells from a freshly isolated and excised aorta can allowing researchers to perform further in situ and in vitro assays. The isolation and excision of the aorta has the limitation of having to sacrifice the animal however, in this case the benefits outweigh the harm as it is the most versatile technique in the study of aortic disease.

Pathology of the aorta can lead to severe morbidity and mortality, therefore research of disease progression and potential therapies is warranted. Here, we present a protocol to isolate and excise the murine aorta to aid researchers in their investigation of cardiovascular disease.

Cardiovascular disease is a broad term describing disease of the heart and/or blood vessels. The main blood vessel supplying the body with oxygenated ...

Medicine

Assessing Collagen and Elastin Pressure-dependent Microarchitectures in Live, Human Resistance Arteries by Label-free Fluorescence Microscopy

The pathogenic contribution of resistance artery remodeling is documented in essential hypertension, diabetes and the metabolic syndrome. Investigations and development of microstructurally motivated mathematical models for understanding the mechanical properties of human resistance arteries in health and disease have the potential to aid understanding how disease and medical treatments affect the human microcirculation. To develop these mathematical models, it is essential to decipher the relationship between the mechanical and microarchitectural properties of the microvascular wall. In this work, we describe an ex vivo method for passive mechanical testing and simultaneous label-free three-dimensional imaging of the microarchitecture of elastin and collagen in the arterial wall of isolated human resistance arteries. The imaging protocol can be applied to resistance arteries of any species of interest. Image analyses are described for quantifying i) pressure-induced changes in internal elastic lamina branching angles and adventitial collagen straightness using Fiji and ii) collagen and elastin volume densities determined using Ilastik software. Preferably all mechanical and imaging measurements are performed on live, perfused arteries, however, an alternative approach using standard video-microscopy pressure myography in combination with post-fixation imaging of re-pressurized vessels is discussed. This alternative method provides users with different options for analysis approaches. The inclusion of the mechanical and imaging data in mathematical models of the arterial wall mechanics is discussed, and future development and additions to the protocol are proposed.

We describe simultaneous mechanical testing and 3D-imaging of the arterial wall of isolated, live human resistance arteries, and Fiji and Ilastik image analyses for the quantification of elastin and collagen spatial organization and volume densities. We discuss the use of these data in mathematical models of arterial wall mechanics.

The pathogenic contribution of resistance artery remodeling is documented in essential hypertension, diabetes and the metabolic syndrome. Investigations ...

Microfluidic Model to Mimic Initial Event of Neovascularization

Neovascularization is usually initialized from an existing normal vasculature and the biomechanical microenvironment of endothelial cells (ECs) in the initial stage varies dramatically from the following process of neovascularization. Although there are plenty of models to simulate different stages of neovascularization, an in vitro 3D model that capitulates the initial process of neovascularization under the corresponding stimulations of normal vasculature microenvironments is still lacking. Here, we reconstructed an in vitro 3D model that mimics the initial event of neovascularization (MIEN). The MIEN model contains a microfluidic sprouting chip and an automatic control, highly efficient circulation system. A functional, perfusable microchannel coated with endothelium was formed and the process of sprouting was simulated in the microfluidic sprouting chip. The initially physiological microenvironment of neovascularization was recapitulated with the microfluidic control system, by which ECs would be exposed to high luminal shear stress, physiological transendothelial flow, and various vascular endothelial growth factor (VEGF) distributions simultaneously. The MIEN model can be readily applied to the study of neovascularization mechanism and holds a potential promise as a low-cost platform for drug screening and toxicology applications.

Here, we provide a microfluidic chip and an automatically controlled, highly efficient circulation microfluidic system that recapitulates the initial microenvironment of neovascularization, allowing endothelial cells (ECs) to be stimulated by high luminal shear stress, physiological level of transendothelial flow, and various vascular endothelial growth factor (VEGF) distribution simultaneously.

Neovascularization is usually initialized from an existing normal vasculature and the biomechanical microenvironment of endothelial cells (ECs) in the ...

Reconstituting Cytoarchitecture and Function of Human Epithelial Tissues on an Open-Top Organ-Chip

Nearly all human organs are lined with epithelial tissues, comprising one or multiple layers of tightly connected cells organized into three-dimensional (3D) structures. One of the main functions of epithelia is the formation of barriers that protect the underlining tissues against physical and chemical insults and infectious agents. In addition, epithelia mediate the transport of nutrients, hormones, and other signaling molecules, often creating biochemical gradients that guide cell positioning and compartmentalization within the organ. Owing to their central role in determining organ-structure and function, epithelia are important therapeutic targets for many human diseases that are not always captured by animal models. Besides the obvious species-to-species differences, conducting research studies on barrier function and transport properties of epithelia in animals is further compounded by the difficulty of accessing these tissues in a living system. While two-dimensional (2D) human cell cultures are useful for answering basic scientific questions, they often yield poor in vivo predictions. To overcome these limitations, in the last decade, a plethora of micro-engineered biomimetic platforms, known as organs-on-a-chip, have emerged as a promising alternative to traditional in vitro and animal testing. Here, we describe an Open-Top Organ-Chip (or Open-Top Chip), a platform designed for modeling organ-specific epithelial tissues, including skin, lungs, and the intestines. This chip offers new opportunities for reconstituting the multicellular architecture and function of epithelial tissues, including the capability to recreate a 3D stromal component by incorporating tissue-specific fibroblasts and endothelial cells within a mechanically active system. This Open-Top Chip provides an unprecedented tool for studying epithelial/mesenchymal and vascular interactions at multiple scales of resolution, from single cells to multi-layer tissue constructs, thus allowing molecular dissection of the intercellular crosstalk of epithelialized organs in health and disease.

The present protocol describes the capabilities and the essential culture modalities of the Open-Top Organ-Chip for the successful establishment and maturation of full-thickness organ-on-chip cultures of primary tissues (skin, alveolus, airway, and intestine), providing the opportunity to investigate different functional aspects of the human epithelial/mesenchymal and vascular niche interface in vitro.

Nearly all human organs are lined with epithelial tissues, comprising one or multiple layers of tightly connected cells organized into three-dimensional ...

Using Digital Image Correlation to Characterize Local Strains on Vascular Tissue Specimens

Characterization of the mechanical behavior of biological and engineered soft tissues is a central component of fundamental biomedical research and product development. Stress-strain relationships are typically obtained from mechanical testing data to enable comparative assessment among samples and in some cases identification of constitutive mechanical properties. However, errors may be introduced through the use of average strain measures, as significant heterogeneity in the strain field may result from geometrical non-uniformity of the sample and stress concentrations induced by mounting/gripping of soft tissues within the test system. When strain field heterogeneity is significant, accurate assessment of the sample mechanical response requires measurement of local strains. This study demonstrates a novel biomechanical testing protocol for calculating local surface strains using a mechanical testing device coupled with a high resolution camera and a digital image correlation technique. A series of sample surface images are acquired and then analyzed to quantify the local surface strain of a vascular tissue specimen subjected to ramped uniaxial loading. This approach can improve accuracy in experimental vascular biomechanics and has potential for broader use among other native soft tissues, engineered soft tissues, and soft hydrogel/polymeric materials. In the video, we demonstrate how to set up the system components and perform a complete experiment on native vascular tissue.

We describe the use of digital image correlation to characterize the local surface strain field on vascular tissue samples subjected to uniaxial tensile testing. These measurements facilitate precise quantification of the sample mechanical response and the generation of constitutive stress-strain relations.

Characterization of the mechanical behavior of biological and engineered soft tissues is a central component of fundamental biomedical research and ...

Biology

Murine Aortic Crush Injury: An Efficient In Vivo Model of Smooth Muscle Cell Proliferation and Endothelial Function

Arterial reconstruction, whether angioplasty or bypass surgery, involves iatrogenic trauma causing endothelial disruption and vascular smooth muscle cell (VSMC) proliferation. Common murine models study small vessels such as the carotid and femoral arteries. Herein we describe an in vivo system in which both VSMC proliferation and endothelial barrier function can be simultaneously assessed in a large vessel. We studied the infrarenal aortic response to injury in C57BL/6 mice. The aorta was injured from the left renal vein to the aortic bifurcation by 30 transmural crushes of 5-seconds duration with a cotton-tipped applicator. Morphological changes were assessed with conventional histology. Aorta wall thickness was measured from the luminal surface to the adventitia. EdU integration and counter staining with DAPI and alpha-actin was used to demonstrate VSMC proliferation. Activation of ERK1/2, a known moderator of intimal hyperplasia formation, was determined by Western Blot analysis. The effect of inflammation was determined by immunohistochemistry for B-cells, T-cells, and macrophages. En face sections of endothelium were visualized with scanning electron microscopy (SEM). Endothelial barrier function was determined with Evans Blue staining. Transmural injury resulted in aortic wall thickening. This injury induced VSMC proliferation, most prominently at 3 days after injury, and early activation of ERK1/2 and decreased p27kip1 expression. Injury did not result in increased B-cells, T-cells, or macrophages infiltration in the vessel wall. Injury caused partial endothelial cell denudation and loss of cell-cell contact. Injury resulted in a significant loss of endothelial barrier function, which returned to baseline after seven days. The murine transmural blunt aortic injury model provides an efficient system to simultaneously study both VSMC proliferation and endothelial barrier function in a large vessel.

Murine Aortic Crush Injury: An Efficient In Vivo Model of Smooth Muscle Cell Proliferation and Endothelial Function

Restenosis following cardiovascular procedures (bypass surgery, angioplasty, or stenting) is a significant problem reducing the durability of these procedures. An ideal therapy would inhibit smooth muscle cell (VSMC) proliferation while promoting regeneration of the endothelium. We describe a model for simultaneous assessment of VSMC proliferation and endothelial function in vivo.

Arterial reconstruction, whether angioplasty or bypass surgery, involves iatrogenic trauma causing endothelial disruption and vascular smooth muscle cell ...

Isolation of Primary Patient-specific Aortic Smooth Muscle Cells and Semiquantitative Real-time Contraction Measurements In Vitro

Smooth muscle cells (SMCs) are the predominant cell type in the aortic media. Their contractile machinery is important for the transmission of force in the aorta and regulates vasoconstriction and vasodilation. Mutations in genes encoding for the SMC contractile apparatus proteins are associated with aortic diseases, such as thoracic aortic aneurysms. Measuring SMC contraction in vitro is challenging, especially in a high-throughput manner, which is essential for screening patient material. Currently available methods are not suitable for this purpose. This paper presents a novel method based on electric cell-substrate impedance sensing (ECIS). First, an explant protocol is described to isolate patient-specific human primary SMCs from aortic biopsies and patient-specific human primary dermal fibroblasts for the study of aortic aneurysms. Next, a detailed description of a new contraction method is given to measure the contractile response of these cells, including the subsequent analysis and suggestion for comparing different groups. This method can be used to study the contraction of adherent cells in the context of translational (cardiovascular) studies and patient and drug screening studies.

Isolation of Primary Patient-specific Aortic Smooth Muscle Cells and Semiquantitative Real-time Contraction Measurements In Vitro

This paper describes an explant culture-based method for the isolation and culturing of primary, patient-specific human aortic smooth muscle cells and dermal fibroblasts. Furthermore, a novel method is presented for measuring cell contraction and subsequent analysis, which can be used to study patient-specific differences in these cells.

Smooth muscle cells (SMCs) are the predominant cell type in the aortic media. Their contractile machinery is important for the transmission of force in ...

Construction of a Human Aorta Smooth Muscle Cell Organ-On-A-Chip Model for Recapitulating Biomechanical Strain in the Aortic Wall

Samenvatting

Meer video's verkennen