This work was supported by the National Science Centre, Poland (Grant/Award Number: 2018/31/D/NZ2/03901).

1. Preparation of the siRNA mixture
<ol>
	<li>One day before the start of the experiment, seed cells (e.g., HeLa) on a 100 mm dish so that they reach 70%-90% confluence the next day. 
	NOTE: All operations must be carried out under sterile conditions in a laminar flow chamber.</li>
	<li>Prepare the appropriate amount of siRNA diluted to a concentration of 140 nM in Opti-MEM medium (see Table of Materials). A 96-well plate can be used as a reservoir.</li>
	<li>Add 5 &#181;L of the siRNA solution (or Opti-MEM medium for the control samples) to each well of a black 384-well cell culture microplate. 
	NOTE: Depending on the number of siRNA samples tested, an electronic or multi-channel pipette can be used.</li>
	<li>Prepare the appropriate amount of RNAiMAX transfection reagent solution (see Table of Materials) in Opti-MEM medium. Add 1 &#181;L of RNAiMAX for every 100 &#181;L of medium.</li>
	<li>Add 10 &#181;L of the transfection reagent solution to each well of the 384-well plate. The most convenient and fastest way to do this is with a reagent dispenser.</li>
	<li>Incubate the siRNA with the transfection reagent for 30 min at room temperature.</li>
</ol>
2. Preparation of cells for transfection
<ol>
	<li>During the incubation (step 1.6), aspirate the medium using a suction device (see Table of Materials), and wash the cells with 3 mL of PBS.</li>
	<li>Add 1.5 mL of trypsin diluted 1:2 in PBS, and incubate the cells at 37 &#176;C for 10 min.</li>
	<li>Check if the cells have detached; if so, add 3 mL of DMEM medium with 10% FBS. Suspend the cells thoroughly, and transfer them to a 15 mL tube. Take at least 150 &#181;L of the suspension, and count the cells in a cell-counting chamber (see Table of Materials).</li>
	<li>Prepare a cell suspension at the appropriate concentration (35,000/mL for the HeLa line) in DMEM medium with 10% FBS, penicillin, and streptomycin.</li>
</ol>
3. Cell transfection
<ol>
	<li>Add 20 &#181;L of the cell suspension to each well of the 384-well plate using the reagent dispenser. This will result in 700 cells seeded per well.</li>
	<li>Incubate the cells for 1 h at room temperature, and then place them in the incubator for 72 h (37 &#176;C and 5% CO2).</li>
</ol>
4. BrdU incorporation
<ol>
	<li>Prepare a 90 &#181;M solution of BrdU (see Table of Materials) in DMEM medium with 10% FBS.</li>
	<li>At 56 h after the siRNA transfection (16 h before cell fixation), add 10 &#181;L of 90 &#181;M BrdU solution to each well of the 384-well plate (the final BrdU concentration is 20 &#181;M). 
	NOTE: The action should be performed as fast as possible; therefore, it is best to use a reagent dispenser, electronic pipette, or multi-dispenser pipette. Remember to prepare control wells without the addition of BrdU.</li>
	<li>Incubate the cells for 16 h (37 &#176;C and 5% CO2).</li>
</ol>
5. Labeling of mitochondria
<ol>
	<li>Prepare a 20 &#181;M solution of BrdU in DMEM with 10% FBS, and add to it the mitochondria tracking dye solution (see Table of Materials) to a concentration of 1.1 &#181;M.</li>
	<li>At 15 h after the start of BrdU incorporation (1 h before cell fixation), add 10 &#181;L of the mitochondria tracking dye solution (see Table of Materials) to each well of the 384-well plate (the final dye concentration is 200 nM). 
	NOTE: Use a reagent dispenser, electronic pipette, or multi-dispenser pipette. Remember to retain control wells without the addition of BrdU but with the addition of the mitochondria tracking dye.</li>
	<li>Incubate the cells for 1 h (37 &#176;C and 5% CO2).</li>
</ol>
6. Cell fixation
NOTE: All washing is most conveniently carried out using a microplate washer, while the addition of reagents is most quickly carried out using a reagent dispenser.
<ol>
	<li>Using the microplate washer (see Table of Materials), rinse each well twice with 100 &#181;L of PBS. After the second wash, leave 25 &#181;L of PBS in the well. 
	NOTE: Leaving PBS in the well reduces the likelihood of cell detachment during the addition of liquid in the next step. All the washes are completed with the PBS left in; therefore, the solution added in the next step should always be prepared at a 2x concentration as it will be added in an equal volume to the remaining PBS.</li>
	<li>Fix the cells by adding 25 &#181;L of an 8% formaldehyde solution in PBS with 0.4% Triton X-100 and Hoechst 33342 at a concentration of 4 &#181;g/mL (the final concentrations of individual reagents are 4%, 0.2%, and 2 &#181;g/mL, respectively) (see Table of Materials).</li>
	<li>Incubate the plate in the dark at room temperature for 30 min.</li>
</ol>
7. Blocking
<ol>
	<li>Rinse each well four times with 100 &#181;L of PBS. After the last wash, leave 25 &#181;L of PBS in the well.</li>
	<li>Add 25 &#181;L of 6% BSA in PBS (the final BSA concentration is 3%) to each well.</li>
	<li>Incubate the plate in the dark at room temperature for 30 min.</li>
</ol>
8. Addition of the primary antibodies
<ol>
	<li>Aspirate the BSA using a microplate washer, and leave 10 &#181;L of solution in the well.</li>
	<li>Add 10 &#181;L of the primary antibody solution prepared in 3% BSA in PBS. Use anti-BrdU at 0.8 &#181;g/mL and anti-DNA at 0.4 &#181;g/mL (the final concentrations of antibodies are 0.4 &#181;g/mL and 0.2 &#181;g/mL, respectively) (see Table of Materials).</li>
	<li>Incubate the plate in the dark at 4 &#176;C overnight.</li>
</ol>
9. Addition of the secondary antibodies
<ol>
	<li>Rinse each well four times with 100 &#181;L of PBS. After the last wash, leave 10 &#181;L of PBS in the well.</li>
	<li>Add 10 &#181;L of the 4 &#181;g/mL secondary antibody solution prepared in 6% BSA in PBS (the final concentration is 2 &#181;g/mL). Use isotype-specific antibodies (anti-mouse IgG1 and anti-mouse IgM) conjugated to fluorochromes such as Alexa Fluor 488 and Alexa Fluor 555 (see Table of Materials).</li>
	<li>Incubate the plate in the dark at room temperature for 1 h.</li>
	<li>Rinse each well four times with 100 &#181;L of PBS. After the last wash, leave 50 &#181;L of PBS in the well.</li>
	<li>Seal the plate with an adhesive sealing film (see Table of Materials), and store it in the dark at 4 &#176;C. Imaging must be performed within 2 weeks.</li>
</ol>
10. Imaging
NOTE: Imaging must be performed with an automated wide-field microscope; the microscope must be equipped with a motor stage supplied with controls to image individual areas of the plate automatically.
<ol>
	<li>Check the autofocus settings in the corner areas of the plate (wells A1, A24, P24, P1) and in the center. 
	NOTE: For imaging, it is recommended to use a 20x short working distance objective (see Table of Materials) with the highest possible numerical aperture.</li>
	<li>Based on the intensity histograms generated by the imaging software in live view mode, select a sufficiently long exposure time for the individual fluorescence channels so that the resulting image is not oversaturated.</li>
	<li>Set the appropriate number of planes for imaging on the z-axis. 
	NOTE: The field of view at 20x magnification is large enough that not all cells are in the same plane of focus, so z-sectioning must be performed to view all the cells in their correct plane of focus. Usually, five planes are enough. Depending on the availability of disk space, individual z-stacks or only maximum intensity projections can be saved. The image analysis shown in the representative results section is based on maximum intensity projections.</li>
	<li>Select the appropriate number of fields of view to display per well. 
	NOTE: Depending on the confluence, approximately 60-300 cells can be imaged in one field of view. Typically, for HeLa cells with a confluence of 60%-90%, imaging five fields of view will allow one to analyze from 500 cells to over 1,000 cells.</li>
	<li>Select the wells to be imaged, and start imaging.</li>
</ol>
11. Quantitative image analysis
NOTE: The quantitative analysis of acquired images can be performed using an open-source software such as Cell Profiler15. For the present study, the analysis was performed using the ScanR 3.0.0 software (see Table of Materials).
<ol>
	<li>Start the analysis by performing background correction for all the images from all the fluorescence channels. Depending on the size of the analyzed objects, select the appropriate filter size: 80 pixels for cell nuclei and 4 pixels for BrdU and mtDNA spots.</li>
	<li>Start segmenting the image by creating a mask of the main object based on the ratio of the intensity of the fluorescence signal to the background for the channel corresponding to the cell nuclei.</li>
	<li>Create masks for the sub-objects representing the BrdU and mtDNA spots, respectively, using the fluorescence channels appropriate for the given structures. 
	NOTE: Each sub-object is assigned to the closest main object (cell nucleus).</li>
	<li>Set the parameters to be measured during the analysis, and measure the intensity of the individual pixels within each mask for all the fluorescence channels. 
	NOTE: It is also necessary to calculate the number of sub-objects assigned to a given cell nucleus and the area of each sub-object.</li>
	<li>Define the derived parameters to be calculated based on the obtained data. To obtain the total fluorescence intensities for the BrdU or mtDNA channel, sum up the intensities of all the sub-objects assigned to a given cell nucleus. To obtain the mean fluorescence intensity, divide the total fluorescence intensity by the sum of the area of the sub-objects assigned to a given cell nucleus. 
	NOTE: To ensure that the created sub-object (BrdU or mtDNA spot) is actually located in the mitochondria, it is necessary to gate them based on the fluorescence intensity from the mitochondria tracking dye.</li>
	<li>Perform further analysis of the data obtained with the ScanR software using the R 4.2.2 statistical Software16 along with the following packages: dplyr17, data.table18, ggplot219,&#160;and ggpubr20. This step is optional.</li>
</ol>

High-Throughput Quantification of the Synthesis and Distribution of mtDNA

<ol>
	<li>Brown, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+respiration+and+ATP+synthesis+in+mammalian+mitochondria+and+cells.">Control of respiration and ATP synthesis in mammalian mitochondria and cells.</a> The Biochemical Journal. 284, 1-13 (1992).</li><li>Zhang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+basis+and+metabolic+interplay+of+redox+regulation).">Biochemical basis and metabolic interplay of redox regulation).</a> Redox Biology. 26, 101284 (2019).</li><li>Pizzo, P., Drago, I., Filadi, R., Pozzan, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+Ca2++homeostasis:+Mechanism,+role,+and+tissue+specificities.">Mitochondrial Ca2+ homeostasis: Mechanism, role, and tissue specificities.</a> Pflugers Archiv: European Journal of Physiology. 464 (1), 3-17 (2012).</li><li>Shadel, G. S., Horvath, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+ROS+signaling+in+organismal+homeostasis.">Mitochondrial ROS signaling in organismal homeostasis.</a> Cell. 163 (3), 560-569 (2015).</li><li>Mart&#237;nez-Reyes, I., Chandel, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+TCA+cycle+metabolites+control+physiology+and+disease.">Mitochondrial TCA cycle metabolites control physiology and disease.</a> Nature Communications. 11 (1), 102 (2020).</li><li>Galluzzi, L., Kepp, O., Trojel-Hansen, C., Kroemer, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+control+of+cellular+life,+stress,+and+death.">Mitochondrial control of cellular life, stress, and death.</a> Circulation Research. 111 (9), 1198-1207 (2012).</li><li>Rone, M. B., Fan, J., Papadopoulos, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cholesterol+transport+in+steroid+biosynthesis:+role+of+protein-protein+interactions+and+implications+in+disease+states.">Cholesterol transport in steroid biosynthesis: role of protein-protein interactions and implications in disease states.</a> Biochimica Et Biophysica Acta. 1791 (7), 646-658 (2009).</li><li>Swenson, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+synthesis+to+utilization:+The+ins+and+outs+of+mitochondrial+heme.">From synthesis to utilization: The ins and outs of mitochondrial heme.</a> Cells. 9 (3), 579 (2020).</li><li>West, A. P., Shadel, G. S., Ghosh, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondria+in+innate+immune+responses.">Mitochondria in innate immune responses.</a> Nature Reviews. Immunology. 11 (6), 389-402 (2011).</li><li>Nunnari, J., Suomalainen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondria:+In+sickness+and+in+health.">Mitochondria: In sickness and in health.</a> Cell. 148 (6), 1145-1159 (2012).</li><li>Pohjoism&#228;ki, J. L. O., Goffart, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Of+circles,+forks+and+humanity:+Topological+organisation+and+replication+of+mammalian+mitochondrial+DNA.">Of circles, forks and humanity: Topological organisation and replication of mammalian mitochondrial DNA.</a> BioEssays. 33 (4), 290-299 (2011).</li><li>Gustafsson, C. M., Falkenberg, M., Larsson, N. -. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+and+expression+of+mammalian+mitochondrial+DNA.">Maintenance and expression of mammalian mitochondrial DNA.</a> Annual Review of Biochemistry. 85, 133-160 (2016).</li><li>Nicholls, T. J., Gustafsson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separating+and+segregating+the+human+mitochondrial+genome.">Separating and segregating the human mitochondrial genome.</a> Trends in Biochemical Sciences. 43 (11), 869-881 (2018).</li><li>Gratzner, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibody+to+5-bromo-+and+5-iododeoxyuridine:+A+new+reagent+for+detection+of+DNA+replication.">Monoclonal antibody to 5-bromo- and 5-iododeoxyuridine: A new reagent for detection of DNA replication.</a> Science. 218 (4571), 474-475 (1982).</li><li>Stirling, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CellProfiler+4:+Improvements+in+speed,+utility+and+usability.">CellProfiler 4: Improvements in speed, utility and usability.</a> BMC Bioinformatics. 22 (1), 433 (2021).</li><li>R Core Team. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=R:+A+Language+and+Environment+for+Statistical+Computing.">R: A Language and Environment for Statistical Computing.</a> R Foundation for Statistical Computing. , (2021).</li><li>. dplyr: A Grammar of Data Manipulation Available from: <a target="_blank" href="https://CRAN.R-project.org/package=dplyr">https://CRAN.R-project.org/package=dplyr</a> (2021)</li><li>. data.table: Extension of `data.frame Available from: <a target="_blank" href="https://CRAN.R-project.org/package=data.table">https://CRAN.R-project.org/package=data.table</a> (2020)</li><li>. ggplot2: Elegant graphics for data analysis Available from: <a target="_blank" href="https://ggplot2.tidyverse.org">https://ggplot2.tidyverse.org</a> (2016)</li><li>. ggpubr: &amp;#34;ggplot2&amp;#34; based publication ready plots Available from: <a target="_blank" href="https://CRAN.R-project.org/package=ggpubr">https://CRAN.R-project.org/package=ggpubr</a> (2020)</li><li>Hashiguchi, K., Zhang-Akiyama, Q. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+human+cell+lines+lacking+mitochondrial+DNA.">Establishment of human cell lines lacking mitochondrial DNA.</a> Methods in Molecular Biology. 554, 383-391 (2009).</li><li>Piechota, J., Szczesny, R., Wolanin, K., Chlebowski, A., Bartnik, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+and+mitochondrial+genome+responses+in+HeLa+cells+treated+with+inhibitors+of+mitochondrial+DNA+expression.">Nuclear and mitochondrial genome responses in HeLa cells treated with inhibitors of mitochondrial DNA expression.</a> Acta Biochimica Polonica. 53 (3), 485-495 (2006).</li><li>Spelbrink, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+mitochondrial+DNA+deletions+associated+with+mutations+in+the+gene+encoding+Twinkle,+a+phage+T7+gene+4-like+protein+localized+in+mitochondria.">Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 gene 4-like protein localized in mitochondria.</a> Nature Genetics. 28 (3), 223-231 (2001).</li><li>Campbell, C. T., Kolesar, J. E., Kaufman, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+transcription+factor+A+regulates+mitochondrial+transcription+initiation,+DNA+packaging,+and+genome+copy+number.">Mitochondrial transcription factor A regulates mitochondrial transcription initiation, DNA packaging, and genome copy number.</a> Biochimica et Biophysica Acta. 1819 (9-10), 921-929 (2012).</li><li>Krasich, R., Copeland, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+polymerases+in+the+mitochondria:+A+critical+review+of+the+evidence.">DNA polymerases in the mitochondria: A critical review of the evidence.</a> Frontiers in Bioscience. 22 (4), 692-709 (2017).</li><li>Kotrys, A. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+proteomics+revealed+C6orf203/MTRES1+as+a+factor+preventing+stress-induced+transcription+deficiency+in+human+mitochondria.">Quantitative proteomics revealed C6orf203/MTRES1 as a factor preventing stress-induced transcription deficiency in human mitochondria.</a> Nucleic Acids Research. 47 (14), 7502-7517 (2019).</li><li>Gratzner, H. G., Pollack, A., Ingram, D. J., Leif, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deoxyribonucleic+acid+replication+in+single+cells+and+chromosomes+by+immunologic+techniques.">Deoxyribonucleic acid replication in single cells and chromosomes by immunologic techniques.</a> Journal of Histochemistry &amp; Cytochemistry. 24 (1), 34-39 (1976).</li><li>Leif, R. C., Stein, J. H., Zucker, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+short+history+of+the+initial+application+of+anti-5-BrdU+to+the+detection+and+measurement+of+S+phase.">A short history of the initial application of anti-5-BrdU to the detection and measurement of S phase.</a> Cytometry. Part A: The Journal of the International Society for Analytical Cytology. 58 (1), 45-52 (2004).</li><li>Lentz, S. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+(mtDNA)+biogenesis:+visualization+and+duel+incorporation+of+BrdU+and+EdU+into+newly+synthesized+mtDNA+in+vitro.">Mitochondrial DNA (mtDNA) biogenesis: visualization and duel incorporation of BrdU and EdU into newly synthesized mtDNA in vitro.</a> The Journal of Histochemistry and Cytochemistry. 58 (2), 207-218 (2010).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multi-omic+measurements+of+heterogeneity+in+HeLa+cells+across+laboratories.">Multi-omic measurements of heterogeneity in HeLa cells across laboratories.</a> Nature Biotechnology. 37 (3), 314-322 (2019).</li></ol>

The authors have nothing to disclose.

Historically, DNA labeling by BrdU incorporation and antibody detection has been used in nuclear DNA replication and cell cycle research14,27,28. So far, all the protocols for detecting BrdU-labeled DNA have included a DNA denaturation step (acidic or thermal) or enzyme digestion (DNase or proteinase) to enable epitope exposure and facilitate antibody penetration. These protocols were developed for tightly packed nuclear DNA. Ho...

For most eukaryotic cells mitochondria are essential organelles, as they play a crucial role in numerous cellular processes. First and foremost, mitochondria are the key energy suppliers of cells1. Mitochondria are also involved in regulating cellular homeostasis (for instance, intracellular redox2 and the calcium balance3), cell signaling4,5, apoptosis6, the synthesis of different biochemical compounds7,8, and the innate immune response9. Mitochondrial dysfunction is associated with various pathological states and human diseases10. 
The functioning of mitochondria depends on the genetic information located in two separate genomes: the nuclear and mitochondrial genomes. The mitochondrial genome encodes a small number of genes compared to the nuclear genome, but all the mtDNA-encoded genes are essential for human life. The mitochondrial protein machinery necessary to maintain the mtDNA is encoded by nDNA. The basic components of the mitochondrial replisome, as well as some mitochondrial biogenesis factors, have already been identified (reviewed in previous research11,12). However, mitochondrial DNA replication and maintenance mechanisms are still far from being understood. In contrast to nDNA, the mitochondrial genome exists in multiple copies, which provides an additional layer for regulating mitochondrial gene expression. Much less is currently known about the distribution and segregation of mtDNA within organelles, to what extent these processes are regulated, and if they are, which proteins are involved13. The segregation pattern is crucial when cells contain a mixed population of wild-type and mutated mtDNA. Their unequal distribution may lead to the generation of cells with a detrimental amount of mutated mtDNA.
So far, the protein factors necessary for mtDNA maintenance have been identified mainly by biochemical methods, bioinformatic analyses, or through disease-associated studies. In this work, in order to ensure a high chance of identifying factors that have previously escaped identification, a different strategy is described. The method is based on the labeling of mtDNA during replication or repair with 5-bromo-2'-deoxyuridine (BrdU), a nucleoside analog of thymidine. BrdU is readily incorporated into nascent DNA strands during DNA synthesis and, in general, is used for monitoring the replication of nuclear DNA14. However, the procedure developed here has been optimized for detecting BrdU incorporated into mtDNA using the immunofluorescence of anti-BrdU antibodies.
The approach allows for the high-throughput quantification of mtDNA synthesis and distribution in human cells cultured in vitro. A high-throughput strategy is necessary to conduct tests under different experimental conditions in a relatively short time; therefore, it is proposed in the protocol to utilize a multi-well format for cell culturing and automated fluorescence microscopy for imaging. The protocol includes the transfection of human HeLa cells with an siRNA library and the subsequent monitoring of mtDNA replication or repair using the metabolic labeling of newly synthesized DNA with BrdU. This approach is combined with immunostaining of the DNA with the help of anti-DNA antibodies. Both parameters are analyzed using quantitative fluorescence microscopy. Additionally, mitochondria are visualized with a specific dye. To demonstrate the specificity of the protocol, BrdU staining was tested on cells devoid of mtDNA (rho0 cells), on HeLa cells upon the silencing of well-known mtDNA maintenance factors, and on HeLa cells after treatment with an mtDNA replication inhibitor. The mtDNA levels were also measured by an independent method, namely qPCR.

<table><tbody><tr><td>2&amp;prime;,3&amp;prime;-Dideoxycytidine (ddC)</td><td>Sigma-Aldrich</td><td>D5782</td><td></td></tr><tr><td>384&amp;nbsp; Well Cell Culture Microplates, black</td><td>Greiner Bio-One</td><td>#781946</td><td></td></tr><tr><td>5-Bromo-2&amp;prime;-deoxyuridine (BrdU)</td><td>Sigma-Aldrich</td><td>B5002-1G</td><td>Dissolve BrdU powder in water to 20 mM stock solution and aliquot. Use 20 &amp;micro;M BrdU solution for labeling.</td></tr><tr><td>Adhesive sealing film</td><td>Nerbe Plus</td><td>04-095-0060</td><td></td></tr><tr><td>Alexa Fluor 488 goat anti-mouse IgG1 secondary antibody</td><td>Thermo Fisher Scientific</td><td>A-21121</td><td></td></tr><tr><td>Alexa Fluor 555 goat anti-mouse IgM secondary antibody</td><td>Thermo Fisher Scientific</td><td>A-21426</td><td></td></tr><tr><td>BioTek 405 LS microplate washer</td><td>Agilent</td><td></td><td></td></tr><tr><td>Bovine Serum Albumin (BSA)</td><td>Sigma-Aldrich</td><td>A4503</td><td></td></tr><tr><td>Cell counting chamber Thoma</td><td>Heinz Herenz</td><td>REF:1080339</td><td></td></tr><tr><td>Dulbecco&#039;s Modified Eagle Medium (DMEM)</td><td>Cytiva</td><td>SH30243.01</td><td></td></tr><tr><td>Dulbecco&#039;s Modified Eagle Medium (DMEM)</td><td>Thermo Fisher Scientific</td><td>41965-062</td><td></td></tr><tr><td>Fetal Bovine Serum (FBS)</td><td>Thermo Fisher Scientific</td><td>10270-106</td><td></td></tr><tr><td>Formaldehyde solution</td><td>Sigma-Aldrich</td><td>F1635</td><td>Formaldehyde is toxic; please read the safety data sheet carefully.</td></tr><tr><td>Hoechst 33342</td><td>Thermo Fisher Scientific</td><td>H3570</td><td></td></tr><tr><td>IgG1 mouse monoclonal anti-BrdU (IIB5) primary antibody</td><td>Santa Cruz Biotechnology</td><td>sc-32323</td><td></td></tr><tr><td>IgM mouse monoclonal anti-DNA (AC-30-10) primary antibody</td><td>Progen</td><td>#61014</td><td></td></tr><tr><td>LightCycler 480 System</td><td>Roche</td><td></td><td></td></tr><tr><td>Lipofectamine RNAiMAX Transfection Reagent</td><td>Thermo Fisher Scientific</td><td>#13778150</td><td></td></tr><tr><td>MitoTracker Deep Red FM</td><td>Thermo Fisher Scientific</td><td>M22426</td><td>Mitochondria tracking dye&amp;nbsp;</td></tr><tr><td>Multidrop Combi Reagent Dispenser</td><td>Thermo Fisher Scientific</td><td></td><td></td></tr><tr><td>Opti-MEM</td><td>Thermo Fisher Scientific</td><td>51985-042</td><td></td></tr><tr><td>Orca-R2 (C10600) CCD Camera</td><td>Hamamatsu</td><td></td><td></td></tr><tr><td>Penicillin-Streptomycin&amp;nbsp;</td><td>Sigma-Aldrich</td><td>P0781-100ML</td><td></td></tr><tr><td>Phosphate buffered saline (PBS)</td><td>Sigma-Aldrich</td><td>P4417-100TAB</td><td></td></tr><tr><td>PowerUp SYBR Green Master Mix</td><td>Thermo Fisher Scientific</td><td>A25742</td><td></td></tr><tr><td>qPCR primer Fw B2M (reference)</td><td></td><td></td><td>CAGGTACTCCAAAGATTCAGG&amp;nbsp;</td></tr><tr><td>qPCR primer Fw GPI (reference gene)</td><td></td><td></td><td>GACCTTTACTACCCAGGAGA</td></tr><tr><td>qPCR primer Fw MT-ND1&amp;nbsp;</td><td></td><td></td><td>TAGCAGAGACCAACCGAACC&amp;nbsp;</td></tr><tr><td>qPCR primer Fw POLG</td><td></td><td></td><td>TGGAAGGCAGGCATGGTCAAACC</td></tr><tr><td>qPCR primer Fw TFAM</td><td></td><td></td><td>GATGAGTTCTGCCTGCTTTAT</td></tr><tr><td>qPCR primer Fw TWNK</td><td></td><td></td><td>GCCATGTGACACTGGTCATT</td></tr><tr><td>qPCR primer Rev B2M (reference)</td><td></td><td></td><td>GTCAACTTCAATGTCGGATGG&amp;nbsp;</td></tr><tr><td>qPCR primer Rev GPI (reference gene)</td><td></td><td></td><td>AGTAGACAGGGCAACAAAGT</td></tr><tr><td>qPCR primer Rev MT-ND1&amp;nbsp;</td><td></td><td></td><td>ATGAAGAATAGGGCGAAGGG&amp;nbsp;</td></tr><tr><td>qPCR primer Rev POLG</td><td></td><td></td><td>GGAGTCAGAACACCTGGCTTTGG</td></tr><tr><td>qPCR primer Rev TFAM</td><td></td><td></td><td>GGACTTCTGCCAGCATAATA</td></tr><tr><td>qPCR primer Rev TWNK</td><td></td><td></td><td>AACATTGTCTGCTTCCTGGC</td></tr><tr><td>ScanR microscope</td><td>Olympus</td><td></td><td></td></tr><tr><td>siRNA Ctrl</td><td>Dharmacon</td><td>D-001810-10-5</td><td></td></tr><tr><td>siRNA POLG</td><td>Invitrogen</td><td>POLGHSS108223</td><td></td></tr><tr><td>siRNA TFAM</td><td>Invitrogen</td><td>TFAMHSS144252</td><td></td></tr><tr><td>siRNA TWNK</td><td>Invitrogen</td><td>C10orf2HSS125597</td><td></td></tr><tr><td>Suction device</td><td>NeoLab</td><td>2-9335</td><td>Suction device for cell culture</td></tr><tr><td>Triton X-100</td><td>Sigma-Aldrich</td><td>T9284-500ML</td><td></td></tr><tr><td>Trypsin</td><td>Biowest</td><td>L0931-500</td><td></td></tr><tr><td>UPlanSApo 20x 0.75 NA objective</td><td>Olympus</td><td></td><td></td></tr></tbody></table>

high-throughput image-based quantification of mitochondrial dna synthesis and distribution

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells produce most of their ATP in the mitochondria by oxidative phosphorylation. Mitochondria are unique organelles because they have their own genome that is replicated and passed on to the next generation of cells. In contrast to the nuclear genome, there are multiple copies of the mitochondrial genome in the cell. The detailed study of the mechanisms responsible for the replication, repair, and maintenance of the mitochondrial genome is essential for understanding the proper functioning of mitochondria and whole cells under both normal and disease conditions. Here, a method that allows the high-throughput quantification of the synthesis and distribution of mitochondrial DNA (mtDNA) in human cells cultured in vitro is presented. This approach is based on the immunofluorescence detection of actively synthesized DNA molecules labeled by 5-bromo-2'-deoxyuridine (BrdU) incorporation and the concurrent detection of all the mtDNA molecules with anti-DNA antibodies. Additionally, the mitochondria are visualized with specific dyes or antibodies. The culturing of cells in a multi-well format and the utilization of an automated fluorescence microscope make it easier to study the dynamics of mtDNA and the morphology of mitochondria under a variety of experimental conditions in a relatively short time.

A scheme of the procedure for the high-throughput study of the dynamics of mtDNA synthesis and distribution is shown in Figure 1. The use of a multi-well plate format enables the simultaneous analysis of many different experimental conditions, such as the silencing of different genes using a siRNA library. The conditions used for the labeling of newly synthesized DNA molecules with BrdU allow for the detection of BrdU-labeled DNA in the mitochondria of HeLa cells (Figure...

Watch this Scientific Journal Video about High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution at JoVE.com

Author Spotlight: High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution  

A procedure for studying the dynamics of mitochondrial DNA (mtDNA) metabolism in cells using a multi-well plate format and automated immunofluorescence imaging to detect and quantify mtDNA synthesis and distribution is described. This can be further used to investigate the effects of various inhibitors, cellular stresses, and gene silencing on mtDNA metabolism.

High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells ...

high-throughput-image-based-quantification-mitochondrial-dna

Research

JoVE Journal

Biochemistry

2.9K Views.  University of Warsaw. Het protocol is gericht op het identificeren van eiwitten met disfunctie leidt tot veranderingen in het aantal mitochondriale DNA-moleculen. Dit onderzoek kan ook de factoren onthullen die betrekking hebben op de verdeling van mitochondriaal DNA in de mitochondriën. Mitochondriale replicatie- en onderhoudsmechanismen zijn nog steeds niet volledig begrepen.Er is veel minder bekend over het reguleren van de distributie van mitochondriale genomen binnen organoïden en de eiwitten die daa...

Video: Auteur in de schijnwerpers: high-throughput beeldgebaseerde kwantificering van mitochondriale DNA-synthese en -distributie  

Visualization of Mitochondrial DNA Replication in Individual Cells by EdU Signal Amplification

Mitochondria are key regulators of cellular energy and mitochondrial biogenesis is an essential component of regulating mitochondria numbers in healthy cells1-3. One approach for monitoring mitochondrial biogenesis is to measure the rate of mitochondrial DNA (mtDNA) replication4. We developed a sensitive technique to label newly synthesized mtDNA in individual cells in order to study mtDNA biogenesis. The technique combines the incorporation of 5-ethynyl-2'-deoxyuridine (EdU)5-7 with a tyramide signal amplification (TSA)8 protocol to visualize mtDNA replication within subcellular compartments of neurons. EdU is superior to other thymidine analogs, such as 5-bromo-2-deoxyuridine (BrdU), because the initial click reaction to label EdU5-7 does not require the harsh acid treatments or enzyme digests that are required for exposing the BrdU epitope. The milder labeling of EdU allows for direct comparison of its incorporation with other cellular markers9-10. The ability to visualize and quantify mtDNA biogenesis provides an essential tool for investigating the mechanisms used to regulate mitochondrial biogenesis and would provide insight into the pathogenesis associated with drug toxicity, aging, cancer and neurodegenerative diseases. Our technique is applicable to sensory neurons as well as other cell types. The use of this technique to measure mtDNA biogenesis has significant implications in furthering the understanding of both normal cellular physiology as well as impaired disease states.

We developed a sensitive technique to label newly synthesized mitochondrial DNA (mtDNA) in individual cells in order to study mtDNA biogenesis. The technique combines the incorporation of EdU together with a tyramide signal amplification (TSA) protocol to visualize mtDNA replication within subcellular compartments of neurons.

Mitochondria are key regulators of cellular energy and mitochondrial biogenesis is an essential component of regulating mitochondria numbers in healthy ...

Neuroscience

Methodology for Accurate Detection of Mitochondrial DNA Methylation

Quantification of DNA methylation can be achieved using bisulfite sequencing, which takes advantage of the property of sodium bisulfite to convert unmethylated cytosine into uracil, in a single-stranded DNA context. Bisulfite sequencing can be targeted (using PCR) or performed on the whole genome and provides absolute quantification of cytosine methylation at the single base-resolution. Given the distinct nature of nuclear- and mitochondrial DNA, notably in the secondary structure, adaptions of bisulfite sequencing methods for investigating cytosine methylation in mtDNA should be made. Secondary and tertiary structure of mtDNA can indeed lead to bisulfite sequencing artifacts leading to false-positives due to incomplete denaturation poor access of bisulfite to single-stranded DNA. Here, we describe a protocol using an enzymatic digestion of DNA with BamHI coupled with bioinformatic analysis pipeline to allow accurate quantification of cytosine methylation levels in mtDNA. In addition, we provide guidelines for designing the bisulfite sequencing primers specific to mtDNA, in order to avoid targeting undesirable NUclear MiTochondrial segments (NUMTs) inserted into the nuclear genome.

Here, we present a protocol to allow accurate quantification of mitochondrial DNA (mtDNA) methylation. In this protocol, we describe an enzymatic digestion of DNA with BamHI coupled with a bioinformatic analysis pipeline which can be used to avoid overestimation of mtDNA methylation levels caused by the secondary structure of mtDNA.

Quantification of DNA methylation can be achieved using bisulfite sequencing, which takes advantage of the property of sodium bisulfite to convert ...

Genetics

A Faster, High Resolution, mtPA-GFP-based Mitochondrial Fusion Assay Acquiring Kinetic Data of Multiple Cells in Parallel Using Confocal Microscopy

Mitochondrial fusion plays an essential role in mitochondrial calcium homeostasis, bioenergetics, autophagy and quality control. Fusion is quantified in living cells by photo-conversion of matrix targeted photoactivatable GFP (mtPAGFP) in a subset of mitochondria. The rate at which the photoconverted molecules equilibrate across the entire mitochondrial population is used as a measure of fusion activity. Thus far measurements were performed using a single cell time lapse approach, quantifying the equilibration in one cell over an hour. Here, we scale up and automate a previously published live cell method based on using mtPAGFP and a low concentration of TMRE (15 nm). This method involves photoactivating a small portion of the mitochondrial network, collecting highly resolved stacks of confocal sections every 15 min for 1 hour, and quantifying the change in signal intensity. Depending on several factors such as ease of finding PAGFP expressing cells, and the signal of the photoactivated regions, it is possible to collect around 10 cells within the 15 min intervals. This provides a significant improvement in the time efficiency of this assay while maintaining the highly resolved subcellular quantification as well as the kinetic parameters necessary to capture the detail of mitochondrial behavior in its native cytoarchitectural environment.
Mitochondrial dynamics play a role in many cellular processes including respiration, calcium regulation, and apoptosis1,2,3,13. The structure of the mitochondrial network affects the function of mitochondria, and the way they interact with the rest of the cell. Undergoing constant division and fusion, mitochondrial networks attain various shapes ranging from highly fused networks, to being more fragmented. Interestingly, Alzheimer's disease, Parkinson's disease, Charcot Marie Tooth 2A, and dominant optic atrophy have been correlated with altered mitochondrial morphology, namely fragmented networks4,10,13. Often times, upon fragmentation, mitochondria become depolarized, and upon accumulation this leads to impaired cell function18. Mitochondrial fission has been shown to signal a cell to progress toward apoptosis. It can also provide a mechanism by which to separate depolarized and inactive mitochondria to keep the bulk of the network robust14. Fusion of mitochondria, on the other hand, leads to sharing of matrix proteins, solutes, mtDNA and the electrochemical gradient, and also seems to prevent progression to apoptosis9. How fission and fusion of mitochondria affects cell homeostasis and ultimately the functioning of the organism needs further understanding, and therefore the continuous development and optimization of how to gather information on these phenomena is necessary.
Existing mitochondrial fusion assays have revealed various insights into mitochondrial physiology, each having its own advantages. The hybrid PEG fusion assay7, mixes two populations of differently labeled cells (mtRFP and mtYFP), and analyzes the amount of mixing and colocalization of fluorophores in fused, multinucleated, cells. Although this method has yielded valuable information, not all cell types can fuse, and the conditions under which fusion is stimulated involves the use of toxic drugs that likely affect the normal fusion process. More recently, a cell free technique has been devised, using isolated mitochondria to observe fusion events based on a luciferase assay1,5. Two human cell lines are targeted with either the amino or a carboxy terminal part of Renilla luciferase along with a leucine zipper to ensure dimerization upon mixing. Mitochondria are isolated from each cell line, and fused. The fusion reaction can occur without the cytosol under physiological conditions in the presence of energy, appropriate temperature and inner mitochondrial membrane potential. Interestingly, the cytosol was found to modulate the extent of fusion, demonstrating that cell signaling regulates the fusion process 4,5. This assay will be very useful for high throughput screening to identify components of the fusion machinery and also pharmacological compounds that may affect mitochondrial dynamics. However, more detailed whole cell mitochondrial assays will be needed to complement this in vitro assay to observe these events within a cellular environment.
A technique for monitoring whole-cell mitochondrial dynamics has been in use for some time and is based on a mitochondrially-targeted photoactivatable GFP (mtPAGFP)6,11. Upon expression of the mtPAGFP, a small portion of the mitochondrial network is photoactivated (10-20%), and the spread of the signal to the rest of the mitochondrial network is recorded every 15 minutes for 1 hour using time lapse confocal imaging. Each fusion event leads to a dilution of signal intensity, enabling quantification of the fusion rate. Although fusion and fission are continuously occurring in cells, this technique only monitors fusion as fission does not lead to a dilution of the PAGFP signal6. Co-labeling with low levels of TMRE (7-15 nM in INS1 cells) allows quantification of the membrane potential of mitochondria. When mitochondria are hyperpolarized they uptake more TMRE, and when they depolarize they lose the TMRE dye. Mitochondria that depolarize no longer have a sufficient membrane potential and tend not to fuse as efficiently if at all. Therefore, active fusing mitochondria can be tracked with these low levels of TMRE9,15. Accumulation of depolarized mitochondria that lack a TMRE signal may be a sign of phototoxicity or cell death. Higher concentrations of TMRE render mitochondria very sensitive to laser light, and therefore great care must be taken to avoid overlabeling with TMRE. If the effect of depolarization of mitochondria is the topic of interest, a technique using slightly higher levels of TMRE and more intense laser light can be used to depolarize mitochondria in a controlled fashion (Mitra and Lippincott-Schwartz, 2010). To ensure that toxicity due to TMRE is not an issue, we suggest exposing loaded cells (3-15 nM TMRE) to the imaging parameters that will be used in the assay (perhaps 7 stacks of 6 optical sections in a row), and assessing cell health after 2 hours. If the mitochondria appear too fragmented and cells are dying, other mitochondrial markers, such as dsRED or Mitotracker red could be used instead of TMRE.
The mtPAGFP method has revealed details about mitochondrial network behavior that could not be visualized using other methods. For example, we now know that mitochondrial fusion can be full or transient, where matrix content can mix without changing the overall network morphology. Additionally, we know that the probability of fusion is independent of contact duration and organelle dimension, is influenced by organelle motility, membrane potential and history of previous fusion activity8,15,16,17.
In this manuscript, we describe a methodology for scaling up the previously published protocol using mtPAGFP and 15nM TMRE8 in order to examine multiple cells at a time and improve the time efficiency of data collection without sacrificing the subcellular resolution. This has been made possible by the use of an automated microscope stage, and programmable image acquisition software. Zen software from Zeiss allows the user to mark and track several designated cells expressing mtPAGFP. Each of these cells can be photoactivated in a particular region of interest, and stacks of confocal slices can be monitored for mtPAGFP signal as well as TMRE at specified intervals. Other confocal systems could be used to perform this protocol provided there is an automated stage that is programmable, an incubator with CO2, and a means by which to photoactivate the PAGFP; either a multiphoton laser, or a 405 nm diode laser.

Mitochondrial fusion was measured by tracking the equilibration of photoconverted matrix-targeted GFP across the mitochondrial network over time. Thus far, only one cell could be subjected to an hour long kinetic analysis at a time. We present a method that simultaneously measures multiple cells, thereby speeding up the data collection process.

Mitochondrial fusion plays an essential role in mitochondrial calcium homeostasis, bioenergetics, autophagy and quality control. Fusion is quantified in ...

Biology

Live-imaging of Mitochondrial System in Cultured Astrocytes

While much attention has been given to mitochondrial alterations at the neuronal level, recent evidence demonstrates that mitochondrial dynamics and function in astrocytes are implicated in cognition. This article describes the method for time-lapse imaging of astrocyte cultures equipped with a mitochondrial biosensor: MitoTimer. MitoTimer is a powerful and unique tool to assess mitochondrial dynamics, mobility, morphology, biogenesis, and redox state. Here, the different procedures for culture, image acquisitions, and subsequent mitochondrial analysis are presented.

This article describes the method for mitochondrial time-lapse imaging of astrocyte cultures equipped with MitoTimer biosensor and the resulting multiparametric analysis of mitochondrial dynamics, mobility, morphology, biogenesis, redox state, and turnover.

While much attention has been given to mitochondrial alterations at the neuronal level, recent evidence demonstrates that mitochondrial dynamics and ...

MATLAB Optimization for Analyzing Mitochondrial Networks in Neuroscience

Optimized Automated Analysis of Live Neuronal Mitochondria Homeostasis Modulation by Isoform-Specific Retinoic Acid Receptors

The complex mitochondrial network makes it very challenging to segment, follow, and analyze live cells. MATLAB tools allow the analysis of mitochondria in timelapse files, considerably simplifying and speeding up the process of image processing. Nonetheless, existing tools produce a large output volume, requiring individual manual attention, and basic experimental setups have an output of thousands of files, each requiring extensive and time-consuming handling. 
To address these issues, a routine optimization was developed, in both MATLAB code and live-script forms, allowing for swift file analysis and significantly reducing document reading and data processing. With a speed of 100 files/min, the optimization allows an overall rapid analysis. The optimization achieves the results output by averaging frame-specific data for individual mitochondria throughout time frames, analyzing data in a defined manner, consistent with those output from existing tools. Live confocal imaging was performed using the dye tetramethylrhodamine methyl ester, and the routine optimization was validated by treating neuronal cells with retinoic acid receptor (RAR) agonists, whose effects on neuronal mitochondria are established in the literature. The results were consistent with the literature and allowed further characterization of mitochondrial network behavior in response to isoform-specific RAR modulation. 
This new methodology allowed rapid and validated characterization of whole-neuron mitochondria network, but it also allows for differentiation between axon and cell body mitochondria, an essential feature to apply in the neuroscience field. Moreover, this protocol can be applied to experiments using fast-acting treatments, allowing the imaging of the same cells before and after treatments, transcending the field of neuroscience.

Author Spotlight: An Optimized Automated Method for Investigating Retinoic Acid Receptors in Neuronal Mitochondria

The mitochondrial network is extremely complex, making it very challenging to analyze. A novel MATLAB tool analyzes live confocal imaged mitochondria in timelapse images but results in a large output volume requiring individual manual attention. To address this issue, a routine optimization was developed, allowing for speedy file analysis.

The complex mitochondrial network makes it very challenging to segment, follow, and analyze live cells. MATLAB tools allow the analysis of mitochondria in ...

Measuring Single-Cell Mitochondrial DNA Copy Number and Heteroplasmy Using Digital Droplet Polymerase Chain Reaction

The mammalian mitochondrial (mt)DNA is a small, circular, double-stranded, intra-mitochondrial DNA molecule, encoding 13 subunits of the electron transport chain. Unlike the diploid nuclear genome, most cells contain many more copies of mtDNA, ranging from less than 100 to over 200,000 copies depending on cell type. MtDNA copy number is increasingly used as a biomarker for a number of age-related degenerative conditions and diseases, and thus, accurate measurement of the mtDNA copy number is becoming a key tool in both research and diagnostic settings. Mutations in the mtDNA, often occurring as single nucleotide polymorphisms (SNPs) or deletions, can either exist in all copies of the mtDNA within the cell (termed homoplasmy) or as a mixture of mutated and WT mtDNA copies (termed heteroplasmy). Heteroplasmic mtDNA mutations are a major cause of clinical mitochondrial pathology, either in rare diseases or in a growing number of common late-onset diseases such as Parkinson's disease. Determining the level of heteroplasmy present in cells is a critical step in the diagnosis of rare mitochondrial diseases and in research aimed at understanding common late-onset disorders where mitochondria may play a role. MtDNA copy number and heteroplasmy have traditionally been measured by quantitative (q)PCR-based assays or deep sequencing. However, the recent introduction of ddPCR technology has provided an alternative method for measuring both parameters. It offers several advantages over existing methods, including the ability to measure absolute mtDNA copy number and sufficient sensitivity to make accurate measurements from single cells even at low copy numbers. Presented here is a detailed protocol describing the measurement of mtDNA copy number in single cells using ddPCR, referred to as droplet generation PCR henceforth, with the option for simultaneous measurement of heteroplasmy in cells with mtDNA deletions. The possibility of expanding this method to measure heteroplasmy in cells with mtDNA SNPs is also discussed.

Here we present a protocol for measuring absolute mitochondrial (mt)DNA copy number and mtDNA deletion heteroplasmy levels in single cells.

The mammalian mitochondrial (mt)DNA is a small, circular, double-stranded, intra-mitochondrial DNA molecule, encoding 13 subunits of the electron ...

Medicine

Simultaneous Mapping and Quantitation of Ribonucleotides in Human Mitochondrial DNA

Established approaches to estimate the number of ribonucleotides present in a genome are limited to the quantitation of incorporated ribonucleotides using short synthetic DNA fragments or plasmids as templates and then extrapolating the results to the whole genome. Alternatively, the number of ribonucleotides present in a genome may be estimated using alkaline gels or Southern blots. More recent in vivo approaches employ Next-generation sequencing allowing genome-wide mapping of ribonucleotides, providing the position and identity of embedded ribonucleotides. However, they do not allow quantitation of the number of ribonucleotides which are incorporated into a genome. Here we describe how to simultaneously map and quantitate the number of ribonucleotides which are incorporated into human mitochondrial DNA in vivo by Next-generation sequencing. We use highly intact DNA and introduce sequence specific double strand breaks by digesting it with an endonuclease, subsequently hydrolyzing incorporated ribonucleotides with alkali. The generated ends are ligated with adapters and these ends are sequenced on a Next-generation sequencing machine. The absolute number of ribonucleotides can be calculated as the number of reads outside the recognition site per average number of reads at the recognition site for the sequence specific endonuclease. This protocol may also be utilized to map and quantitate free nicks in DNA and allows adaption to map other DNA lesions that can be processed to 5&#180;-OH ends or 5&#180;-phosphate ends. Furthermore, this method can be applied to any organism, given that a suitable reference genome is available. This protocol therefore provides an important tool to study DNA replication, 5&#180;-end processing, DNA damage, and DNA repair.

Here we describe a method amenable to simultaneously quantitate and genome-wide map ribonucleotides in highly intact DNA at single-nucleotide resolution, combining enzymatic cleavage of genomic DNA with its alkaline hydrolysis and subsequent 5&#180;-end sequencing.

Established approaches to estimate the number of ribonucleotides present in a genome are limited to the quantitation of incorporated ribonucleotides using ...

Imaging of Mitochondrial Peroxide in Living Yeast Cells Using mtHyper7

Imaging of mtHyPer7, a Ratiometric Biosensor for Mitochondrial Peroxide, in Living Yeast Cells

Mitochondrial dysfunction, or functional alteration, is found in many diseases and conditions, including neurodegenerative and musculoskeletal disorders, cancer, and normal aging. Here, an approach is described to assess mitochondrial function in living yeast cells at cellular and subcellular resolutions using a genetically encoded, minimally invasive, ratiometric biosensor. The biosensor, mitochondria-targeted HyPer7 (mtHyPer7), detects hydrogen peroxide (H2O2) in mitochondria. It consists of a mitochondrial signal sequence fused to a circularly permuted fluorescent protein and the H2O2-responsive domain of a bacterial OxyR protein. The biosensor is generated and integrated into the yeast genome using a CRISPR-Cas9 marker-free system, for&#160;more consistent expression compared to plasmid-borne constructs.
mtHyPer7 is quantitatively targeted to mitochondria, has no detectable effect on yeast growth rate or mitochondrial morphology, and provides a quantitative readout for mitochondrial H2O2 under normal growth conditions and upon exposure to oxidative stress. This protocol explains how to optimize imaging conditions using a spinning-disk confocal microscope system and perform quantitative analysis using freely available software. These tools make it possible to collect rich spatiotemporal information on mitochondria both within cells and among cells in a population. Moreover, the workflow described here can be used to validate other biosensors.

Author Spotlight: Advancing Mitochondrial Research - mtHyper7 Biosensor for Subcellular Analysis 

Hydrogen peroxide (H2O2) is both a source of oxidative damage and a signaling molecule. This protocol describes how to measure mitochondrial H2O2 using mitochondria-targeted HyPer7 (mtHyPer7), a genetically encoded ratiometric biosensor, in living yeast. It details how to optimize imaging conditions and perform quantitative cellular and subcellular analysis using freely available software.

Mitochondrial dysfunction, or functional alteration, is found in many diseases and conditions, including neurodegenerative and musculoskeletal disorders, ...

Confocal Microscopic Analysis of Rat Muscle Mitochondria

Analysis of the Mitochondrial Density and Longitudinal Distribution in Rat Live-Skeletal Muscle Fibers by Confocal Microscopy

The mitochondrion is an organelle that can be elongated, fragmented, and renovated according to the metabolic requirements of the cells. The remodeling of the mitochondrial network allows healthy mitochondria to meet cellular demands; however, the loss of this capacity has been related to the development or progression of different pathologies. In skeletal muscle, mitochondrial density and distribution changes are observed in physiological and pathological conditions such as exercise, aging, and obesity, among others. Therefore, the study of the mitochondrial network may provide a better understanding of mechanisms related to those conditions.
Here, a protocol for mitochondria imaging of live-skeletal muscle fibers from rats is described. Fibers are manually dissected in a relaxing solution and incubated with a fluorescent live-cell imaging indicator of mitochondria (tetramethylrhodamine ethyl ester, TMRE). The mitochondria signal is recorded by confocal microscopy using the XYZ scan mode to obtain confocal images of the intermyofibrillar mitochondrial (IMF) network. After that, the confocal images are processed by thresholding and binarization. The binarized confocal image accounts for the positive pixels for mitochondria, which are then counted to obtain the mitochondrial density. The mitochondrial network in skeletal muscle is characterized by a high density of IMF population, which has a periodic longitudinal distribution similar to that of T-tubules (TT).&#160;The Fast Fourier Transform (FFT) is a standard analysis technique performed to evaluate the distribution of TT that allows finding the distribution frequency and the level of their organization. In this protocol, the implementation of the FFT algorithm is described for the analysis of the longitudinal mitochondrial distribution in skeletal muscle.

Author Spotlight: Mitochondrial Remodeling in Skeletal Muscle 

Here, we present a protocol to analyze changes in mitochondrial density and longitudinal distribution by live-skeletal muscle imaging using confocal microscopy for mitochondrial network scanning.

The mitochondrion is an organelle that can be elongated, fragmented, and renovated according to the metabolic requirements of the cells. The remodeling of ...

Analyzing Mitochondrial Morphology in C. elegans

Imaging and Quantifying Mitochondrial Morphology in C. elegans During Aging

Mitochondria, important cellular organelles found in most eukaryotic cells, are major sites of energy production through aerobic respiration. Beyond this well-known role as the 'cellular powerhouse,' mitochondria are also involved in many other essential cellular processes, including the regulation of cellular metabolism, proliferation, immune signaling, and hormonal signaling. Deterioration in mitochondrial function during aging or under mitochondrial stress is often characterized by distinct changes in mitochondrial morphology and volume. The nematode C. elegans is an ideal model for studying these changes due to its transparent body and short lifespan, which facilitate live microscopy throughout its lifetime. However, even within the C. elegans field, numerous transgenic constructs and methods for mitochondrial imaging are available, each with its own limitations. Here, single-copy, matrix-localized GFP constructs are presented as a robust and reliable method for imaging mitochondrial morphology in C. elegans. This study specifically focuses on experimentally controllable factors to minimize errors and reduce variability between replicates and across studies when performing mitochondrial imaging during the aging process. Additionally, mitoMAPR is recommended as a robust method to quantify changes in mitochondrial morphology across tissue types during aging.

This protocol provides a standardized approach for imaging mitochondrial morphology in multiple tissues of C. elegans during aging.

Mitochondria, important cellular organelles found in most eukaryotic cells, are major sites of energy production through aerobic respiration. Beyond this ...

High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video