The authors acknowledge that this work was supported by grants from the Science and Technology Commission of Shanghai Municipality (20ZR1411700), the National Natural Science Foundation of China (81771971), and Shanghai Sailing Program (22YF1406600).

Human aortic specimens were utilized for primary HASMC isolation under the approval of Zhongshan Hospital, Fudan University Ethics Committee (NO. B2020-158). Aortic specimens were collected from patients who underwent ascending aorta surgery at Zhongshan Hospital, Fudan University. Written informed consent was obtained from all patients before participation.
1. Primary human aortic smooth muscle cell isolation
<ol>
	<li>Wash the right lateral region of the ascending aorta with sterile PBS, 1x-2x.</li>
	<li>Remove the intima and adventitia layers of the tissue with two ophthalmic forceps and retain the media layer to harvest the cells.</li>
	<li>Place the media layer onto a 10 cm culture dish and cut it into small pieces (2-3 mm) with scissors. Add 5 mL of smooth muscle cell culture medium (SMCM) containing 10% FBS and 1% penicillin-streptomycin.</li>
	<li>Move the small tissue into the culture bottle with a sterile dropper, spreading the tissue evenly. Discard the culture medium as much as possible, then invert the bottle upside down.</li>
	<li>Add 2 mL of SMCM into the inverted culture bottle and place it in the incubator (5% CO2) at 37 &#176;C for 1-2 h, then slowly turn it right side up and add another 2 mL of SMCM.</li>
	<li>After 5-7 days of incubation, exchange the SMCM with 4 mL of fresh SMCM. Generally, sporadic smooth muscle cells climb out in approximately 2 weeks.</li>
	<li>Slowly discard the SMCM and add it slowly when changing the medium. Transport the culture bottle slowly when moving to a microscope station; otherwise, the tissues will float, and the cells will grow slowly.</li>
	<li>When the cells reach approximately 80% confluency, wash with 2 mL of PBS, digest with 2 mL of 0.25% trypsin, and divide them into two new culture bottles with 4 mL of fresh SMCM.</li>
	<li>Identify the cells through an immunofluorescence analysis of four different specific markers for smooth muscle cells (CNN1, SM22)14.</li>
</ol>
2. Preparation of PDMS chip
<ol>
	<li>To polymerize PDMS, add curing agent (B component) to base (A component) at a weight ratio of A: B = 10:1 w/w and mix the complex completely for 5 min; the volume depends on the need of the study.</li>
	<li>Place the prepared PDMS gel in a vacuum extraction tank for 30-60 min and maintain the pressure below -0.8 mPa. 
	NOTE: High pressure will lead to insufficient extraction of small bubbles inside the PDMS gel that will affect the next step of chip fabrication.</li>
	<li>Using computer-aided design (CAD) software, design the mold with a 100 mm &#215; 40 mm &#215; 8&#160;mm external frame structure and a 70 mm &#215; 6 mm &#215; 4 mm channel.</li>
	<li>Custom make the molds of the three layers using a high-precision computer numerical control engraving machine. Carve out the frame of the molds and the microchannels using polymethyl methacrylate (PMMA) plates, and then glue them onto another PMMA plate.</li>
	<li>Pour the prepared PDMS gel onto a mold with a 100 mm &#215; 40 mm &#215; 6 mm outer frame and 70 mm &#215; 6 mm &#215; 4 mm channel, and then cross-link at 70 &#176;C for 1-2 h.</li>
	<li>Peel off the cross-linked PDMS slabs from the mold and cut the commercialized PDMS membranes into 100 mm &#215; 40 mm sections.</li>
	<li>Treat the three prepared PDMS slabs and two PDMS membranes with oxygen plasma for 5 min for PDMS surface activation. Apply the following specific settings: room air as the process gas; pressure set to -100 kPa; current set to 180--200 Ma; voltage set to 200 V; process time to 5 min.</li>
	<li>Punch holes on the three PDMS slabs using a 1 mm hole puncher to make the inlet and outlet of air and medium microchannels on the PDMS chip.</li>
	<li>Bond three PDMS slabs and two PDMS membranes together in the order: air channel PDMS slab (top layer) - PDMS membrane - medium channel PDMS slab (middle layer) - PDMS membrane- air channel PDMS slab (bottom layer). Perform this step under a stereoscopic microscope at 4x to fully overlap the air microchannels with the medium microchannels.</li>
	<li>Place the assembled PDMS chip in a 70 &#176;C incubator for 1 h.</li>
	<li>Prepare several 1 mm inner diameter and 3 cm length latex hoses. Insert a 1 mm outer diameter and 1 cm long stainless-steel needle into one end of the prepared hose, and then insert a Luer into the other end of the hose to create the tube connected to the air and medium microchannels of the PDMS chip.</li>
	<li>Insert the prepared tubes into the outlets and inlets of the air and medium microchannels on the PDMS chip.</li>
</ol>
3. PDMS chip surface treatment and sterilization
<ol>
	<li>Infuse 2 mL of 80 mg/mL mouse collagen into the medium microchannel of the PDMS chip using a 2 mL syringe and incubate at room temperature for 30 min.</li>
	<li>After incubation, remove the collagen from the channel and recollect with a 2 mL syringe. Place the collagen-coated PDMS chips in a 60 &#176;C incubator overnight.</li>
	<li>Place the PDMS chips in a UV sterilizer for more than 1 h. Place the sterilized PDMS chips on an ultraclean bench in preparation for the cell experiment.</li>
</ol>
4. Cell seeding on the PDMS chip and cell stretching process
<ol>
	<li>Culture 4 x 105 primary human smooth muscle cells (HASMCs) from patients using smooth muscle cell medium (SMCM) containing 2% fetal bovine serum (FBS) and 1% penicillin-streptomycin in an 5% CO2 incubator at 37 &#176;C.</li>
	<li>When the HASMC density reaches 80%, discard the SMCM and wash the cells with 2 mL of PBS.</li>
	<li>Digest the cells using 1 mL of 0.25% trypsin for 2 min and centrifuge at 100 x g for 5 min. Remove the supernatant and resuspend the cell pellet in 1 mL of fresh SMCM. Use 8 mL of SMCM to culture the cells on a 10 cm culture dish.</li>
	<li>Calculate the cell number using a cytometer and use the cells at a final concentration of 2 x 105 cells/mL.</li>
	<li>Slowly pour 2 mL of PBS into the collagen-coated and sterilized PDMS chip medium microchannel and later discard using a 2 mL syringe.</li>
	<li>Slowly pour a total of 2 mL of 2 x 105 cells/mL HASMC suspension into the medium microchannel of the PDMS chip using a 2 mL syringe. Then, close the Luer at the entrance and exit of the PDMS chip. Place the PDMS chip in an incubator (5% CO2) at 37 &#176;C for 1 day.</li>
	<li>After the cells are attached to the PDMS membrane in the PDMS chip, nearly after 24 h, connect the outlet of the air microchannel on the PDMS chip to the vacuum controller system. When the cell is attached, an elongated, normal cellular form can be seen under the microscope, contrasting with the suspended round cells.</li>
	<li>Turn on the solenoid valve and the vacuum pump. Open the vacuum regulator and adjust the pressure level to 10 kPa for 7.18 &#177; 0.44% strain and 15 kPa for 17.28 &#177; 0.91% strain.</li>
	<li>After the parameters of the control system are set, place the PDMS chips in an incubator (5% CO2)&#160;at 37 &#176;C and stretch for 24 h.</li>
</ol>
5. Preparation of the mechanical control system
<ol>
	<li>Prepare several solenoid valves, vacuum filters, vacuum regulators, a vacuum pump, a peristaltic pump, and a programmable logic controller (PLC) controlling the solenoid valve.</li>
	<li>Program the PLC controller and set the on/off time interval to 1 Hz. Connect the solenoid valves to the programmed controller.</li>
	<li>Connect the inlet of the vacuum pump to the vacuum filters, and then connect the outlet of the vacuum filters to the vacuum regulators. Connect the outlet of the vacuum regulators to solenoid valves, and finally, connect the outlet of the solenoid valves to the outlets of the air microchannels of the PDMS chips.</li>
	<li>Connect the outlet of the peristaltic pump to the inlet of the medium microchannel of the PDMS chip and the inlet of the peristaltic pump to the outlet of the medium microchannel PDMS chip for culture medium replacement and drug handling.</li>
	<li>Adjust the amplitude of the strain by the regulator and the strain frequency by the microcontroller.</li>
</ol>

<ol>
	<li>Olsson, C., Thelin, S., St&#229;hle, E., Ekbom, A., Granath, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thoracic+aortic+aneurysm+and+dissection:+increasing+prevalence+and+improved+outcomes+reported+in+a+nationwide+population-based+study+of+more+than+14,000+cases+from+1987+to+2002.">Thoracic aortic aneurysm and dissection: increasing prevalence and improved outcomes reported in a nationwide population-based study of more than 14,000 cases from 1987 to 2002.</a> Circulation. 114 (24), 2611-2618 (2006).</li><li>van Varik, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+arterial+remodeling:+lessons+from+genetic+diseases.">Mechanisms of arterial remodeling: lessons from genetic diseases.</a> Frontiers in Genetics. 3 (290), 1-10 (2012).</li><li>Halka, A. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effects+of+stretch+on+vascular+smooth+muscle+cell+phenotype+in+vitro.">The effects of stretch on vascular smooth muscle cell phenotype in vitro.</a> Cardiovascular Pathology. 17 (2), 98-102 (2008).</li><li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arterial+wall+stress+induces+phenotypic+switching+of+arterial+smooth+muscle+cells+in+vascular+remodeling+by+activating+the+YAP/TAZ+signaling+pathway.">Arterial wall stress induces phenotypic switching of arterial smooth muscle cells in vascular remodeling by activating the YAP/TAZ signaling pathway.</a> Cellular Physiology and Biochemistry. 51 (2), 842-853 (2018).</li><li>Fabre, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introduction+to+a+manuscript+series+on+the+characterization+and+use+of+microphysiological+systems+(MPS)+in+pharmaceutical+safety+and+ADME+applications.">Introduction to a manuscript series on the characterization and use of microphysiological systems (MPS) in pharmaceutical safety and ADME applications.</a> Lab on a Chip. 20, 1049-1057 (2020).</li><li>Golding, H., Khurana, S., Zaitseva, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+is+the+predictive+value+of+animal+models+for+vaccine+efficacy+in+humans?+The+importance+of+bridging+studies+and+species-independent+correlates+of+protection.">What is the predictive value of animal models for vaccine efficacy in humans? The importance of bridging studies and species-independent correlates of protection.</a> Cold Spring Harbor Perspectives in Biology. 10 (4), 028902 (2018).</li><li>Ingber, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+organs-on-chips+for+disease+modelling,+drug+development+and+personalized+medicine.">Human organs-on-chips for disease modelling, drug development and personalized medicine.</a> Nature Reviews. Genetics. 25, 1-25 (2022).</li><li>Niu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+chip+for+odontoblasts+in+vitro.">Microfluidic chip for odontoblasts in vitro.</a> ACS Biomaterials Science &amp; Engineering. 5 (9), 4844-4851 (2019).</li><li>Huh, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reconstituting+organ-level+lung+functions+on+a+chip.">Reconstituting organ-level lung functions on a chip.</a> Science. 328 (5986), 1662-1668 (2010).</li><li>Musah, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mature+induced-pluripotent-stem-cell-derived+human+podocytes+reconstitute+kidney+glomerular-capillary-wall+function+on+a+chip.">Mature induced-pluripotent-stem-cell-derived human podocytes reconstitute kidney glomerular-capillary-wall function on a chip.</a> Nature Biomedical Engineering. 1 (69), 1-25 (2017).</li><li>Yoon No, D., Lee, K. H., Lee, J., Lee, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3D+liver+models+on+a+microplatform:+well-defined+culture,+engineering+of+liver+tissue+and+liver-on-a-chip.">3D liver models on a microplatform: well-defined culture, engineering of liver tissue and liver-on-a-chip.</a> Lab on a Chip. 15 (19), 3822-3837 (2015).</li><li>Bein, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+organ-on-a-chip+models+of+human+intestine.">Microfluidic organ-on-a-chip models of human intestine.</a> Cellular and Molecular Gastroenterology and Hepatology. 5 (4), 659-668 (2018).</li><li>Jastrzebska, E., Tomecka, E., Jesion, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heart-on-a-chip+based+on+stem+cell+biology.">Heart-on-a-chip based on stem cell biology.</a> Biosensors &amp; Bioelectronics. 75 (1), 67-81 (2016).</li><li>Rensen, S. S., Doevendans, P. A., van Eys, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+and+characteristics+of+vascular+smooth+muscle+cell+phenotypic+diversity.">Regulation and characteristics of vascular smooth muscle cell phenotypic diversity.</a> Netherlands Heart Journal. 15 (3), 100-108 (2007).</li><li>Perestrelo, A. R., &#193;guas, A. C., Rainer, A., Forte, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+organ/body-on-a-chip+devices+at+the+convergence+of+biology+and+microengineering.">Microfluidic organ/body-on-a-chip devices at the convergence of biology and microengineering.</a> Sensors. 15 (12), 31142-31170 (2015).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+cancer-on-a-chip+for+drug+screening.">Construction of cancer-on-a-chip for drug screening.</a> Drug Discovery Today. 26 (8), 1875-1890 (2021).</li><li>Yang, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+of+organ-on-a-chip+to+improve+cell+capture+efficiency.">Design of organ-on-a-chip to improve cell capture efficiency.</a> International Journal of Mechanical Sciences. 209, 106705 (2021).</li><li>Yang, Q., Lian, Q., Xu, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Perspective:+Fabrication+of+integrated+organ-on-a-chip+via+bioprinting.">Perspective: Fabrication of integrated organ-on-a-chip via bioprinting.</a> Biomicrofluidics. 11 (3), 031301 (2017).</li><li>Mohammed, M. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fabrication+of+microfluidic+devices:+improvement+of+surface+quality+of+CO2+laser+machined+poly+(methylmethacrylate)+polymer.">Fabrication of microfluidic devices: improvement of surface quality of CO2 laser machined poly (methylmethacrylate) polymer.</a> Journal of Micromechanics and Microengineering. 27 (1), 015021 (2017).</li><li>Tsao, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymer+microfluidics:+Simple,+low-cost+fabrication+process+bridging+academic+lab+research+to+commercialized+production.">Polymer microfluidics: Simple, low-cost fabrication process bridging academic lab research to commercialized production.</a> Micromachines. 7 (12), 225-236 (2016).</li><li>Kirschbaum, S. E., Baeumner, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+electrochemiluminescence+(ECL)+in+and+for+microfluidic+analytical+devices.">A review of electrochemiluminescence (ECL) in and for microfluidic analytical devices.</a> Analytical and Bioanalytical Chemistry. 407 (14), 3911-3926 (2015).</li><li>Stefanadis, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pressure-diameter+relation+of+the+human+aorta.+A+new+method+of+determination+by+the+application+of+a+special+ultrasonic+dimension+catheter.">Pressure-diameter relation of the human aorta. A new method of determination by the application of a special ultrasonic dimension catheter.</a> Circulation. 92 (8), 2210-2219 (1995).</li><li>Williams, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanical+influences+on+vascular+smooth+muscle+cell+function.">Mechanical influences on vascular smooth muscle cell function.</a> Journal of Hypertension. 16 (12), 1921-1929 (1998).</li><li>Abudupataer, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aorta+smooth+muscle-on-a-chip+reveals+impaired+mitochondrial+dynamics+as+a+therapeutic+target+for+aortic+aneurysm+in+bicuspid+aortic+valve+disease.">Aorta smooth muscle-on-a-chip reveals impaired mitochondrial dynamics as a therapeutic target for aortic aneurysm in bicuspid aortic valve disease.</a> eLife. 10, 69310 (2021).</li><li>Poussin, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3d+human+microvessel-on-a-chip+model+for+studying+monocyte-to-endothelium+adhesion+under+flow+-+application+in+systems+toxicology.">3d human microvessel-on-a-chip model for studying monocyte-to-endothelium adhesion under flow - application in systems toxicology.</a> Altex. 1, 47-63 (2020).</li><li>Yasotharan, S., Pinto, S., Sled, J. G., Bolz, S., Gunther, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Artery-on-a-chip+platform+for+automated,+multimodal+assessment+of+cerebral+blood+vessel+structure+and+function.">Artery-on-a-chip platform for automated, multimodal assessment of cerebral blood vessel structure and function.</a> Lab on a Chip. 15, 2660-2669 (2015).</li></ol>

The authors have nothing to disclose.

With the rapid development of microfluidic technology, OOC models that can replicate the biological function and structure of one or more organs in vitro have emerged in recent years for applications in biology, medicine, and pharmacology15. OOC can simulate key functions of the human physiological microenvironment, essential for exploring disease mechanisms and promoting preclinical drug translation8,16. Although OOC is still in ...

Thoracic aortic aneurysm and dissection (TAAD) is a localized dilatation or delamination of the aortic wall that is associated with high morbidity and mortality1. Human aortic smooth muscle cells (HASMCs) play a vital role in the pathogenesis of TAAD. HASMCs are not terminally differentiated cells, and HASMCs retain high plasticity, allowing them to switch phenotypes in response to different stimuli2. HASMCs are mainly subjected to rhythmic tensile strain in vivo, and this is one of the key factors regulating smooth muscle morphological changes, differentiation and physiological functions3,4. Therefore, the role of cyclic strain in the study of HASMCs cannot be ignored. However, conventional 2D cell cultures cannot replicate the biomechanical stimulation of cyclic strain experienced by HASMCs in vivo. Additionally, the construction of an animal TAAD model is not suitable for some types of TAAD, such as bicuspid aortic valve (BAV)-related TAAD. Moreover, the species gap between clinical human studies and animal experiments cannot be ignored. It hinders pharmaceutical translation in clinical practice. Thus, there is an urgent need for more complex and physiological systems to simulate the in vivo biomechanical environment in the research of aortic diseases.
Animal experiments used in biomedical research and drug development are costly, time-consuming, and ethically questionable. In addition, the results from animal studies frequently fail to predict the results obtained in human clinical trials5,6. The lack of human preclinical models and high failure rate in clinical trials have resulted in few effective drugs for the clinic, which has increased health care costs7. Thus, it is urgent to find other experimental models to complement animal models. Microfabrication and microfluidic techniques have developed greatly in recent years, providing novel techniques for establishing organoids-on-a-chip models that remedy the drawbacks of traditional 2D cell culture techniques and establish a more realistic, low-cost, and efficient in vitro model for physiological studies and drug development. Using microfluidic devices, organs-on-chips are established to culture living cells in micrometer-sized chambers with different stimuli to replicate the key functions of a tissue or organ. The system consists of single or multiple microfluidic microchannels, with either one kind of cell cultured in a perfused chamber replicating functions of one tissue type or different cell types cultured on porous membranes to recreate interfaces between different tissues. Microfluidic-based organoids combined with patient-derived cells have the unique advantage of bridging the large species difference between mouse and human disease models and overcoming the disadvantages of traditional 2D cell culture for disease mechanism research and drug discovery. With the rapid development of microfluidics in the past few years, researchers have realized the usefulness of in vitro organ-on-a-chip (OOC) models replicating complex in vivo biological parameters8. These microfluidic organoids simulate in vitro biomechanical environments, such as cyclic strain, shear stress, and liquid pressure, providing a three-dimensional (3D) cell culture environment. To date, several OOC models have been established to simulate biomechanical stimuli in organs such as the lung9, kidney10, liver11, intestine12, and heart13, but these have not been widely applied to the study of human aortic disease.
In this study, we present a human aorta smooth muscle cell organ-on-a-chip (HASMC-OOC) model that can control the biomimetic mechanical forces and rhythms applied to TAAD patient-derived primary HASMCs. The chip consists of three-layered thick plates of polydimethylsiloxane (PDMS) etched with channels and two commercialized highly flexible PDMS membranes. HASMCs are cultured on the PDMS membranes. The channel in the middle of the chip is filled with a culture medium for cell culture. The top and bottom channels of the chip are connected to a vacuum pressure supply system that can control the rhythm and frequency of mechanical tensile strain of the PDMS membranes. Rhythmic strain experienced by HASMCs can be simulated in HASMC-OOC, replicating the biomechanical microenvironment of tissue or organ not functionally achievable with conventional 2D culture systems. With the advantage of high-resolution, real-time imaging, and biomechanical microenvironment, the biochemical, genetic and metabolic activities of living cells can be studied for tissue development, organ physiology, disease etiology, molecular mechanisms and biomarker identification ,cardiovascular disease and aortic disease. Combined with tissue-specific and patient cells, this system can be used for drug screening, personalized medicine, and toxicity testing. This HASMC-OOC model provides a novel in vitro platform for studying the pathogenesis of the aortic disease.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>4% paraformaldehyde</td>
			<td>Beyotime</td>
			<td>P0099-100ml</td>
			<td>Used for cell immobilization</td>
		</tr>
		<tr>
			<td>Alexa Fluor 350-labeled Goat Anti-Rabbit IgG</td>
			<td>Beyotime</td>
			<td>A0408</td>
			<td>Antibodies used for immunostaining</td>
		</tr>
		<tr>
			<td>Bovine serum albumin</td>
			<td>Beyotime</td>
			<td>ST025-20g</td>
			<td></td>
		</tr>
		<tr>
			<td>Calcium AM/PI</td>
			<td>Invitrogen</td>
			<td>L3224</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell culture flask&#160;</td>
			<td>Corning</td>
			<td>430639</td>
			<td></td>
		</tr>
		<tr>
			<td>CNN1</td>
			<td>Abcam&#160;</td>
			<td>Ab46794</td>
			<td></td>
		</tr>
		<tr>
			<td>Commercial flexible 
			PDMS membrane</td>
			<td>Hangzhou Bald Advanced Materials</td>
			<td>KYQ-200</td>
			<td></td>
		</tr>
		<tr>
			<td>F-actin</td>
			<td>Invitrogen</td>
			<td>R415</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS</td>
			<td>Sigma</td>
			<td>M8318</td>
			<td></td>
		</tr>
		<tr>
			<td>Hoses</td>
			<td>Runze Fluid</td>
			<td>96410</td>
			<td>1 mm inner diameter; 3 mm outer diameter; 1 mm wall thickness; Official website address: https://www.runzefluidsystem.com</td>
		</tr>
		<tr>
			<td>Human aortic smooth 
			muscle cell line CRL1999</td>
			<td>ATCC</td>
			<td>Lot Number:70019189</td>
			<td></td>
		</tr>
		<tr>
			<td>Image J</td>
			<td>Imagej.net/fiji/downloads</td>
			<td>Free Download: https://fiji.sc</td>
			<td>Imaging platform that is used to identify fluorescence intensity</td>
		</tr>
		<tr>
			<td>Incubator</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td>Ensures that the temperature, 
			humidity, and light exposure is 
			exactly the same throughout 
			experiment.</td>
		</tr>
		<tr>
			<td>Luer</td>
			<td>Runze Fluid</td>
			<td>RH-M016</td>
			<td>Official website address: https://www.runzefluidsystem.com.</td>
		</tr>
		<tr>
			<td>Microscope</td>
			<td>Olympus</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>mouse collagen</td>
			<td>Sigma</td>
			<td>C7661</td>
			<td></td>
		</tr>
		<tr>
			<td>Oxygen plasma&#160;</td>
			<td>Changzhou Hongming Instrument</td>
			<td>HM-Plasma5L</td>
			<td></td>
		</tr>
		<tr>
			<td>Pasteur pipette</td>
			<td>Biologix</td>
			<td>30-0138A1</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS</td>
			<td>Beyotime</td>
			<td>C0221A</td>
			<td></td>
		</tr>
		<tr>
			<td>Pen-Strep</td>
			<td>Sigma</td>
			<td>P4458-100ml</td>
			<td>Antibiodics used to prevent bacterial 
			contamination of cells during culture.</td>
		</tr>
		<tr>
			<td>peristaltic pump</td>
			<td>Kamoer</td>
			<td>F01A-STP-B046</td>
			<td></td>
		</tr>
		<tr>
			<td>Petri dish</td>
			<td>Corning</td>
			<td>430167</td>
			<td></td>
		</tr>
		<tr>
			<td>PLC controller</td>
			<td>Zhejiang Jun Teng (BenT) CNC factory</td>
			<td>BR010-11T8X2M</td>
			<td>The detailed program setting can be found in supplementary. Official website address: files.http://www.btcnc.net</td>
		</tr>
		<tr>
			<td>polydimethylsiloxane (PDMS)</td>
			<td>Dow Corning</td>
			<td>Sylgard 184</td>
			<td></td>
		</tr>
		<tr>
			<td>SM22</td>
			<td>Abcam&#160;</td>
			<td>ab14106</td>
			<td></td>
		</tr>
		<tr>
			<td>SMCM</td>
			<td>ScienCell</td>
			<td>Cat 1101</td>
			<td></td>
		</tr>
		<tr>
			<td>solenoid valve</td>
			<td>SMC (China)</td>
			<td>VQZ300</td>
			<td></td>
		</tr>
		<tr>
			<td>Syringe</td>
			<td>Becton,Dickinson and Company</td>
			<td>300841</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton-X 100</td>
			<td>Beyotime</td>
			<td>ST795</td>
			<td>To penetrate cell membranes</td>
		</tr>
		<tr>
			<td>Trizol</td>
			<td>Invitrogen</td>
			<td>10296010</td>
			<td>Used for RNA extraction</td>
		</tr>
		<tr>
			<td>trypsin</td>
			<td>Sigma</td>
			<td>15400054</td>
			<td></td>
		</tr>
		<tr>
			<td>vacuum filter</td>
			<td>SMC (China)</td>
			<td>ZFC5-6</td>
			<td>Official website address: https://www.smc.com.cn</td>
		</tr>
		<tr>
			<td>vacuum pump</td>
			<td>Kamoer</td>
			<td>KVP15-KL-S</td>
			<td></td>
		</tr>
		<tr>
			<td>vacuum regulator</td>
			<td>AirTAC</td>
			<td>GVR-200-06</td>
			<td></td>
		</tr>
		<tr>
			<td>Primers</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer Name</td>
			<td>Forward (5&#8217; to 3&#8217;)</td>
			<td>Reverse (5&#8217; to 3&#8217;)</td>
			<td></td>
		</tr>
		<tr>
			<td>SM22</td>
			<td>CCGTGGAGATCCCAACTGG</td>
			<td>CCATCTGAAGGCCAATGACAT</td>
			<td></td>
		</tr>
		<tr>
			<td>CNN1</td>
			<td>CTCCATTGACTCGAACGACTC</td>
			<td>CAGGTCTGCGAAACTTCTTAGA</td>
			<td></td>
		</tr>
	</tbody>
</table>

construction of a human aorta smooth muscle cell organ-on-a-chip model for recapitulating biomechanical strain in the aortic wall

Conventional two-dimensional cell culture techniques and animal models have been used in the study of human thoracic aortic aneurysm and dissection (TAAD). However, human TAAD sometimes cannot be characterized by animal models. There is an apparent species gap between clinical human studies and animal experiments that may hinder the discovery of therapeutic drugs. In contrast, the conventional cell culture model is unable to simulate in vivo biomechanical stimuli. To this end, microfabrication and microfluidic techniques have developed greatly in recent years, providing novel techniques for establishing organoids-on-a-chip models that replicate the biomechanical microenvironment. In this study, a human aorta smooth muscle cell organ-on-a-chip (HASMC-OOC) model was developed to simulate the pathophysiological parameters of aortic biomechanics, including the amplitude and frequency of cyclic strain experienced by human aortic smooth muscle cells (HASMCs) that play a vital role in TAAD. In this model, the morphology of HASMCs became elongated in shape, aligned perpendicularly to the strain direction, and presented a more contractile phenotype under strain conditions than under static conventional conditions. This was consistent with the cell orientation and phenotype in native human aortic walls. Additionally, using bicuspid aortic valve-related TAAD (BAV-TAAD) and tricuspid aortic valve-related TAAD (TAV-TAAD) patient-derived primary HASMCs, we established BAV-TAAD and TAV-TAAD disease models, which replicate HASMC characteristics in TAAD. The HASMC-OOC model provides a novel in vitro platform that is complementary to animal models for further exploring the pathogenesis of TAAD and discovering therapeutic targets.

The HASMC-OOC model consists of a vacuum control system, a circulating system, and PDMS chips, and the schematic design of the HASMC-OOC model (Figure 1). The vacuum control system consists of a vacuum pump, solenoid valves, and a PLC controller. To act as the circulating system, a peristaltic pump was used to refresh the cell culture medium and add drugs. The PDMS chip was composed of two vacuum chambers and a middle chamber filled with SMCM for cell growth. According to the design of the c...

Watch this Scientific Journal Video about Construction of a Human Aorta Smooth Muscle Cell Organ-On-A-Chip Model for Recapitulating Biomechanical Strain in the Aortic Wall at JoVE.com

Construction of a Human Aorta Smooth Muscle Cell Organ-On-A-Chip Model for Recapitulating Biomechanical Strain in the Aortic Wall

Here, we developed a human aorta smooth muscle cell organ-on-a-chip model to replicate the in vivo biomechanical strain of smooth muscle cells in the human aortic wall.

Conventional two-dimensional cell culture techniques and animal models have been used in the study of human thoracic aortic aneurysm and dissection ...

construction-human-aorta-smooth-muscle-cell-organ-on-chip-model-for

Research

JoVE Journal

Bioengineering

2.9K Views.  Fudan University. Here, we developed a human aorta smooth muscle cell organ-on-a-chip model to replicate the in vivo biomechanical strain of smooth muscle cells in the human aortic wall.

Video: Construction of a Human Aorta Smooth Muscle Cell Organ-On-A-Chip Model for Recapitulating Biomechanical Strain in the Aortic Wall

Directed Cellular Self-Assembly to Fabricate Cell-Derived Tissue Rings for Biomechanical Analysis and Tissue Engineering

Each year, hundreds of thousands of patients undergo coronary artery bypass surgery in the United States.1 Approximately one third of these patients do not have suitable autologous donor vessels due to disease progression or previous harvest. The aim of vascular tissue engineering is to develop a suitable alternative source for these bypass grafts. In addition, engineered vascular tissue may prove valuable as living vascular models to study cardiovascular diseases. Several promising approaches to engineering blood vessels have been explored, with many recent studies focusing on development and analysis of cell-based methods.2-5 Herein, we present a method to rapidly self-assemble cells into 3D tissue rings that can be used in vitro to model vascular tissues.
To do this, suspensions of smooth muscle cells are seeded into round-bottomed annular agarose wells. The non-adhesive properties of the agarose allow the cells to settle, aggregate and contract around a post at the center of the well to form a cohesive tissue ring.6,7 These rings can be cultured for several days prior to harvesting for mechanical, physiological, biochemical, or histological analysis. We have shown that these cell-derived tissue rings yield at 100-500 kPa ultimate tensile strength8 which exceeds the value reported for other tissue engineered vascular constructs cultured for similar durations (&lt;30 kPa).9,10 Our results demonstrate that robust cell-derived vascular tissue ring generation can be achieved within a short time period, and offers the opportunity for direct and quantitative assessment of the contributions of cells and cell-derived matrix (CDM) to vascular tissue structure and function.

This article outlines a versatile method to create cell-derived tissue rings by cellular self-assembly. Smooth muscle cells seeded into ring-shaped agarose wells aggregate and contract to form robust three-dimensional (3D) tissues within 7 days. Millimeter-scale tissue rings are conducive to mechanical testing and serve as building blocks for tissue assembly.

Each year, hundreds of thousands of patients undergo coronary artery bypass surgery in the United States.1 Approximately one third of these patients do ...

Rotating Cell Culture Systems for Human Cell Culture: Human Trophoblast Cells as a Model

The field of human trophoblast research aids in understanding the complex environment established during placentation. Due to the nature of these studies, human in vivo experimentation is impossible. A combination of primary cultures, explant cultures and trophoblast cell lines1 support our understanding of invasion of the uterine wall2 and remodeling of uterine spiral arteries3,4 by extravillous trophoblast cells (EVTs), which is required for successful establishment of pregnancy. Despite the wealth of knowledge gleaned from such models, it is accepted that in vitro cell culture models using EVT-like cell lines display altered cellular properties when compared to their in vivo counterparts5,6. Cells cultured in the rotating cell culture system (RCCS) display morphological, phenotypic, and functional properties of EVT-like cell lines that more closely mimic differentiating in utero EVTs, with increased expression of genes mediating invasion (e.g. matrix metalloproteinases (MMPs)) and trophoblast differentiation7,8,9. The Saint Georges Hospital Placental cell Line-4 (SGHPL-4) (kindly donated by Dr. Guy Whitley and Dr. Judith Cartwright) is an EVT-like cell line that was used for testing in the RCCS.
The design of the RCCS culture vessel is based on the principle that organs and tissues function in a three-dimensional (3-D) environment. Due to the dynamic culture conditions in the vessel, including conditions of physiologically relevant shear, cells grown in three dimensions form aggregates based on natural cellular affinities and differentiate into organotypic tissue-like assemblies10,11,12 . The maintenance of a fluid orbit provides a low-shear, low-turbulence environment similar to conditions found in vivo. Sedimentation of the cultured cells is countered by adjusting the rotation speed of the RCCS to ensure a constant free-fall of cells. Gas exchange occurs through a permeable hydrophobic membrane located on the back of the bioreactor. Like their parental tissue in vivo, RCCS-grown cells are able to respond to chemical and molecular gradients in three dimensions (i.e. at their apical, basal, and lateral surfaces) because they are cultured on the surface of porous microcarrier beads. When grown as two-dimensional monolayers on impermeable surfaces like plastic, cells are deprived of this important communication at their basal surface. Consequently, the spatial constraints imposed by the environment profoundly affect how cells sense and decode signals from the surrounding microenvironment, thus implying an important role for the 3-D milieu13.
We have used the RCCS to engineer biologically meaningful 3-D models of various human epithelial tissues7,14,15,16. Indeed, many previous reports have demonstrated that cells cultured in the RCCS can assume physiologically relevant phenotypes that have not been possible with other models10,17-21. In summary, culture in the RCCS represents an easy, reproducible, high-throughput platform that provides large numbers of differentiated cells that are amenable to a variety of experimental manipulations. 
In the following protocol, using EVTs as an example, we clearly describe the steps required to three-dimensionally culture adherent cells in the RCCS.

Traditional, two dimensional cell culture techniques often result in altered characteristics with respect to differentiation markers, cytokines and growth factors. Three-dimensional cell culture in the rotating cell culture system (RCCS) reestablishes expression of many of these factors as shown here with an extravillous trophoblast cell line.

The field of human trophoblast research aids in  understanding the complex environment established during placentation. Due to the  nature of these ...

Improved Method for the Preparation of a Human Cell-based, Contact Model of the Blood-Brain Barrier

The blood-brain barrier (BBB) comprises impermeable but adaptable brain capillaries which tightly control the brain environment. Failure of the BBB has been implied in the etiology of many brain pathologies, creating a need for development of human in vitro BBB models to assist in clinically-relevant research. Among the numerous BBB models thus far described, a static (without flow), contact BBB model, where astrocytes and brain endothelial cells (BECs) are cocultured on the opposite sides of a porous membrane, emerged as a simplified yet authentic system to simulate the BBB with high throughput screening capacity. Nevertheless the generation of such model presents few technical challenges. Here, we describe a protocol for preparation of a contact human BBB model utilizing a novel combination of primary human BECs and immortalized human astrocytes. Specifically, we detail an innovative method for cell-seeding on inverted inserts as well as specify insert staining techniques and exemplify how we use our model for BBB-related research.

Establishment of human models of the blood-brain barrier (BBB) can benefit research into brain conditions associated with BBB failure. We describe here an improved technique for preparation of a contact BBB model, which permits coculturing of human astrocytes and brain endothelial cells on the opposite sides of a porous membrane.

The blood-brain barrier (BBB) comprises impermeable but adaptable brain capillaries which tightly control the brain environment. Failure of the BBB has ...

Tissue Engineering: Construction of a Multicellular 3D Scaffold for the Delivery of Layered Cell Sheets

Many tissues, such as the adult human hearts, are unable to adequately regenerate after damage.2,3 Strategies in tissue engineering propose innovations to assist the body in recovery and repair. For example, TE approaches may be able to attenuate heart remodeling after myocardial infarction (MI) and possibly increase total heart function to a near normal pre-MI level.4 As with any functional tissue, successful regeneration of cardiac tissue involves the proper delivery of multiple cell types with environmental cues favoring integration and survival of the implanted cell/tissue graft. Engineered tissues should address multiple parameters including: soluble signals, cell-to-cell interactions, and matrix materials evaluated as delivery vehicles, their effects on cell survival, material strength, and facilitation of cell-to-tissue organization. Studies employing the direct injection of graft cells only ignore these essential elements.2,5,6 A tissue design combining these ingredients has yet to be developed. Here, we present an example of integrated designs using layering of patterned cell sheets with two distinct types of biological-derived materials containing the target organ cell type and endothelial cells for enhancing new vessels formation in the &#8220;tissue&#8221;. Although these studies focus on the generation of heart-like tissue, this tissue design can be applied to many organs other than heart with minimal design and material changes, and is meant to be an off-the-shelf product for regenerative therapies. The protocol contains five detailed steps. A temperature sensitive Poly(N-isopropylacrylamide) (pNIPAAM) is used to coat tissue culture dishes. Then, tissue specific cells are cultured on the surface of the coated plates/micropattern surfaces to form cell sheets with strong lateral adhesions. Thirdly, a base matrix is created for the tissue by combining porous matrix with neovascular permissive hydrogels and endothelial cells. Finally, the cell sheets are lifted from the pNIPAAM coated dishes and transferred to the base element, making the complete construct.

For creation of highly organized structures of complex tissue, one must assemble multiple material and cell types into an integrated composite. This combinatorial design incorporates organ-specific layered cell sheets with two distinct biologically-derived materials containing a strong fibrous matrix base, and endothelial cells for enhancing new vessels formation.

Many tissues, such as the adult human hearts, are unable to adequately regenerate after damage.2,3 Strategies in tissue engineering propose innovations to ...

The Encapsulation of Cell-free Transcription and Translation Machinery in Vesicles for the Construction of Cellular Mimics

As interest shifts from individual molecules to systems of molecules, an increasing number of laboratories have sought to build from the bottom up cellular mimics that better represent the complexity of cellular life. To date there are a number of paths that could be taken to build compartmentalized cellular mimics, including the exploitation of water-in-oil emulsions, microfluidic devices, and vesicles. Each of the available options has specific advantages and disadvantages. For example, water-in-oil emulsions give high encapsulation efficiency but do not mimic well the permeability barrier of living cells. The primary advantage of the methods described herein is that they are all easy and cheap to implement. Transcription-translation machinery is encapsulated inside of phospholipid vesicles through a process that exploits common instrumentation, such as a centrifugal evaporator and an extruder. Reactions are monitored by fluorescence spectroscopy. The protocols can be adapted for recombinant protein expression, the construction of cellular mimics, the exploration of the minimum requirements for cellular life, or the assembly of genetic circuitry.

Herein we describe simple methods for the preparation of vesicles, the encapsulation of transcription and translation machinery, and the monitoring of protein production. The resulting cell-free systems can be used as a starting point from which to build increasingly complex cellular mimics.

As interest shifts from individual molecules to systems of molecules, an increasing number of laboratories have sought to build from the bottom up ...

Production, Characterization and Potential Uses of a 3D Tissue-engineered Human Esophageal Mucosal Model

The incidence of both esophageal adenocarcinoma and its precursor, Barrett&#8217;s Metaplasia, are rising rapidly in the western world. Furthermore esophageal adenocarcinoma generally has a poor prognosis, with little improvement in survival rates in recent years. These are difficult conditions to study and there has been a lack of suitable experimental platforms to investigate disorders of the esophageal mucosa.
A model of the human esophageal mucosa has been developed in the MacNeil laboratory which, unlike conventional 2D cell culture systems, recapitulates the cell-cell and cell-matrix interactions present in vivo and produces a mature, stratified epithelium similar to that of the normal human esophagus. Briefly, the model utilizes non-transformed normal primary human esophageal fibroblasts and epithelial cells grown within a porcine-derived acellular esophageal scaffold. Immunohistochemical characterization of this model by CK4, CK14, Ki67 and involucrin staining demonstrates appropriate recapitulation of the histology of the normal human esophageal mucosa.
This model provides a robust, biologically relevant experimental model of the human esophageal mucosa. It can easily be manipulated to investigate a number of research questions including the effectiveness of pharmacological agents and the impact of exposure to environmental factors such as alcohol, toxins, high temperature or gastro-esophageal refluxate components. The model also facilitates extended culture periods not achievable with conventional 2D cell culture, enabling, inter alia, the study of the impact of repeated exposure of a mature epithelium to the agent of interest for up to 20 days. Furthermore, a variety of cell lines, such as those derived from esophageal tumors or Barrett&#8217;s Metaplasia, can be incorporated into the model to investigate processes such as tumor invasion and drug responsiveness in a more biologically relevant environment.

This manuscript describes the production, characterization and potential uses of a tissue engineered 3D esophageal construct prepared from normal primary human esophageal fibroblast and squamous epithelial cells seeded within a de-cellularized porcine scaffold. The results demonstrate the formation of a mature stratified epithelium similar to the normal human esophagus.

The incidence of both esophageal adenocarcinoma and its precursor, Barrett&#8217;s Metaplasia, are rising rapidly in the western world. Furthermore ...

Adapting the Electrospinning Process to Provide Three Unique Environments for a Tri-layered In Vitro Model of the Airway Wall

Electrospinning is a highly adaptable method producing porous 3D fibrous scaffolds that can be exploited in in vitro cell culture. Alterations to intrinsic parameters within the process allow a high degree of control over scaffold characteristics including fiber diameter, alignment and porosity. By developing scaffolds with similar dimensions and topographies to organ- or tissue-specific extracellular matrices (ECM), micro-environments representative to those that cells are exposed to in situ can be created. 
The airway bronchiole wall, comprised of three main micro-environments, was selected as a model tissue. Using decellularized airway ECM as a guide, we electrospun the non-degradable polymer, polyethylene terephthalate (PET), by three different protocols to produce three individual electrospun scaffolds optimized for epithelial, fibroblast or smooth muscle cell-culture. Using a commercially available bioreactor system, we stably co-cultured the three cell-types to provide an in vitro model of the airway wall over an extended time period.
This model highlights the potential for such methods being employed in in vitro diagnostic studies investigating important inter-cellular cross-talk mechanisms or assessing novel pharmaceutical targets, by providing a relevant platform to allow the culture of fully differentiated adult cells within 3D, tissue-specific environments.

Adapting the Electrospinning Process to Provide Three Unique Environments for a Tri-layered In Vitro Model of the Airway Wall

Advancements in biomaterial technologies enable the development of three-dimensional multi-cell-type constructs. We have developed electrospinning protocols to produce three individual scaffolds to culture the main structural cells of the airway to provide a 3D in vitro model of the airway bronchiole wall.

Electrospinning is a highly adaptable method producing porous 3D fibrous scaffolds that can be exploited in in vitro cell culture. Alterations to ...

Construction of Defined Human Engineered Cardiac Tissues to Study Mechanisms of Cardiac Cell Therapy

Human cardiac tissue engineering can fundamentally impact therapeutic discovery through the development of new species-specific screening systems that replicate the biofidelity of three-dimensional native human myocardium, while also enabling a controlled level of biological complexity, and allowing non-destructive longitudinal monitoring of tissue contractile function. Initially, human engineered cardiac tissues (hECT) were created using the entire cell population obtained from directed differentiation of human pluripotent stem cells, which typically yielded less than 50% cardiomyocytes. However, to create reliable predictive models of human myocardium, and to elucidate mechanisms of heterocellular interaction, it is essential to accurately control the biological composition in engineered tissues. 
To address this limitation, we utilize live cell sorting for the cardiac surface marker SIRP&#945; and the fibroblast marker CD90 to create tissues containing a 3:1 ratio of these cell types, respectively, that are then mixed together and added to a collagen-based matrix solution. Resulting hECTs are, thus, completely defined in both their cellular and extracellular matrix composition.
Here we describe the construction of defined hECTs as a model system to understand mechanisms of cell-cell interactions in cell therapies, using an example of human bone marrow-derived mesenchymal stem cells (hMSC) that are currently being used in human clinical trials. The defined tissue composition is imperative to understand how the hMSCs may be interacting with the endogenous cardiac cell types to enhance tissue function. A bioreactor system is also described that simultaneously cultures six hECTs in parallel, permitting more efficient use of the cells after sorting.

This manuscript describes the creation of defined engineered cardiac tissues using surface marker expression and cell sorting. The defined tissues can then be used in a multi-tissue bioreactor to investigate mechanisms of cardiac cell therapy in order to provide a functional, yet controlled, model system of the human heart.

Human cardiac tissue engineering can fundamentally impact therapeutic discovery through the development of new species-specific screening systems that ...

Lucifer Yellow - A Robust Paracellular Permeability Marker in a Cell Model of the Human Blood-brain Barrier

The blood-brain barrier BBB consists of endothelial cells that form a barrier between the systemic circulation and the brain to prevent the exchange of non-essential ions and toxic substances. Tight junctions (TJ) effectively seal the paracellular space in the monolayers resulting in an intact barrier. This study describes a LY-based fluorescence assay that can be used to determine its apparent permeability coefficient (Papp) and in turn can be used to determine the kinetics of the formation of confluent monolayers and the resulting tight junction barrier integrity in hCMEC/D3 monolayers. We further demonstrate an additional utility of this assay to determine TJ functional integrity in transfected cells. Our data from the LY Papp assay shows that the hCMEC/D3 cells seeded in a transwell setup effectively limit LY paracellular transport 7 days-post culture. As an additional utility of the presented assay, we also demonstrate that the DNA nanoparticle transfection does not alter LY paracellular transport in hCMEC/D3 monolayers.

We present a fluorescence assay to demonstrate that Lucifer Yellow (LY) is a robust marker to determine the apparent paracellular permeability of hCMEC/D3 cell monolayers, an in vitro model of the human blood-brain barrier. We used this assay to determine the kinetics of a confluent monolayer formation in cultured hCMEC/D3 cells.

The blood-brain barrier BBB consists of endothelial cells that form a barrier between the systemic circulation and the brain to prevent the exchange of ...

A Human 3D Extracellular Matrix-Adipocyte Culture Model for Studying Matrix-Cell Metabolic Crosstalk

The extracellular matrix (ECM) plays a central role in regulating tissue homeostasis, engaging in crosstalk with cells and regulating multiple aspects of cellular function. The ECM plays a particularly important role in adipose tissue function in obesity, and alterations in adipose tissue ECM deposition and composition are associated with metabolic disease in mice and humans. Tractable in vitro models that permit dissection of the roles of the ECM and cells in contributing to global tissue phenotype are sparse. We describe a novel 3D in vitro model of human ECM-adipocyte culture that permits study of the specific roles of the ECM and adipocytes in regulating adipose tissue metabolic phenotype. Human adipose tissue is decellularized to isolate ECM, which is subsequently repopulated with preadipocytes that are then differentiated within the ECM into mature adipocytes. This method creates ECM-adipocyte constructs that are metabolically active and retain characteristics of the tissues and patients from which they are derived. We have used this system to demonstrate disease-specific ECM-adipocyte crosstalk in human adipose tissue. This culture model provides a tool for dissecting the roles of the ECM and adipocytes in contributing to global adipose tissue metabolic phenotype and permits study of the role of the ECM in regulating adipose tissue homeostasis.

We describe a 3D human extracellular matrix-adipocyte in vitro culture system that permits dissection of the roles of the matrix and adipocytes in contributing to adipose tissue metabolic phenotype.

The extracellular matrix (ECM) plays a central role in regulating tissue homeostasis, engaging in crosstalk with cells and regulating multiple aspects of ...