עבודה זו נתמכה על ידי המרכז הלאומי למדע, פולין (מספר מענק/פרס: 2018/31/D/NZ2/03901).

1. הכנת תערובת siRNA
<ol><li>יום לפני תחילת הניסוי, תאי זרע (למשל, HeLa) על צלחת של 100 מ"מ, כך שהם מגיעים למפגש של 70%-90% למחרת. הערה: כל הפעולות חייבות להתבצע בתנאים סטריליים בתא זרימה למינרי.</li>
	<li>הכינו את הכמות המתאימה של siRNA מדולל לריכוז של 140 ננומטר בתווך Opti-MEM (ראו טבלת חומרים). צלחת 96 בארות יכולה לשמש כמאגר.</li>
	<li>הוסף 5 μL של תמיסת siRNA (או מדיום Opti-MEM עבור דגימות הבקרה) לכל באר של מיקרו-צלחת שחורה של תרבית תאים בת 384 בארות. הערה: בהתאם למספר דגימות ה-siRNA שנבדקו, ניתן להשתמש בפיפט אלקטרוני או רב-ערוצי.</li>
	<li>הכן את הכמות המתאימה של תמיסת מגיב טרנספקציה RNAiMAX (ראה טבלת חומרים) בתווך Opti-MEM. הוסף 1 μL של RNAiMAX עבור כל 100 μL של בינוני.</li>
	<li>הוסף 10 μL של תמיסת מגיב transfection לכל באר של צלחת 384 באר. הדרך הנוחה והמהירה ביותר לעשות זאת היא עם מתקן מגיב.</li>
	<li>לדגור את siRNA עם מגיב transfection במשך 30 דקות בטמפרטורת החדר.</li>
</ol>2. הכנת תאים לטרנספקציה
<ol><li>במהלך הדגירה (שלב 1.6), שאפו את המדיום באמצעות מכשיר יניקה (ראו טבלת חומרים), ושטפו את התאים עם 3 מ"ל PBS.</li>
	<li>הוסף 1.5 מ"ל של טריפסין מדולל 1: 2 ב PBS, ולדגור את התאים ב 37 ° C במשך 10 דקות.</li>
	<li>בדוק אם התאים התנתקו; אם כן, הוסף 3 מ"ל של מדיום DMEM עם 10% FBS. להשעות את התאים ביסודיות, ולהעביר אותם צינור 15 מ"ל. קח לפחות 150 μL של התרחיף, וספור את התאים בתא ספירת תאים (ראה טבלה של חומרים).</li>
	<li>הכינו תרחיף תאים בריכוז המתאים (35,000/מ"ל לקו HeLa) בתווך DMEM עם 10% FBS, פניצילין וסטרפטומיצין.</li>
</ol>3. טרנספקציה של תאים
<ol><li>הוסף 20 μL של תרחיף התא לכל באר של צלחת 384 באר באמצעות מתקן מגיב. התוצאה תהיה 700 תאים שנזרעו לכל באר.</li>
	<li>לדגור על התאים במשך שעה אחת בטמפרטורת החדר, ולאחר מכן להניח אותם באינקובטור במשך 72 שעות (37 ° C ו 5% CO2).</li>
</ol>4. התאגדות BrdU
<ol><li>הכינו תמיסה של 90 מיקרומטר של BrdU (ראו טבלת חומרים) בתווך DMEM עם 10% FBS.</li>
	<li>56 שעות לאחר התמרת siRNA (16 שעות לפני קיבוע התא), הוסף 10 μL של 90 מיקרומטר תמיסת BrdU לכל באר של צלחת 384 בארות (ריכוז BrdU הסופי הוא 20 μM). הערה: יש לבצע את הפעולה מהר ככל האפשר; לכן, עדיף להשתמש מתקן מגיב, פיפטה אלקטרונית, או פיפטה רב מתקן. זכור להכין בארות בקרה ללא תוספת של BrdU.</li>
	<li>לדגור על התאים במשך 16 שעות (37 ° C ו 5% CO2).</li>
</ol>5. תיוג מיטוכונדריה
<ol><li>הכינו תמיסה של 20 מיקרומטר של BrdU ב-DMEM עם 10% FBS, והוסיפו לה את תמיסת הצבע למעקב מיטוכונדריה (ראו טבלת חומרים) לריכוז של 1.1 מיקרומטר.</li>
	<li>15 שעות לאחר תחילת שילוב BrdU (שעה אחת לפני קיבוע התא), הוסף 10 μL של תמיסת צבע מעקב מיטוכונדריה (ראה טבלת חומרים) לכל באר של צלחת 384 בארות (ריכוז הצבע הסופי הוא 200 ננומטר). הערה: השתמש במתקן מגיבים, פיפטה אלקטרונית או פיפטה מרובת מתקנים. זכור לשמור על בארות שליטה ללא תוספת של BrdU אלא עם תוספת של צבע מעקב מיטוכונדריה.</li>
	<li>לדגור על התאים במשך 1 שעות (37 ° C ו 5% CO2).</li>
</ol>6. קיבוע תאים
הערה: כל הכביסה מתבצעת בצורה הנוחה ביותר באמצעות מכונת כביסה microplate, בעוד תוספת של ריאגנטים מתבצעת במהירות הגבוהה ביותר באמצעות מתקן מגיב.
<ol><li>באמצעות מכונת הכביסה microplate (ראה טבלה של חומרים), לשטוף כל באר פעמיים עם 100 μL של PBS. לאחר הכביסה השנייה, להשאיר 25 μL של PBS בבאר. הערה: השארת PBS בבאר מפחיתה את הסבירות לניתוק תאים במהלך הוספת נוזל בשלב הבא. כל השטיפות הושלמו עם PBS נשאר בפנים; לכן, התמיסה שנוספה בשלב הבא צריכה תמיד להיות מוכנה בריכוז של פי 2 מכיוון שהיא תתווסף בנפח שווה ל- PBS הנותר.</li>
	<li>תקן את התאים על ידי הוספת 25 μL של תמיסת פורמלדהיד 8% ב- PBS עם 0.4% Triton X-100 ו- Hoechst 33342 בריכוז של 4 מיקרוגרם / מ"ל (הריכוזים הסופיים של ריאגנטים בודדים הם 4%, 0.2% ו- 2 מיקרוגרם / מ"ל, בהתאמה) (ראה טבלת חומרים).</li>
	<li>דוגרים על הצלחת בחושך בטמפרטורת החדר למשך 30 דקות.</li>
</ol>7. חסימה
<ol><li>יש לשטוף כל באר ארבע פעמים עם 100 מיקרוליטר של PBS. לאחר השטיפה האחרונה, להשאיר 25 μL של PBS בבאר.</li>
	<li>הוסף 25 μL של 6% BSA ב- PBS (ריכוז BSA הסופי הוא 3%) לכל באר.</li>
	<li>דוגרים על הצלחת בחושך בטמפרטורת החדר למשך 30 דקות.</li>
</ol>8. הוספת הנוגדנים הראשוניים
<ol><li>שואפים את BSA באמצעות מכונת כביסה microplate, ולהשאיר 10 μL של פתרון בבאר.</li>
	<li>הוסף 10 μL של תמיסת הנוגדנים הראשונית שהוכנה ב -3% BSA ב- PBS. השתמשו באנטי-BrdU ב-0.8 מיקרוגרם/מ"ל ובאנטי-דנ"א ב-0.4 מיקרוגרם/מ"ל (הריכוזים הסופיים של נוגדנים הם 0.4 מיקרוגרם/מ"ל ו-0.2 מיקרוגרם/מ"ל, בהתאמה) (ראו טבלת חומרים).</li>
	<li>לדגור את הצלחת בחושך ב 4 ° C במשך הלילה.</li>
</ol>9. הוספת נוגדנים משניים
<ol><li>יש לשטוף כל באר ארבע פעמים עם 100 מיקרוליטר של PBS. לאחר השטיפה האחרונה, להשאיר 10 μL של PBS בבאר.</li>
	<li>הוסף 10 μL של תמיסת נוגדנים משנית 4 מיקרוגרם/מ"ל שהוכנה ב-6% BSA ב-PBS (הריכוז הסופי הוא 2 מק"ג/מ"ל). השתמש בנוגדנים ספציפיים לאיזוטיפ (IgG1 נגד עכבר ונגד עכבר IgM) מצומדים לפלואורוכרום כגון Alexa Fluor 488 ו- Alexa Fluor 555 (ראה טבלת חומרים).</li>
	<li>דוגרים על הצלחת בחושך בטמפרטורת החדר למשך שעה.</li>
	<li>יש לשטוף כל באר ארבע פעמים עם 100 מיקרוליטר של PBS. לאחר הכביסה האחרונה, להשאיר 50 μL של PBS בבאר.</li>
	<li>אטמו את הצלחת בסרט איטום דביק (ראו טבלת חומרים), ואחסנו אותה בחושך בטמפרטורה של 4°C. יש לבצע הדמיה תוך שבועיים.</li>
</ol>10. הדמיה
הערה: יש לבצע הדמיה באמצעות מיקרוסקופ אוטומטי בעל שדה רחב; המיקרוסקופ חייב להיות מצויד בשלב מנוע המסופק עם פקדים כדי לצלם אזורים בודדים של הצלחת באופן אוטומטי.
<ol><li>בדוק את הגדרות המיקוד האוטומטי באזורים הפינתיים של הצלחת (בארות A1, A24, P24, P1) ובמרכז. הערה: להדמיה, מומלץ להשתמש ביעד מרחק עבודה קצר פי 20 (ראה טבלת חומרים) עם הצמצם המספרי הגבוה ביותר האפשרי.</li>
	<li>בהתבסס על היסטוגרמות העוצמה שנוצרו על-ידי תוכנת ההדמיה במצב תצוגה חיה, בחרו זמן חשיפה ארוך מספיק לערוצי הפלואורסצנטיות הבודדים, כך שהתמונה המתקבלת לא תהיה רוויה יתר על המידה.</li>
	<li>הגדר את מספר המישורים המתאים להדמיה על ציר z. הערה: שדה הראייה בהגדלה של 20x גדול מספיק כך שלא כל התאים נמצאים באותו מישור מיקוד, ולכן יש לבצע חתך z כדי להציג את כל התאים במישור המיקוד הנכון שלהם. בדרך כלל, חמישה מטוסים מספיקים. בהתאם לזמינות שטח הדיסק, ניתן לשמור ערימות z בודדות או רק הקרנות בעוצמה מרבית. ניתוח התמונה המוצג בסעיף התוצאות המייצגות מבוסס על הקרנות בעוצמה מרבית.</li>
	<li>בחר את מספר שדות הראייה המתאים להצגה לכל באר. הערה: בהתאם למפגש, ניתן לצלם כ- 60-300 תאים בשדה ראייה אחד. בדרך כלל, עבור תאי HeLa עם מפגש של 60%-90%, הדמיה של חמישה שדות ראייה תאפשר לנתח מ-500 תאים ליותר מ-1,000 תאים.</li>
	<li>בחר את הבארות שברצונך לצלם והתחל בהדמיה.</li>
</ol>11. ניתוח תמונה כמותי
הערה: ניתן לבצע ניתוח כמותי של תמונות שנרכשו באמצעות תוכנת קוד פתוח כגון Cell Profiler15. במחקר הנוכחי, הניתוח בוצע באמצעות תוכנת ScanR 3.0.0 (ראה טבלת חומרים).
<ol><li>התחל את הניתוח על ידי ביצוע תיקון רקע עבור כל התמונות מכל ערוצי הפלואורסצנציה. בהתאם לגודל העצמים שנותחו, בחרו את גודל המסנן המתאים: 80 פיקסלים לגרעיני תאים ו-4 פיקסלים לכתמי BrdU ו-mtDNA.</li>
	<li>התחילו לפלח את התמונה על ידי יצירת מסיכה של העצם הראשי בהתבסס על היחס בין עוצמת האות הפלואורסצנטי לרקע של הערוץ המתאים לגרעיני התא.</li>
	<li>צרו מסיכות לתת-עצמים המייצגים את כתמי BrdU ו-mtDNA, בהתאמה, באמצעות תעלות פלואורסצנטיות המתאימות למבנים הנתונים. הערה: כל תת-אובייקט מוקצה לאובייקט הראשי הקרוב ביותר (גרעין התא).</li>
	<li>קבעו את הפרמטרים שיימדדו במהלך הניתוח, ומדו את עוצמת הפיקסלים הבודדים בכל מסיכה עבור כל ערוצי הפלואורסצנטיות. הערה: כמו כן, יש לחשב את מספר תת-האובייקטים שהוקצו לגרעין תא נתון ואת השטח של כל תת-אובייקט.</li>
	<li>הגדר את הפרמטרים הנגזרים שיחושבו בהתבסס על הנתונים המתקבלים. כדי לקבל את העוצמות הפלואורסצנטיות הכוללות עבור ערוץ BrdU או mtDNA, סכמו את העוצמות של כל תת-האובייקטים שהוקצו לגרעין תא נתון. כדי לקבל את עוצמת הפלואורסצנטיות הממוצעת, חלק את עוצמת הפלואורסצנטיות הכוללת בסכום השטח של תת-העצמים שהוקצו לגרעין תא נתון. הערה: כדי להבטיח שתת-האובייקט שנוצר (BrdU או mtDNA spot) אכן ממוקם במיטוכונדריה, יש צורך לשער אותם בהתבסס על עוצמת הפלואורסצנטיות של צבע מעקב המיטוכונדריה.</li>
	<li>בצע ניתוח נוסף של הנתונים המתקבלים באמצעות תוכנת ScanR באמצעות התוכנה הסטטיסטית R 4.2.216 יחד עם החבילות הבאות: dplyr 17, data.table18, ggplot219 ו- ggpubr20. שלב זה הוא אופציונלי.</li>
</ol>

כימות בתפוקה גבוהה של סינתזה והפצה של mtDNA

<ol>
	<li>Brown, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+respiration+and+ATP+synthesis+in+mammalian+mitochondria+and+cells.">Control of respiration and ATP synthesis in mammalian mitochondria and cells.</a> The Biochemical Journal. 284, 1-13 (1992).</li><li>Zhang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+basis+and+metabolic+interplay+of+redox+regulation).">Biochemical basis and metabolic interplay of redox regulation).</a> Redox Biology. 26, 101284 (2019).</li><li>Pizzo, P., Drago, I., Filadi, R., Pozzan, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+Ca2++homeostasis:+Mechanism,+role,+and+tissue+specificities.">Mitochondrial Ca2+ homeostasis: Mechanism, role, and tissue specificities.</a> Pflugers Archiv: European Journal of Physiology. 464 (1), 3-17 (2012).</li><li>Shadel, G. S., Horvath, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+ROS+signaling+in+organismal+homeostasis.">Mitochondrial ROS signaling in organismal homeostasis.</a> Cell. 163 (3), 560-569 (2015).</li><li>Mart&#237;nez-Reyes, I., Chandel, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+TCA+cycle+metabolites+control+physiology+and+disease.">Mitochondrial TCA cycle metabolites control physiology and disease.</a> Nature Communications. 11 (1), 102 (2020).</li><li>Galluzzi, L., Kepp, O., Trojel-Hansen, C., Kroemer, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+control+of+cellular+life,+stress,+and+death.">Mitochondrial control of cellular life, stress, and death.</a> Circulation Research. 111 (9), 1198-1207 (2012).</li><li>Rone, M. B., Fan, J., Papadopoulos, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cholesterol+transport+in+steroid+biosynthesis:+role+of+protein-protein+interactions+and+implications+in+disease+states.">Cholesterol transport in steroid biosynthesis: role of protein-protein interactions and implications in disease states.</a> Biochimica Et Biophysica Acta. 1791 (7), 646-658 (2009).</li><li>Swenson, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+synthesis+to+utilization:+The+ins+and+outs+of+mitochondrial+heme.">From synthesis to utilization: The ins and outs of mitochondrial heme.</a> Cells. 9 (3), 579 (2020).</li><li>West, A. P., Shadel, G. S., Ghosh, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondria+in+innate+immune+responses.">Mitochondria in innate immune responses.</a> Nature Reviews. Immunology. 11 (6), 389-402 (2011).</li><li>Nunnari, J., Suomalainen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondria:+In+sickness+and+in+health.">Mitochondria: In sickness and in health.</a> Cell. 148 (6), 1145-1159 (2012).</li><li>Pohjoism&#228;ki, J. L. O., Goffart, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Of+circles,+forks+and+humanity:+Topological+organisation+and+replication+of+mammalian+mitochondrial+DNA.">Of circles, forks and humanity: Topological organisation and replication of mammalian mitochondrial DNA.</a> BioEssays. 33 (4), 290-299 (2011).</li><li>Gustafsson, C. M., Falkenberg, M., Larsson, N. -. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+and+expression+of+mammalian+mitochondrial+DNA.">Maintenance and expression of mammalian mitochondrial DNA.</a> Annual Review of Biochemistry. 85, 133-160 (2016).</li><li>Nicholls, T. J., Gustafsson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separating+and+segregating+the+human+mitochondrial+genome.">Separating and segregating the human mitochondrial genome.</a> Trends in Biochemical Sciences. 43 (11), 869-881 (2018).</li><li>Gratzner, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibody+to+5-bromo-+and+5-iododeoxyuridine:+A+new+reagent+for+detection+of+DNA+replication.">Monoclonal antibody to 5-bromo- and 5-iododeoxyuridine: A new reagent for detection of DNA replication.</a> Science. 218 (4571), 474-475 (1982).</li><li>Stirling, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CellProfiler+4:+Improvements+in+speed,+utility+and+usability.">CellProfiler 4: Improvements in speed, utility and usability.</a> BMC Bioinformatics. 22 (1), 433 (2021).</li><li>R Core Team. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=R:+A+Language+and+Environment+for+Statistical+Computing.">R: A Language and Environment for Statistical Computing.</a> R Foundation for Statistical Computing. , (2021).</li><li>. dplyr: A Grammar of Data Manipulation Available from: <a target="_blank" href="https://CRAN.R-project.org/package=dplyr">https://CRAN.R-project.org/package=dplyr</a> (2021)</li><li>. data.table: Extension of `data.frame Available from: <a target="_blank" href="https://CRAN.R-project.org/package=data.table">https://CRAN.R-project.org/package=data.table</a> (2020)</li><li>. ggplot2: Elegant graphics for data analysis Available from: <a target="_blank" href="https://ggplot2.tidyverse.org">https://ggplot2.tidyverse.org</a> (2016)</li><li>. ggpubr: &amp;#34;ggplot2&amp;#34; based publication ready plots Available from: <a target="_blank" href="https://CRAN.R-project.org/package=ggpubr">https://CRAN.R-project.org/package=ggpubr</a> (2020)</li><li>Hashiguchi, K., Zhang-Akiyama, Q. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+human+cell+lines+lacking+mitochondrial+DNA.">Establishment of human cell lines lacking mitochondrial DNA.</a> Methods in Molecular Biology. 554, 383-391 (2009).</li><li>Piechota, J., Szczesny, R., Wolanin, K., Chlebowski, A., Bartnik, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+and+mitochondrial+genome+responses+in+HeLa+cells+treated+with+inhibitors+of+mitochondrial+DNA+expression.">Nuclear and mitochondrial genome responses in HeLa cells treated with inhibitors of mitochondrial DNA expression.</a> Acta Biochimica Polonica. 53 (3), 485-495 (2006).</li><li>Spelbrink, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+mitochondrial+DNA+deletions+associated+with+mutations+in+the+gene+encoding+Twinkle,+a+phage+T7+gene+4-like+protein+localized+in+mitochondria.">Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 gene 4-like protein localized in mitochondria.</a> Nature Genetics. 28 (3), 223-231 (2001).</li><li>Campbell, C. T., Kolesar, J. E., Kaufman, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+transcription+factor+A+regulates+mitochondrial+transcription+initiation,+DNA+packaging,+and+genome+copy+number.">Mitochondrial transcription factor A regulates mitochondrial transcription initiation, DNA packaging, and genome copy number.</a> Biochimica et Biophysica Acta. 1819 (9-10), 921-929 (2012).</li><li>Krasich, R., Copeland, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+polymerases+in+the+mitochondria:+A+critical+review+of+the+evidence.">DNA polymerases in the mitochondria: A critical review of the evidence.</a> Frontiers in Bioscience. 22 (4), 692-709 (2017).</li><li>Kotrys, A. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+proteomics+revealed+C6orf203/MTRES1+as+a+factor+preventing+stress-induced+transcription+deficiency+in+human+mitochondria.">Quantitative proteomics revealed C6orf203/MTRES1 as a factor preventing stress-induced transcription deficiency in human mitochondria.</a> Nucleic Acids Research. 47 (14), 7502-7517 (2019).</li><li>Gratzner, H. G., Pollack, A., Ingram, D. J., Leif, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deoxyribonucleic+acid+replication+in+single+cells+and+chromosomes+by+immunologic+techniques.">Deoxyribonucleic acid replication in single cells and chromosomes by immunologic techniques.</a> Journal of Histochemistry &amp; Cytochemistry. 24 (1), 34-39 (1976).</li><li>Leif, R. C., Stein, J. H., Zucker, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+short+history+of+the+initial+application+of+anti-5-BrdU+to+the+detection+and+measurement+of+S+phase.">A short history of the initial application of anti-5-BrdU to the detection and measurement of S phase.</a> Cytometry. Part A: The Journal of the International Society for Analytical Cytology. 58 (1), 45-52 (2004).</li><li>Lentz, S. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+(mtDNA)+biogenesis:+visualization+and+duel+incorporation+of+BrdU+and+EdU+into+newly+synthesized+mtDNA+in+vitro.">Mitochondrial DNA (mtDNA) biogenesis: visualization and duel incorporation of BrdU and EdU into newly synthesized mtDNA in vitro.</a> The Journal of Histochemistry and Cytochemistry. 58 (2), 207-218 (2010).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multi-omic+measurements+of+heterogeneity+in+HeLa+cells+across+laboratories.">Multi-omic measurements of heterogeneity in HeLa cells across laboratories.</a> Nature Biotechnology. 37 (3), 314-322 (2019).</li></ol>

למחברים אין מה לחשוף.

מבחינה היסטורית, תיוג DNA על ידי שילוב BrdU וזיהוי נוגדנים שימש בשכפול DNA גרעיני ומחקר מחזור התא 14,27,28. עד כה, כל הפרוטוקולים לזיהוי DNA המסומן ב- BrdU כללו שלב דנטורציה של DNA (חומצי או תרמי) או עיכול אנזים (DNase או פרוטאינאז) כדי לאפשר חשיפה לאפיטופים ...

עבור רוב התאים האיקריוטים, מיטוכונדריה הם אברונים חיוניים, שכן הם ממלאים תפקיד מכריע בתהליכים תאיים רבים. בראש ובראשונה, מיטוכונדריה הם ספקי האנרגיה העיקריים של תאים1. מיטוכונדריה מעורבים גם בוויסות הומאוסטזיס תאי (לדוגמה, חמצון-חיזור תוך-תאי2 ומאזן הסידן3), איתות תאי 4,5, אפופטוזיס6, סינתזה של תרכובות ביוכימיות שונות7,8, והתגובה החיסונית המולדת9. תפקוד לקוי של המיטוכונדריה קשור למצבים פתולוגיים שונים ולמחלות אנושיות10.
תפקוד המיטוכונדריה תלוי במידע הגנטי הנמצא בשני גנומים נפרדים: הגנום הגרעיני והמיטוכונדריאלי. הגנום המיטוכונדריאלי מקודד מספר קטן של גנים בהשוואה לגנום הגרעיני, אך כל הגנים המקודדים ב-mtDNA חיוניים לחיי האדם. מנגנון החלבונים המיטוכונדריאליים הדרוש לשמירה על mtDNA מקודד על ידי nDNA. המרכיבים הבסיסיים של הרפליזום המיטוכונדריאלי, כמו גם כמה גורמים ביוגנזה מיטוכונדריאלית, כבר זוהו (נסקרו במחקר קודם11,12). עם זאת, מנגנוני השכפול והתחזוקה של הדנ"א המיטוכונדריאלי עדיין רחוקים מלהיות מובנים. בניגוד ל-nDNA, הגנום המיטוכונדריאלי קיים במספר עותקים, מה שמספק שכבה נוספת לוויסות ביטוי גנים מיטוכונדריאליים. הרבה פחות ידוע כיום על התפלגות והפרדה של mtDNA בתוך אברונים, באיזו מידה תהליכים אלה מוסדרים, ואם כן, אילו חלבונים מעורבים13. דפוס ההפרדה הוא חיוני כאשר תאים מכילים אוכלוסייה מעורבת של mtDNA מסוג בר ומוטציה. התפלגות לא שוויונית שלהם עלולה להוביל ליצירת תאים עם כמות מזיקה של mtDNA מוטציה.
עד כה, הגורמים החלבוניים הדרושים לתחזוקת mtDNA זוהו בעיקר בשיטות ביוכימיות, ניתוחים ביואינפורמטיים או באמצעות מחקרים הקשורים למחלות. בעבודה זו, על מנת להבטיח סיכוי גבוה לזיהוי גורמים שחמקו בעבר מזיהוי, מתוארת אסטרטגיה שונה. השיטה מבוססת על תיוג של mtDNA במהלך שכפול או תיקון עם 5-bromo-2'-deoxyuridine (BrdU), אנלוג נוקלאוזיד של תימידין. BrdU משולב בקלות בגדילי דנ"א מתהווים במהלך סינתזת דנ"א, ובאופן כללי, משמש לניטור שכפול דנ"א גרעיני14. עם זאת, ההליך שפותח כאן הותאם לאיתור BrdU המשולב ב- mtDNA באמצעות אימונופלואורסנציה של נוגדנים נגד BrdU.
הגישה מאפשרת כימות בתפוקה גבוהה של סינתזת mtDNA והפצה בתאים אנושיים בתרבית חוץ גופית. יש צורך באסטרטגיית תפוקה גבוהה כדי לבצע בדיקות בתנאי ניסוי שונים בזמן קצר יחסית; לכן, מוצע בפרוטוקול להשתמש בפורמט רב בארות לתרבית תאים ומיקרוסקופ פלואורסצנטי אוטומטי להדמיה. הפרוטוקול כולל העברה של תאי HeLa אנושיים עם ספריית siRNA וניטור עוקב של שכפול או תיקון mtDNA באמצעות תיוג מטבולי של DNA מסונתז חדש עם BrdU. גישה זו משולבת עם immunostaining של ה- DNA בעזרת נוגדנים anti DNA. שני הפרמטרים מנותחים באמצעות מיקרוסקופ פלואורסצנטי כמותי. נוסף על כך, מדמיינים מיטוכונדריה באמצעות צבע מסוים. כדי להדגים את הספציפיות של הפרוטוקול, צביעת BrdU נבדקה על תאים נטולי mtDNA (תאי rho0), על תאי HeLa על השתקה של גורמי תחזוקה ידועים של mtDNA, ועל תאי HeLa לאחר טיפול במעכב שכפול mtDNA. רמות mtDNA נמדדו גם בשיטה עצמאית, כלומר qPCR.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2&#8242;,3&#8242;-Dideoxycytidine (ddC)</td>
			<td>Sigma-Aldrich</td>
			<td>D5782</td>
			<td></td>
		</tr>
		<tr>
			<td>384&#160; Well Cell Culture Microplates, black</td>
			<td>Greiner Bio-One</td>
			<td>#781946</td>
			<td></td>
		</tr>
		<tr>
			<td>5-Bromo-2&#8242;-deoxyuridine (BrdU)</td>
			<td>Sigma-Aldrich</td>
			<td>B5002-1G</td>
			<td>Dissolve BrdU powder in water to 20 mM stock solution and aliquot. Use 20 &#181;M BrdU solution for labeling.</td>
		</tr>
		<tr>
			<td>Adhesive sealing film</td>
			<td>Nerbe Plus</td>
			<td>04-095-0060</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa Fluor 488 goat anti-mouse IgG1 secondary antibody</td>
			<td>Thermo Fisher Scientific</td>
			<td>A-21121</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa Fluor 555 goat anti-mouse IgM secondary antibody</td>
			<td>Thermo Fisher Scientific</td>
			<td>A-21426</td>
			<td></td>
		</tr>
		<tr>
			<td>BioTek 405 LS microplate washer</td>
			<td>Agilent</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin (BSA)</td>
			<td>Sigma-Aldrich</td>
			<td>A4503</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell counting chamber Thoma</td>
			<td>Heinz Herenz</td>
			<td>REF:1080339</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Cytiva</td>
			<td>SH30243.01</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Thermo Fisher Scientific</td>
			<td>41965-062</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Thermo Fisher Scientific</td>
			<td>10270-106</td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde solution</td>
			<td>Sigma-Aldrich</td>
			<td>F1635</td>
			<td>Formaldehyde is toxic; please read the safety data sheet carefully.</td>
		</tr>
		<tr>
			<td>Hoechst 33342</td>
			<td>Thermo Fisher Scientific</td>
			<td>H3570</td>
			<td></td>
		</tr>
		<tr>
			<td>IgG1 mouse monoclonal anti-BrdU (IIB5) primary antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-32323</td>
			<td></td>
		</tr>
		<tr>
			<td>IgM mouse monoclonal anti-DNA (AC-30-10) primary antibody</td>
			<td>Progen</td>
			<td>#61014</td>
			<td></td>
		</tr>
		<tr>
			<td>LightCycler 480 System</td>
			<td>Roche</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine RNAiMAX Transfection Reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>#13778150</td>
			<td></td>
		</tr>
		<tr>
			<td>MitoTracker Deep Red FM</td>
			<td>Thermo Fisher Scientific</td>
			<td>M22426</td>
			<td>Mitochondria tracking dye&#160;</td>
		</tr>
		<tr>
			<td>Multidrop Combi Reagent Dispenser</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Opti-MEM</td>
			<td>Thermo Fisher Scientific</td>
			<td>51985-042</td>
			<td></td>
		</tr>
		<tr>
			<td>Orca-R2 (C10600) CCD Camera</td>
			<td>Hamamatsu</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>P0781-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate buffered saline (PBS)</td>
			<td>Sigma-Aldrich</td>
			<td>P4417-100TAB</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerUp SYBR Green Master Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25742</td>
			<td></td>
		</tr>
		<tr>
			<td>qPCR primer Fw B2M (reference)</td>
			<td></td>
			<td></td>
			<td>CAGGTACTCCAAAGATTCAGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Fw GPI (reference gene)</td>
			<td></td>
			<td></td>
			<td>GACCTTTACTACCCAGGAGA</td>
		</tr>
		<tr>
			<td>qPCR primer Fw MT-ND1&#160;</td>
			<td></td>
			<td></td>
			<td>TAGCAGAGACCAACCGAACC&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Fw POLG</td>
			<td></td>
			<td></td>
			<td>TGGAAGGCAGGCATGGTCAAACC</td>
		</tr>
		<tr>
			<td>qPCR primer Fw TFAM</td>
			<td></td>
			<td></td>
			<td>GATGAGTTCTGCCTGCTTTAT</td>
		</tr>
		<tr>
			<td>qPCR primer Fw TWNK</td>
			<td></td>
			<td></td>
			<td>GCCATGTGACACTGGTCATT</td>
		</tr>
		<tr>
			<td>qPCR primer Rev B2M (reference)</td>
			<td></td>
			<td></td>
			<td>GTCAACTTCAATGTCGGATGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Rev GPI (reference gene)</td>
			<td></td>
			<td></td>
			<td>AGTAGACAGGGCAACAAAGT</td>
		</tr>
		<tr>
			<td>qPCR primer Rev MT-ND1&#160;</td>
			<td></td>
			<td></td>
			<td>ATGAAGAATAGGGCGAAGGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Rev POLG</td>
			<td></td>
			<td></td>
			<td>GGAGTCAGAACACCTGGCTTTGG</td>
		</tr>
		<tr>
			<td>qPCR primer Rev TFAM</td>
			<td></td>
			<td></td>
			<td>GGACTTCTGCCAGCATAATA</td>
		</tr>
		<tr>
			<td>qPCR primer Rev TWNK</td>
			<td></td>
			<td></td>
			<td>AACATTGTCTGCTTCCTGGC</td>
		</tr>
		<tr>
			<td>ScanR microscope</td>
			<td>Olympus</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA Ctrl</td>
			<td>Dharmacon</td>
			<td>D-001810-10-5</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA POLG</td>
			<td>Invitrogen</td>
			<td>POLGHSS108223</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA TFAM</td>
			<td>Invitrogen</td>
			<td>TFAMHSS144252</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA TWNK</td>
			<td>Invitrogen</td>
			<td>C10orf2HSS125597</td>
			<td></td>
		</tr>
		<tr>
			<td>Suction device</td>
			<td>NeoLab</td>
			<td>2-9335</td>
			<td>Suction device for cell culture</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>T9284-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin</td>
			<td>Biowest</td>
			<td>L0931-500</td>
			<td></td>
		</tr>
		<tr>
			<td>UPlanSApo 20x 0.75 NA objective</td>
			<td>Olympus</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

high-throughput image-based quantification of mitochondrial dna synthesis and distribution

הרוב המכריע של תהליכים תאיים דורשים אספקה רציפה של אנרגיה, המוביל הנפוץ ביותר של אשר הוא מולקולת ATP. תאים אאוקריוטים מייצרים את רוב ה-ATP שלהם במיטוכונדריה על ידי זרחן חמצוני. מיטוכונדריה הם אברונים ייחודיים מכיוון שיש להם גנום משלהם המשוכפל ומועבר לדור הבא של התאים. בניגוד לגנום הגרעיני, ישנם עותקים רבים של הגנום המיטוכונדריאלי בתא. המחקר המפורט של המנגנונים האחראים לשכפול, תיקון ותחזוקה של הגנום המיטוכונדריאלי חיוני להבנת תפקודם התקין של מיטוכונדריה ותאים שלמים בתנאי נורמליות ומחלות כאחד. כאן מוצגת שיטה המאפשרת כימות בתפוקה גבוהה של סינתזה והפצה של DNA מיטוכונדריאלי (mtDNA) בתאים אנושיים בתרבית חוץ גופית . גישה זו מבוססת על זיהוי אימונופלואורסצנטי של מולקולות DNA מסונתזות באופן פעיל המסומנות על ידי שילוב 5-bromo-2'-deoxyuridine (BrdU) וזיהוי בו זמנית של כל מולקולות mtDNA עם נוגדנים נגד DNA. נוסף על כך, מדמיינים את המיטוכונדריה בעזרת צבעים או נוגדנים ספציפיים. גידול תאים בפורמט רב-באר ושימוש במיקרוסקופ פלואורסצנטי אוטומטי מקלים על חקר הדינמיקה של mtDNA והמורפולוגיה של המיטוכונדריה במגוון תנאי ניסוי בזמן קצר יחסית.

For most eukaryotic cells mitochondria are essential organelles, as they play a crucial role in numerous cellular processes. First and foremost, mitochondria are the key energy suppliers of cells1. Mitochondria are also involved in regulating cellular homeostasis (for instance, intracellular redox2 and the calcium balance3), cell signaling4,5, apoptosis6, the synthesis of different biochemical compounds7,8, and the innate immune response9. Mitochondrial dysfunction is associated with various pathological states and human diseases10. 
The functioning of mitochondria depends on the genetic information located in two separate genomes: the nuclear and mitochondrial genomes. The mitochondrial genome encodes a small number of genes compared to the nuclear genome, but all the mtDNA-encoded genes are essential for human life. The mitochondrial protein machinery necessary to maintain the mtDNA is encoded by nDNA. The basic components of the mitochondrial replisome, as well as some mitochondrial biogenesis factors, have already been identified (reviewed in previous research11,12). However, mitochondrial DNA replication and maintenance mechanisms are still far from being understood. In contrast to nDNA, the mitochondrial genome exists in multiple copies, which provides an additional layer for regulating mitochondrial gene expression. Much less is currently known about the distribution and segregation of mtDNA within organelles, to what extent these processes are regulated, and if they are, which proteins are involved13. The segregation pattern is crucial when cells contain a mixed population of wild-type and mutated mtDNA. Their unequal distribution may lead to the generation of cells with a detrimental amount of mutated mtDNA.
So far, the protein factors necessary for mtDNA maintenance have been identified mainly by biochemical methods, bioinformatic analyses, or through disease-associated studies. In this work, in order to ensure a high chance of identifying factors that have previously escaped identification, a different strategy is described. The method is based on the labeling of mtDNA during replication or repair with 5-bromo-2'-deoxyuridine (BrdU), a nucleoside analog of thymidine. BrdU is readily incorporated into nascent DNA strands during DNA synthesis and, in general, is used for monitoring the replication of nuclear DNA14. However, the procedure developed here has been optimized for detecting BrdU incorporated into mtDNA using the immunofluorescence of anti-BrdU antibodies.
The approach allows for the high-throughput quantification of mtDNA synthesis and distribution in human cells cultured in vitro. A high-throughput strategy is necessary to conduct tests under different experimental conditions in a relatively short time; therefore, it is proposed in the protocol to utilize a multi-well format for cell culturing and automated fluorescence microscopy for imaging. The protocol includes the transfection of human HeLa cells with an siRNA library and the subsequent monitoring of mtDNA replication or repair using the metabolic labeling of newly synthesized DNA with BrdU. This approach is combined with immunostaining of the DNA with the help of anti-DNA antibodies. Both parameters are analyzed using quantitative fluorescence microscopy. Additionally, mitochondria are visualized with a specific dye. To demonstrate the specificity of the protocol, BrdU staining was tested on cells devoid of mtDNA (rho0 cells), on HeLa cells upon the silencing of well-known mtDNA maintenance factors, and on HeLa cells after treatment with an mtDNA replication inhibitor. The mtDNA levels were also measured by an independent method, namely qPCR.

מחבר זרקור: כימות מבוסס תמונה בתפוקה גבוהה של סינתזה והפצה של DNA מיטוכונדריאלי  

כימות מבוסס תמונה בתפוקה גבוהה של סינתזה והפצה של DNA מיטוכונדריאלי

The protocol aims to identify proteins with dysfunction leads to changes in the number of mitochondrial DNA molecules. This research may also reveal the factors involving the distribution of mitochondrial DNA within the mitochondria. Mitochondrial replication and maintenance mechanisms are still not fully understood.Much less is known about regulating the distribution of mitochondrial genomes within organoids and the proteins involved in it. As a result, identifying and characterizing some new players will be of great importance. The main advantage of the technique is its high-throughput and high content protocol.We can simultaneously test many experimental conditions and measure various parameters during a single experiment. In genome-wide studies, the proposed protocol provides an opportunity to outline a global picture of how nuclear encoded genetic information regulates its mitochondrial counterpart. Additionally, it has the potential to identify proteins whose dysfunction causes mitochondrial DNA stress and activates the interferon response pathway.

סכימה של ההליך לחקר התפוקה הגבוהה של הדינמיקה של סינתזה והפצה של mtDNA מוצגת באיור 1. השימוש בפורמט של צלחת מרובת בארות מאפשר ניתוח סימולטני של תנאי ניסוי רבים ושונים, כגון השתקה של גנים שונים באמצעות ספריית siRNA. התנאים המשמשים לתיוג של מולקולות דנ"א מסונתזות חדשות עם BrdU מאפשר?...

Watch this Scientific Journal Video about High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution at JoVE.com

מתואר הליך לחקר הדינמיקה של מטבוליזם של דנ"א מיטוכונדריאלי (mtDNA) בתאים באמצעות פורמט צלחת מרובת בארות והדמיה אימונופלואורסצנטית אוטומטית כדי לזהות ולכמת סינתזה והפצה של mtDNA. זה יכול לשמש גם כדי לחקור את ההשפעות של מעכבים שונים, לחצים תאיים והשתקת גנים על חילוף החומרים mtDNA.

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells ...

מטרת הפרוטוקול היא לזהות חלבונים עם תפקוד לקוי המוביל לשינויים במספר מולקולות הדנ"א המיטוכונדריאלי. מחקר זה עשוי גם לחשוף את הגורמים הקשורים להתפלגות הדנ"א המיטוכונדריאלי בתוך המיטוכונדריה. מנגנוני השכפול והתחזוקה של המיטוכונדריה עדיין אינם מובנים במלואם.הרבה פחות ידוע על ויסות התפלגות הגנום המיטוכונדריאלי בתוך אורגנואידים והחלבונים המעורבים בו. כתוצאה מכך, זיהוי ואפיון כמה שחקנים חדשים יהיה בעל חשיבות רבה. היתרון העיקרי של הטכניקה הוא תפוקה גבוהה שלה פרוטוקול תוכן גבוה.אנו יכולים לבחון בו זמנית תנאי ניסוי רבים ולמדוד פרמטרים שונים במהלך ניסוי יחיד. במחקרים כלל-גנומיים, הפרוטוקול המוצע מספק הזדמנות לשרטט תמונה גלובלית של האופן שבו מידע גנטי מקודד גרעיני מווסת את מקבילו המיטוכונדריאלי. בנוסף, יש לו פוטנציאל לזהות חלבונים שתפקודם הלקוי גורם לעקה בדנ"א המיטוכונדריאלי ומפעיל את מסלול התגובה של אינטרפרון.

high-throughput-image-based-quantification-mitochondrial-dna

Research

JoVE Journal

Biochemistry

High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution

1.5K Views.  University of Warsaw. מטרת הפרוטוקול היא לזהות חלבונים עם תפקוד לקוי המוביל לשינויים במספר מולקולות הדנ"א המיטוכונדריאלי. מחקר זה עשוי גם לחשוף את הגורמים הקשורים להתפלגות הדנ"א המיטוכונדריאלי בתוך המיטוכונדריה. מנגנוני השכפול והתחזוקה של המיטוכונדריה עדיין אינם מובנים במלואם.הרבה פחות י...

Video: מחבר זרקור: כימות מבוסס תמונה בתפוקה גבוהה של סינתזה והפצה של DNA מיטוכונדריאלי  

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells produce most of their ATP in the mitochondria by oxidative phosphorylation. Mitochondria are unique organelles because they have their own genome that is replicated and passed on to the next generation of cells. In contrast to the nuclear genome, there are multiple copies of the mitochondrial genome in the cell. The detailed study of the mechanisms responsible for the replication, repair, and maintenance of the mitochondrial genome is essential for understanding the proper functioning of mitochondria and whole cells under both normal and disease conditions. Here, a method that allows the high-throughput quantification of the synthesis and distribution of mitochondrial DNA (mtDNA) in human cells cultured in vitro is presented. This approach is based on the immunofluorescence detection of actively synthesized DNA molecules labeled by 5-bromo-2'-deoxyuridine (BrdU) incorporation and the concurrent detection of all the mtDNA molecules with anti-DNA antibodies. Additionally, the mitochondria are visualized with specific dyes or antibodies. The culturing of cells in a multi-well format and the utilization of an automated fluorescence microscope make it easier to study the dynamics of mtDNA and the morphology of mitochondria under a variety of experimental conditions in a relatively short time.

A procedure for studying the dynamics of mitochondrial DNA (mtDNA) metabolism in cells using a multi-well plate format and automated immunofluorescence imaging to detect and quantify mtDNA synthesis and distribution is described. This can be further used to investigate the effects of various inhibitors, cellular stresses, and gene silencing on mtDNA metabolism.

Preparation of siRNA Mixture for Mitochondrial DNA Synthesis

To begin, prepare a 140 nano molar mix of small interfering RNA or siRNA by diluting the siRNA in optimum medium. Add the five microliters of the diluted mix to the wells of a black 384 well cell culture microplate. Prepare the appropriate amount of RNAiMAX transfection reagent solution in optimum medium and add 10 microliters to each well of the 384 well plate with a reagent dispenser.

הכנת תערובת siRNA לסינתזה של DNA מיטוכונדריאלי

Cell Transfection and 5-Bromo-2&#39;-Deoxyuridine (BrdU) Incorporation in HeLa Cells

Cell Transfection and 5-Bromo-2&#039;-Deoxyuridine (BrdU) Incorporation in HeLa Cells  

To begin the cell transfection, add 20 microliters of the HeLa cell suspension to the 384-well plate wells containing diluted siRNA to seed 700 HeLa cells per well. After one hour of incubation at room temperature, place the well plate in an incubator for 72 hours at 37 degrees Celsius and 5%carbon dioxide. To incorporate BrdU in the transfected cells, add 10 microliters of 90-micromolar BrdU solution to each well after 56 hours of siRNA transfection.Incubate the cells for 16 hours at 37 degrees Celsius and 5%carbon dioxide. The specificity of BrdU incorporation into the mitochondrial DNA of HeLa cells was studied using rho0 cells lacking mitochondrial DNA.

טרנספקציה של תאים ושילוב 5-Bromo-2&#39;-Deoxyuridine (BrdU) בתאי HeLa

5-Bromo-2&#39;-Deoxyuridine (BrdU) Labeling of Mitochondrial DNA in HeLa Cells

5-Bromo-2&#039;-Deoxyuridine (BrdU) Labeling of Mitochondrial DNA in HeLa Cells  

To begin the mitochondria labeling prepare a 20 micromolar solution of BrdU in DMEM with 10%fetal bovine serum or FBS. Then add the mitochondria tracking dye to adjust the final concentration to 1.1 micromolar. After 15 hours add 10 microliters of the mitochondria tracking dye solution to the HeLa cell suspension containing wells.Incubate the cells for one hour. The conditions used to label newly synthesized DNA molecules with BrdU allowed the detection of BrdU labeled DNA in the mitochondria of HeLa cells. The signal obtained with anti-BrdU antibodies was specific and only observed in cells treated with BrdU.Regardless of BrdU treatment no anti-BrdU or anti-DNA antibody signal was detected in the mitochondria of row zero cells. Quantifying the fluorescent signal from the anti-BrdU antibodies indicated that row zero cells treated with BrdU showed the same low level of fluorescence as the BrdU untreated cells, while the signal for the parental lines A549 and HeLa were 50 fold higher.

5-Bromo-2&#39;-Deoxyuridine (BrdU) תיוג של DNA מיטוכונדריאלי בתאי HeLa

HeLa Cell Fixation with Hoechst 33342 and Blocking

To begin the HeLa cell fixation, rinse the HeLa cell-containing 384-well plate two times with 100 microliters of PBS using the microplate washer. Leave 25 microliters of PBS in the well after the second wash and add 25 microliters of an 8%formaldehyde solution. Incubate the plate in the dark at room temperature for 30 minutes.Then, rinse each well four times with 100 microliters of PBS and leave 25 microliters of PBS in the well after the last wash. Add 25 microliters of 6%bovine serum albumin, or BSA, in PBS to each well and incubate the plate in the dark for 30 minutes.

קיבוע תאי HeLa עם Hoechst 33342 וחסימה

Addition of Primary and Secondary Antibodies to the Transfected HeLa Cells to Monitor the mtDNA Distribution

To begin the addition of the primary antibody, aspirate the bovine serum albumin or BSA from the fixed and blocked transfected HeLa cells leaving 10 microliters of BSA solution in the well. Then add 10 microliters of the primary antibody solution prepared in 3%BSA in PBS and incubate the plate in the dark at four degrees Celsius overnight. After the incubation, rinse each well four times with 100 microliters of PBS, leaving 10 microliters after the last wash.Next, add 10 microliters of secondary antibody solution to the 384 well plate. Use isotype specific antibodies conjugated to fluorochromes, such as Alexa Fluor 488 and Alexa Fluor 555. After incubating the plate in the dark for one hour, rinse each well four times with 100 microliters of PBS and leave 50 microliters of PBS in the well after the last wash.The use of anti-DNA antibodies allowed the monitoring of the mitochondrial DNA distribution in the cell under the given experimental conditions. The downregulation of mitochondrial transcription factor A TFAM led to drastic changes in the mitochondrial DNA distribution with fewer mitochondrial DNA spots than in control cells. Quantifying the mean fluorescent signal from the anti-DNA antibody showed a several fold increase upon TFAM silencing compared to the other conditions tested.

הוספת נוגדנים ראשוניים ומשניים לתאי HeLa הנגועים כדי לפקח על התפלגות mtDNA

Quantitative Image Analysis to Measure the mtDNA and Gene Expression Levels in the Transfected HeLa Cells

To begin the imaging of transfected HeLa cells select a sufficiently long exposure time for the individual fluorescence channels in live view mode based on the intensity histograms generated by the imaging software. Set the appropriate number of planes for imaging on the Z axis. Select the appropriate number of fields of view to display per well.To start the quantitative analysis of acquired images, perform background correction for all the images from all the fluorescence channels. Depending on the size of the analyzed objects, select the appropriate filter size. Next, start the image segmenting by creating a mask of the main object based on the ratio of the intensity of the fluorescent signal to the background for the channel corresponding to the cell nuclei.Create masks for the sub objects representing BrdU and mitochondrial DNA spots using the fluorescence channels appropriate for the given structures. Set the parameters and measure the intensity of the individual pixels within each mask for all the fluorescence channels. To obtain the total fluorescence intensities for the BrdU or mitochondrial DNA channel sum up the intensities of all the sub objects assigned to a given cell nucleus.To obtain the mean fluorescence intensity, divide the total fluorescence intensity by the sum of the area of the sub objects assigned to a given cell nucleus. The imaging results were verified by measuring the mitochondrial DNA and gene expression levels using quantitative real-time PCR. Treatment with dideoxycytidine or DDC resulted in a very strong decrease in the mitochondrial DNA levels.A weaker effect was observed in TFAM and TWINKLE helicase silencing, while the transfection of cells with mitochondrial DNA polymerase gamma or POLG siRNA had a modest effect on the mitochondrial DNA copy number. Quantifying the TFAM and TWINKLE helicase expression confirmed an efficient reduction in their mRNA expression to approximately 15 to 20%of the control levels. In POLG, the mRNA expression was reduced only to 30%which explains the unexpected modest effect on the mitochondrial DNA copy number.