이 작업은 폴란드 국립 과학 센터(보조금/수상 번호: 2018/31/D/NZ2/03901)의 지원을 받았습니다.

1. siRNA 혼합물의 제조
<ol><li>실험 시작 하루 전, 종자 세포(예: HeLa)를 100mm 접시에 올려 다음날 70%-90% 합류에 도달하도록 합니다. 알림: 모든 작업은 층류 챔버의 무균 조건에서 수행해야 합니다.</li>
	<li>Opti-MEM 배지에서 140 nM의 농도로 희석된 siRNA를 적당량 준비한다( 재료 표 참조). 96웰 플레이트를 저장소로 사용할 수 있습니다.</li>
	<li>5μL의 siRNA 용액(또는 대조군 샘플용 Opti-MEM 배지)을 검은색 384웰 세포 배양 마이크로플레이트의 각 웰에 추가합니다. 참고: 테스트한 siRNA 샘플의 수에 따라 전자 또는 다중 채널 피펫을 사용할 수 있습니다.</li>
	<li>Opti-MEM 배지에서 적절한 양의 RNAiMAX 형질주입 시약 용액( 재료 표 참조)을 준비합니다. 배지 100μL당 RNAiMAX 1μL을 추가합니다.</li>
	<li>형질주입 시약 용액 10μL를 384웰 플레이트의 각 웰에 추가합니다. 이를 수행하는 가장 편리하고 빠른 방법은 시약 디스펜서를 사용하는 것입니다.</li>
	<li>siRNA를 실온에서 30분 동안 형질주입 시약과 함께 인큐베이션합니다.</li>
</ol>2. 형질주입을 위한 세포의 제조
<ol><li>인큐베이션 (단계 1.6) 동안, 흡입 장치 ( 재료 표 참조)를 사용하여 배지를 흡인하고, 세포를 3 mL의 PBS로 세척한다.</li>
	<li>PBS에 1:2로 희석된 트립신 1.5mL를 넣고 37°C에서 10분 동안 세포를 배양합니다.</li>
	<li>셀이 분리되었는지 확인하십시오. 그렇다면 10% FBS가 있는 DMEM 배지 3mL를 추가합니다. 세포를 완전히 현탁하고 15mL 튜브로 옮깁니다. 현탁액의 최소 150 μL를 취하고, 세포 계수 챔버에서 세포를 계수한다 ( 물질의 표 참조).</li>
	<li>10% FBS, 페니실린 및 스트렙토마이신이 포함된 DMEM 배지에서 적절한 농도(HeLa 라인의 경우 35,000/mL)로 세포 현탁액을 준비합니다.</li>
</ol>3. 세포 형질감염
<ol><li>시약 디스펜서를 사용하여 384-웰 플레이트의 각 웰에 20 μL의 세포 현탁액을 추가합니다. 이렇게 하면 웰당 700개의 세포가 시딩됩니다.</li>
	<li>세포를 실온에서 1시간 동안 인큐베이션한 다음, 72시간 동안 인큐베이터에 넣는다(37°C 및 5%CO2).</li>
</ol>4. BrdU 법인 설립
<ol><li>10% FBS가 있는 DMEM 배지에서 BrdU의 90μM 용액( 재료 표 참조)을 준비합니다.</li>
	<li>siRNA 형질감염 후 56시간(세포 고정 전 16시간)에 90μM BrdU 용액 10μL를 384웰 플레이트의 각 웰에 추가합니다(최종 BrdU 농도는 20μM). 알림: 작업은 가능한 한 빨리 수행해야 합니다. 따라서 시약 디스펜서, 전자 피펫 또는 멀티 디스펜서 피펫을 사용하는 것이 가장 좋습니다. BrdU를 추가하지 않고 제어 우물을 준비하는 것을 잊지 마십시오.</li>
	<li>세포를 16시간 동안 인큐베이션한다(37°C 및 5%CO2).</li>
</ol>5. 미토콘드리아의 표지
<ol><li>10% FBS를 갖는 DMEM 중의 BrdU의 20 μM 용액을 준비하고, 여기에 미토콘드리아 추적 염료 용액( 재료 표 참조)을 1.1 μM의 농도로 첨가한다.</li>
	<li>BrdU 혼입 시작 후 15시간(세포 고정 1시간 전)에 10μL의 미토콘드리아 추적 염료 용액( 재료 표 참조)을 384웰 플레이트의 각 웰에 추가합니다(최종 염료 농도는 200nM). 알림: 시약 디스펜서, 전자 피펫 또는 멀티 디스펜서 피펫을 사용하십시오. BrdU를 추가하지 않고 미토콘드리아 추적 염료를 추가하여 제어 웰을 유지하는 것을 잊지 마십시오.</li>
	<li>세포를 1시간 동안 인큐베이션한다(37°C 및 5%CO2).</li>
</ol>6. 세포 고정
참고: 모든 세척은 마이크로플레이트 세척기를 사용하여 가장 편리하게 수행되는 반면, 시약 추가는 시약 디스펜서를 사용하여 가장 빠르게 수행됩니다.
<ol><li>마이크로플레이트 세척기( 재료 표 참조)를 사용하여 100μL의 PBS로 각 웰을 두 번 헹굽니다. 두 번째 세척 후 25 μL의 PBS를 웰에 남겨 둡니다. 알림: PBS를 웰에 그대로 두면 다음 단계에서 액체를 추가하는 동안 세포가 분리될 가능성이 줄어듭니다. 모든 세척은 PBS가 남아 있는 상태에서 완료됩니다. 따라서 다음 단계에서 첨가된 용액은 나머지 PBS에 동일한 부피로 첨가될 것이므로 항상 2x 농도로 준비해야 합니다.</li>
	<li>4μg/mL의 농도로 0.4% Triton X-100 및 Hoechst 33342가 포함된 PBS에 8% 포름알데히드 용액 25μL를 추가하여 세포를 고정합니다(개별 시약의 최종 농도는 각각 4%, 0.2% 및 2μg/mL임)( 재료 표 참조).</li>
	<li>플레이트를 실온의 어두운 곳에서 30분 동안 배양합니다.</li>
</ol>7. 차단
<ol><li>PBS 100μL로 각 웰을 4회 헹굽니다. 마지막 세척 후 25μL의 PBS를 웰에 남겨둡니다.</li>
	<li>PBS에 6% BSA 25μL(최종 BSA 농도는 3%)를 각 웰에 추가합니다.</li>
	<li>플레이트를 실온의 어두운 곳에서 30분 동안 배양합니다.</li>
</ol>8. 1차 항체의 첨가
<ol><li>마이크로플레이트 세척기를 사용하여 BSA를 흡인하고 10μL의 용액을 웰에 남겨둡니다.</li>
	<li>PBS에 3% BSA에서 제조된 1차 항체 용액 10 μL를 첨가한다. 0.8μg/mL의 항-BrdU 및 0.4μg/mL의 항-DNA를 사용하십시오(항체의 최종 농도는 각각 0.4μg/mL 및 0.2μg/mL임)( 재료 표 참조).</li>
	<li>플레이트를 4°C의 암실에서 밤새 인큐베이션한다.</li>
</ol>9. 2차 항체의 첨가
<ol><li>PBS 100μL로 각 웰을 4회 헹굽니다. 마지막 세척 후 10 μL의 PBS를 웰에 남겨 둡니다.</li>
	<li>PBS에 4% BSA에서 제조된 4μg/mL 보조 항체 용액 6μL을 추가합니다(최종 농도는 2μg/mL). Alexa Fluor 488 및 Alexa Fluor 555와 같은 형광색소에 접합된 동형 특이적 항체(anti-mouse IgG1 및 anti-mouse IgM)를 사용합니다( 표 참조).</li>
	<li>플레이트를 실온에서 어두운 곳에서 1시간 동안 배양합니다.</li>
	<li>PBS 100μL로 각 웰을 4회 헹굽니다. 마지막 세척 후 50 μL의 PBS를 웰에 남겨 둡니다.</li>
	<li>접착 밀봉 필름( 재료 표 참조)으로 플레이트를 밀봉하고 4°C의 어두운 곳에 보관합니다. 이미징은 2주 이내에 수행해야 합니다.</li>
</ol>10. 이미징
참고: 이미징은 자동화된 광시야 현미경으로 수행해야 합니다. 현미경에는 플레이트의 개별 영역을 자동으로 이미지화할 수 있는 제어 장치와 함께 제공되는 모터 스테이지가 장착되어 있어야 합니다.
<ol><li>플레이트의 모서리 영역(웰 A1, A24, P24, P1)과 중앙에서 자동 초점 설정을 확인하십시오. 알림: 이미징의 경우 가능한 가장 높은 개구수를 가진 20배 짧은 작동 거리 대물렌즈( 재료 표 참조)를 사용하는 것이 좋습니다.</li>
	<li>라이브 뷰 모드에서 이미징 소프트웨어에 의해 생성된 강도 히스토그램을 기반으로 결과 이미지가 과포화되지 않도록 개별 형광 채널에 대해 충분히 긴 노출 시간을 선택합니다.</li>
	<li>z축에서 이미징을 위한 적절한 평면 수를 설정합니다. 참고: 20x 배율에서의 시야는 모든 셀이 동일한 초점면에 있지 않을 만큼 충분히 크므로 올바른 초점면에 있는 모든 셀을 보려면 z-절편을 수행해야 합니다. 일반적으로 5 대의 비행기로 충분합니다. 디스크 공간의 가용성에 따라 개별 z-스택 또는 최대 강도 프로젝션만 저장할 수 있습니다. 대표 결과 섹션에 표시된 이미지 분석은 최대 강도 투영을 기반으로 합니다.</li>
	<li>웰별로 표시할 적절한 수의 보기 필드를 선택합니다. 참고: 합류점에 따라 약 60-300개의 셀을 하나의 시야에서 이미지화할 수 있습니다. 일반적으로 합류도가 60%-90%인 HeLa 세포의 경우 5개의 시야를 이미징하면 500개 세포에서 1,000개 이상의 세포까지 분석할 수 있습니다.</li>
	<li>이미징할 웰을 선택하고 이미징을 시작합니다.</li>
</ol>11. 정량적 이미지 분석
참고: 획득한 이미지의 정량 분석은 Cell Profiler15와 같은 오픈 소스 소프트웨어를 사용하여 수행할 수 있습니다. 본 연구를 위해, 분석은 ScanR 3.0.0 소프트웨어를 사용하여 수행되었다( 재료 표 참조).
<ol><li>모든 형광 채널의 모든 이미지에 대해 배경 보정을 수행하여 분석을 시작합니다. 분석 된 물체의 크기에 따라 적절한 필터 크기를 선택하십시오 : 세포핵의 경우 80 픽셀, BrdU 및 mtDNA 스폿의 경우 4 픽셀.</li>
	<li>세포핵에 해당하는 채널에 대한 배경에 대한 형광 신호의 강도 비율을 기준으로 주 물체의 마스크를 만들어 이미지 분할을 시작합니다.</li>
	<li>주어진 구조에 적합한 형광 채널을 사용하여 각각 BrdU 및 mtDNA 스폿을 나타내는 하위 물체에 대한 마스크를 만듭니다. 참고: 각 하위 개체는 가장 가까운 주 개체(세포핵)에 할당됩니다.</li>
	<li>분석 중에 측정할 파라미터를 설정하고 모든 형광 채널에 대해 각 마스크 내의 개별 픽셀의 강도를 측정합니다. 참고: 또한 주어진 세포핵에 할당된 하위 물체의 수와 각 하위 물체의 면적을 계산해야 합니다.</li>
	<li>얻은 데이터를 기반으로 계산할 파생 매개 변수를 정의합니다. BrdU 또는 mtDNA 채널에 대한 총 형광 강도를 얻으려면 주어진 세포핵에 할당된 모든 하위 개체의 강도를 합산합니다. 평균 형광 강도를 구하기 위해, 총 형광 강도를 주어진 세포핵에 할당된 하위 물체의 면적의 합으로 나눕니다. 참고: 생성된 하위 개체(BrdU 또는 mtDNA 스팟)가 실제로 미토콘드리아에 위치하도록 하려면 미토콘드리아 추적 염료의 형광 강도를 기반으로 게이트를 지정해야 합니다.</li>
	<li>dplyr 17, data.table 18, ggplot219 및 ggpubr20 패키지와 함께 R 4.2.2 통계 소프트웨어 16을 사용하여 ScanR 소프트웨어로 얻은 데이터에 대한 추가 분석을 수행합니다. 이 단계는 선택 사항입니다.</li>
</ol>

mtDNA의 합성 및 분포에 대한 고처리량 정량화

<ol>
	<li>Brown, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+respiration+and+ATP+synthesis+in+mammalian+mitochondria+and+cells.">Control of respiration and ATP synthesis in mammalian mitochondria and cells.</a> The Biochemical Journal. 284, 1-13 (1992).</li><li>Zhang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+basis+and+metabolic+interplay+of+redox+regulation).">Biochemical basis and metabolic interplay of redox regulation).</a> Redox Biology. 26, 101284 (2019).</li><li>Pizzo, P., Drago, I., Filadi, R., Pozzan, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+Ca2++homeostasis:+Mechanism,+role,+and+tissue+specificities.">Mitochondrial Ca2+ homeostasis: Mechanism, role, and tissue specificities.</a> Pflugers Archiv: European Journal of Physiology. 464 (1), 3-17 (2012).</li><li>Shadel, G. S., Horvath, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+ROS+signaling+in+organismal+homeostasis.">Mitochondrial ROS signaling in organismal homeostasis.</a> Cell. 163 (3), 560-569 (2015).</li><li>Mart&#237;nez-Reyes, I., Chandel, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+TCA+cycle+metabolites+control+physiology+and+disease.">Mitochondrial TCA cycle metabolites control physiology and disease.</a> Nature Communications. 11 (1), 102 (2020).</li><li>Galluzzi, L., Kepp, O., Trojel-Hansen, C., Kroemer, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+control+of+cellular+life,+stress,+and+death.">Mitochondrial control of cellular life, stress, and death.</a> Circulation Research. 111 (9), 1198-1207 (2012).</li><li>Rone, M. B., Fan, J., Papadopoulos, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cholesterol+transport+in+steroid+biosynthesis:+role+of+protein-protein+interactions+and+implications+in+disease+states.">Cholesterol transport in steroid biosynthesis: role of protein-protein interactions and implications in disease states.</a> Biochimica Et Biophysica Acta. 1791 (7), 646-658 (2009).</li><li>Swenson, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+synthesis+to+utilization:+The+ins+and+outs+of+mitochondrial+heme.">From synthesis to utilization: The ins and outs of mitochondrial heme.</a> Cells. 9 (3), 579 (2020).</li><li>West, A. P., Shadel, G. S., Ghosh, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondria+in+innate+immune+responses.">Mitochondria in innate immune responses.</a> Nature Reviews. Immunology. 11 (6), 389-402 (2011).</li><li>Nunnari, J., Suomalainen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondria:+In+sickness+and+in+health.">Mitochondria: In sickness and in health.</a> Cell. 148 (6), 1145-1159 (2012).</li><li>Pohjoism&#228;ki, J. L. O., Goffart, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Of+circles,+forks+and+humanity:+Topological+organisation+and+replication+of+mammalian+mitochondrial+DNA.">Of circles, forks and humanity: Topological organisation and replication of mammalian mitochondrial DNA.</a> BioEssays. 33 (4), 290-299 (2011).</li><li>Gustafsson, C. M., Falkenberg, M., Larsson, N. -. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+and+expression+of+mammalian+mitochondrial+DNA.">Maintenance and expression of mammalian mitochondrial DNA.</a> Annual Review of Biochemistry. 85, 133-160 (2016).</li><li>Nicholls, T. J., Gustafsson, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separating+and+segregating+the+human+mitochondrial+genome.">Separating and segregating the human mitochondrial genome.</a> Trends in Biochemical Sciences. 43 (11), 869-881 (2018).</li><li>Gratzner, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibody+to+5-bromo-+and+5-iododeoxyuridine:+A+new+reagent+for+detection+of+DNA+replication.">Monoclonal antibody to 5-bromo- and 5-iododeoxyuridine: A new reagent for detection of DNA replication.</a> Science. 218 (4571), 474-475 (1982).</li><li>Stirling, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CellProfiler+4:+Improvements+in+speed,+utility+and+usability.">CellProfiler 4: Improvements in speed, utility and usability.</a> BMC Bioinformatics. 22 (1), 433 (2021).</li><li>R Core Team. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=R:+A+Language+and+Environment+for+Statistical+Computing.">R: A Language and Environment for Statistical Computing.</a> R Foundation for Statistical Computing. , (2021).</li><li>. dplyr: A Grammar of Data Manipulation Available from: <a target="_blank" href="https://CRAN.R-project.org/package=dplyr">https://CRAN.R-project.org/package=dplyr</a> (2021)</li><li>. data.table: Extension of `data.frame Available from: <a target="_blank" href="https://CRAN.R-project.org/package=data.table">https://CRAN.R-project.org/package=data.table</a> (2020)</li><li>. ggplot2: Elegant graphics for data analysis Available from: <a target="_blank" href="https://ggplot2.tidyverse.org">https://ggplot2.tidyverse.org</a> (2016)</li><li>. ggpubr: &amp;#34;ggplot2&amp;#34; based publication ready plots Available from: <a target="_blank" href="https://CRAN.R-project.org/package=ggpubr">https://CRAN.R-project.org/package=ggpubr</a> (2020)</li><li>Hashiguchi, K., Zhang-Akiyama, Q. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+human+cell+lines+lacking+mitochondrial+DNA.">Establishment of human cell lines lacking mitochondrial DNA.</a> Methods in Molecular Biology. 554, 383-391 (2009).</li><li>Piechota, J., Szczesny, R., Wolanin, K., Chlebowski, A., Bartnik, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+and+mitochondrial+genome+responses+in+HeLa+cells+treated+with+inhibitors+of+mitochondrial+DNA+expression.">Nuclear and mitochondrial genome responses in HeLa cells treated with inhibitors of mitochondrial DNA expression.</a> Acta Biochimica Polonica. 53 (3), 485-495 (2006).</li><li>Spelbrink, J. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+mitochondrial+DNA+deletions+associated+with+mutations+in+the+gene+encoding+Twinkle,+a+phage+T7+gene+4-like+protein+localized+in+mitochondria.">Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 gene 4-like protein localized in mitochondria.</a> Nature Genetics. 28 (3), 223-231 (2001).</li><li>Campbell, C. T., Kolesar, J. E., Kaufman, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+transcription+factor+A+regulates+mitochondrial+transcription+initiation,+DNA+packaging,+and+genome+copy+number.">Mitochondrial transcription factor A regulates mitochondrial transcription initiation, DNA packaging, and genome copy number.</a> Biochimica et Biophysica Acta. 1819 (9-10), 921-929 (2012).</li><li>Krasich, R., Copeland, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+polymerases+in+the+mitochondria:+A+critical+review+of+the+evidence.">DNA polymerases in the mitochondria: A critical review of the evidence.</a> Frontiers in Bioscience. 22 (4), 692-709 (2017).</li><li>Kotrys, A. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+proteomics+revealed+C6orf203/MTRES1+as+a+factor+preventing+stress-induced+transcription+deficiency+in+human+mitochondria.">Quantitative proteomics revealed C6orf203/MTRES1 as a factor preventing stress-induced transcription deficiency in human mitochondria.</a> Nucleic Acids Research. 47 (14), 7502-7517 (2019).</li><li>Gratzner, H. G., Pollack, A., Ingram, D. J., Leif, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deoxyribonucleic+acid+replication+in+single+cells+and+chromosomes+by+immunologic+techniques.">Deoxyribonucleic acid replication in single cells and chromosomes by immunologic techniques.</a> Journal of Histochemistry &amp; Cytochemistry. 24 (1), 34-39 (1976).</li><li>Leif, R. C., Stein, J. H., Zucker, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+short+history+of+the+initial+application+of+anti-5-BrdU+to+the+detection+and+measurement+of+S+phase.">A short history of the initial application of anti-5-BrdU to the detection and measurement of S phase.</a> Cytometry. Part A: The Journal of the International Society for Analytical Cytology. 58 (1), 45-52 (2004).</li><li>Lentz, S. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+(mtDNA)+biogenesis:+visualization+and+duel+incorporation+of+BrdU+and+EdU+into+newly+synthesized+mtDNA+in+vitro.">Mitochondrial DNA (mtDNA) biogenesis: visualization and duel incorporation of BrdU and EdU into newly synthesized mtDNA in vitro.</a> The Journal of Histochemistry and Cytochemistry. 58 (2), 207-218 (2010).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multi-omic+measurements+of+heterogeneity+in+HeLa+cells+across+laboratories.">Multi-omic measurements of heterogeneity in HeLa cells across laboratories.</a> Nature Biotechnology. 37 (3), 314-322 (2019).</li></ol>

저자는 공개 할 것이 없습니다.

역사적으로, BrdU 혼입 및 항체 검출에 의한 DNA 표지는 핵 DNA 복제 및 세포주기 연구에 사용되어왔다 14,27,28. 지금까지 BrdU 표지 DNA를 검출하기 위한 모든 프로토콜에는 에피토프 노출을 가능하게 하고 항체 침투를 촉진하기 위한 DNA 변성 단계(산성 또는 열) 또는 효소 분해(DNase 또는 proteinase)가 포함되었습니다. 이 프로토콜은 단...

대부분의 진핵 세포에서 미토콘드리아는 수많은 세포 과정에서 중요한 역할을 하기 때문에 필수 세포 기관입니다. 무엇보다도, 미토콘드리아는 세포의 핵심 에너지 공급원이다1. 미토콘드리아는 또한 세포 항상성(예: 세포 내 산화환원2 및 칼슘 균형3), 세포 신호 전달4,5, 세포자멸사6, 다른 생화학적 화합물의 합성 7,8 및 선천성 면역 반응9 조절에 관여합니다. 미토콘드리아 기능 장애는 다양한 병리학 적 상태 및 인간 질병과 관련이 있습니다10.
미토콘드리아의 기능은 핵 게놈과 미토콘드리아 게놈이라는 두 개의 개별 게놈에 위치한 유전 정보에 달려 있습니다. 미토콘드리아 게놈은 핵 게놈에 비해 적은 수의 유전자를 암호화하지만 모든 mtDNA 암호화 유전자는 인간의 생명에 필수적입니다. mtDNA를 유지하는 데 필요한 미토콘드리아 단백질 기계는 nDNA에 의해 암호화됩니다. 미토콘드리아 반응체의 기본 구성 요소와 일부 미토콘드리아 생물 발생 인자는 이미 확인되었습니다(이전 연구11,12에서 검토됨). 그러나 미토콘드리아 DNA 복제 및 유지 메커니즘은 아직 이해되지 않았습니다. nDNA와 달리, 미토콘드리아 게놈은 다중 사본으로 존재하며, 이는 미토콘드리아 유전자 발현을 조절하기 위한 추가 층을 제공합니다. 세포 기관 내에서 mtDNA의 분포와 분리, 이러한 과정이 어느 정도 조절되는지, 그리고 그렇다면 어떤 단백질이 관련되어 있는지에 대해서는 현재 알려진 바가 훨씬 적습니다13. 분리 패턴은 세포가 야생형 및 돌연변이 mtDNA의 혼합 집단을 포함할 때 중요합니다. 이들의 불균등한 분포는 유해한 양의 돌연변이된 mtDNA를 가진 세포의 생성으로 이어질 수 있습니다.
지금까지 mtDNA 유지에 필요한 단백질 인자는 주로 생화학적 방법, 생물정보학적 분석 또는 질병 관련 연구를 통해 확인되었습니다. 이 작업에서는 이전에 식별을 벗어난 요인을 식별할 수 있는 높은 기회를 보장하기 위해 다른 전략이 설명됩니다. 이 방법은 티미딘의 뉴클레오시드 유사체인 5-브로모-2'-데옥시유리딘(BrdU)으로 복제 또는 복구하는 동안 mtDNA를 표지하는 것을 기반으로 합니다. BrdU는 DNA 합성 중에 초기 DNA 가닥에 쉽게 통합되며, 일반적으로 핵 DNA14의 복제를 모니터링하는 데 사용됩니다. 그러나 여기에서 개발된 절차는 항-BrdU 항체의 면역형광을 사용하여 mtDNA에 혼입된 BrdU를 검출하는 데 최적화되었습니다.
이 접근법은 시험관 내에서 배양된 인간 세포에서 mtDNA 합성 및 분포의 고처리량 정량화를 가능하게 합니다. 비교적 짧은 시간에 다양한 실험 조건에서 테스트를 수행하려면 고처리량 전략이 필요합니다. 따라서, 세포 배양을 위한 멀티웰 포맷 및 이미징을 위한 자동화된 형광 현미경을 활용하는 것이 프로토콜에서 제안된다. 이 프로토콜에는 siRNA 라이브러리를 사용한 인간 HeLa 세포의 형질감염과 BrdU로 새로 합성된 DNA의 대사 표지를 사용한 mtDNA 복제 또는 복구의 후속 모니터링이 포함됩니다. 이 접근법은 항 DNA 항체의 도움으로 DNA의 면역 염색과 결합됩니다. 두 매개변수 모두 정량적 형광 현미경을 사용하여 분석됩니다. 또한 미토콘드리아는 특정 염료로 시각화됩니다. 프로토콜의 특이성을 입증하기 위해 BrdU 염색을 mtDNA가 없는 세포(rho0 세포), 잘 알려진 mtDNA 유지 인자의 침묵 시 HeLa 세포 및 mtDNA 복제 억제제로 처리한 후 HeLa 세포에서 테스트했습니다. mtDNA 수준은 또한 독립적인 방법, 즉 qPCR에 의해 측정되었다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2&#8242;,3&#8242;-Dideoxycytidine (ddC)</td>
			<td>Sigma-Aldrich</td>
			<td>D5782</td>
			<td></td>
		</tr>
		<tr>
			<td>384&#160; Well Cell Culture Microplates, black</td>
			<td>Greiner Bio-One</td>
			<td>#781946</td>
			<td></td>
		</tr>
		<tr>
			<td>5-Bromo-2&#8242;-deoxyuridine (BrdU)</td>
			<td>Sigma-Aldrich</td>
			<td>B5002-1G</td>
			<td>Dissolve BrdU powder in water to 20 mM stock solution and aliquot. Use 20 &#181;M BrdU solution for labeling.</td>
		</tr>
		<tr>
			<td>Adhesive sealing film</td>
			<td>Nerbe Plus</td>
			<td>04-095-0060</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa Fluor 488 goat anti-mouse IgG1 secondary antibody</td>
			<td>Thermo Fisher Scientific</td>
			<td>A-21121</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa Fluor 555 goat anti-mouse IgM secondary antibody</td>
			<td>Thermo Fisher Scientific</td>
			<td>A-21426</td>
			<td></td>
		</tr>
		<tr>
			<td>BioTek 405 LS microplate washer</td>
			<td>Agilent</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin (BSA)</td>
			<td>Sigma-Aldrich</td>
			<td>A4503</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell counting chamber Thoma</td>
			<td>Heinz Herenz</td>
			<td>REF:1080339</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Cytiva</td>
			<td>SH30243.01</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Thermo Fisher Scientific</td>
			<td>41965-062</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Thermo Fisher Scientific</td>
			<td>10270-106</td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde solution</td>
			<td>Sigma-Aldrich</td>
			<td>F1635</td>
			<td>Formaldehyde is toxic; please read the safety data sheet carefully.</td>
		</tr>
		<tr>
			<td>Hoechst 33342</td>
			<td>Thermo Fisher Scientific</td>
			<td>H3570</td>
			<td></td>
		</tr>
		<tr>
			<td>IgG1 mouse monoclonal anti-BrdU (IIB5) primary antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-32323</td>
			<td></td>
		</tr>
		<tr>
			<td>IgM mouse monoclonal anti-DNA (AC-30-10) primary antibody</td>
			<td>Progen</td>
			<td>#61014</td>
			<td></td>
		</tr>
		<tr>
			<td>LightCycler 480 System</td>
			<td>Roche</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine RNAiMAX Transfection Reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>#13778150</td>
			<td></td>
		</tr>
		<tr>
			<td>MitoTracker Deep Red FM</td>
			<td>Thermo Fisher Scientific</td>
			<td>M22426</td>
			<td>Mitochondria tracking dye&#160;</td>
		</tr>
		<tr>
			<td>Multidrop Combi Reagent Dispenser</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Opti-MEM</td>
			<td>Thermo Fisher Scientific</td>
			<td>51985-042</td>
			<td></td>
		</tr>
		<tr>
			<td>Orca-R2 (C10600) CCD Camera</td>
			<td>Hamamatsu</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>P0781-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate buffered saline (PBS)</td>
			<td>Sigma-Aldrich</td>
			<td>P4417-100TAB</td>
			<td></td>
		</tr>
		<tr>
			<td>PowerUp SYBR Green Master Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25742</td>
			<td></td>
		</tr>
		<tr>
			<td>qPCR primer Fw B2M (reference)</td>
			<td></td>
			<td></td>
			<td>CAGGTACTCCAAAGATTCAGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Fw GPI (reference gene)</td>
			<td></td>
			<td></td>
			<td>GACCTTTACTACCCAGGAGA</td>
		</tr>
		<tr>
			<td>qPCR primer Fw MT-ND1&#160;</td>
			<td></td>
			<td></td>
			<td>TAGCAGAGACCAACCGAACC&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Fw POLG</td>
			<td></td>
			<td></td>
			<td>TGGAAGGCAGGCATGGTCAAACC</td>
		</tr>
		<tr>
			<td>qPCR primer Fw TFAM</td>
			<td></td>
			<td></td>
			<td>GATGAGTTCTGCCTGCTTTAT</td>
		</tr>
		<tr>
			<td>qPCR primer Fw TWNK</td>
			<td></td>
			<td></td>
			<td>GCCATGTGACACTGGTCATT</td>
		</tr>
		<tr>
			<td>qPCR primer Rev B2M (reference)</td>
			<td></td>
			<td></td>
			<td>GTCAACTTCAATGTCGGATGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Rev GPI (reference gene)</td>
			<td></td>
			<td></td>
			<td>AGTAGACAGGGCAACAAAGT</td>
		</tr>
		<tr>
			<td>qPCR primer Rev MT-ND1&#160;</td>
			<td></td>
			<td></td>
			<td>ATGAAGAATAGGGCGAAGGG&#160;</td>
		</tr>
		<tr>
			<td>qPCR primer Rev POLG</td>
			<td></td>
			<td></td>
			<td>GGAGTCAGAACACCTGGCTTTGG</td>
		</tr>
		<tr>
			<td>qPCR primer Rev TFAM</td>
			<td></td>
			<td></td>
			<td>GGACTTCTGCCAGCATAATA</td>
		</tr>
		<tr>
			<td>qPCR primer Rev TWNK</td>
			<td></td>
			<td></td>
			<td>AACATTGTCTGCTTCCTGGC</td>
		</tr>
		<tr>
			<td>ScanR microscope</td>
			<td>Olympus</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA Ctrl</td>
			<td>Dharmacon</td>
			<td>D-001810-10-5</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA POLG</td>
			<td>Invitrogen</td>
			<td>POLGHSS108223</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA TFAM</td>
			<td>Invitrogen</td>
			<td>TFAMHSS144252</td>
			<td></td>
		</tr>
		<tr>
			<td>siRNA TWNK</td>
			<td>Invitrogen</td>
			<td>C10orf2HSS125597</td>
			<td></td>
		</tr>
		<tr>
			<td>Suction device</td>
			<td>NeoLab</td>
			<td>2-9335</td>
			<td>Suction device for cell culture</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>T9284-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin</td>
			<td>Biowest</td>
			<td>L0931-500</td>
			<td></td>
		</tr>
		<tr>
			<td>UPlanSApo 20x 0.75 NA objective</td>
			<td>Olympus</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

high-throughput image-based quantification of mitochondrial dna synthesis and distribution

대부분의 세포 과정에는 지속적인 에너지 공급이 필요하며, 가장 일반적인 운반체는 ATP 분자입니다. 진핵 세포는 산화적 인산화에 의해 미토콘드리아에서 대부분의 ATP를 생산합니다. 미토콘드리아는 복제되어 차세대 세포로 전달되는 자체 게놈을 가지고 있기 때문에 독특한 세포 소기관입니다. 핵 게놈과 달리 세포에는 미토콘드리아 게놈의 여러 사본이 있습니다. 미토콘드리아 게놈의 복제, 복구 및 유지를 담당하는 메커니즘에 대한 자세한 연구는 정상 및 질병 조건 모두에서 미토콘드리아와 전체 세포의 적절한 기능을 이해하는 데 필수적입니다. 여기서, 시험관 내에서 배양된 인간 세포에서 미토콘드리아 DNA(mtDNA)의 합성 및 분포를 고처리량 정량화할 수 있는 방법이 제시된다. 이 접근법은 5-브로모-2'-데옥시유리딘(BrdU) 혼입으로 표지된 능동적으로 합성된 DNA 분자의 면역형광 검출과 항-DNA 항체가 있는 모든 mtDNA 분자의 동시 검출을 기반으로 합니다. 또한 미토콘드리아는 특정 염료 또는 항체로 시각화됩니다. 다중 웰 형식의 세포 배양과 자동 형광 현미경의 활용을 통해 비교적 짧은 시간에 다양한 실험 조건에서 mtDNA의 역학과 미토콘드리아의 형태를 더 쉽게 연구할 수 있습니다.

For most eukaryotic cells mitochondria are essential organelles, as they play a crucial role in numerous cellular processes. First and foremost, mitochondria are the key energy suppliers of cells1. Mitochondria are also involved in regulating cellular homeostasis (for instance, intracellular redox2 and the calcium balance3), cell signaling4,5, apoptosis6, the synthesis of different biochemical compounds7,8, and the innate immune response9. Mitochondrial dysfunction is associated with various pathological states and human diseases10. 
The functioning of mitochondria depends on the genetic information located in two separate genomes: the nuclear and mitochondrial genomes. The mitochondrial genome encodes a small number of genes compared to the nuclear genome, but all the mtDNA-encoded genes are essential for human life. The mitochondrial protein machinery necessary to maintain the mtDNA is encoded by nDNA. The basic components of the mitochondrial replisome, as well as some mitochondrial biogenesis factors, have already been identified (reviewed in previous research11,12). However, mitochondrial DNA replication and maintenance mechanisms are still far from being understood. In contrast to nDNA, the mitochondrial genome exists in multiple copies, which provides an additional layer for regulating mitochondrial gene expression. Much less is currently known about the distribution and segregation of mtDNA within organelles, to what extent these processes are regulated, and if they are, which proteins are involved13. The segregation pattern is crucial when cells contain a mixed population of wild-type and mutated mtDNA. Their unequal distribution may lead to the generation of cells with a detrimental amount of mutated mtDNA.
So far, the protein factors necessary for mtDNA maintenance have been identified mainly by biochemical methods, bioinformatic analyses, or through disease-associated studies. In this work, in order to ensure a high chance of identifying factors that have previously escaped identification, a different strategy is described. The method is based on the labeling of mtDNA during replication or repair with 5-bromo-2'-deoxyuridine (BrdU), a nucleoside analog of thymidine. BrdU is readily incorporated into nascent DNA strands during DNA synthesis and, in general, is used for monitoring the replication of nuclear DNA14. However, the procedure developed here has been optimized for detecting BrdU incorporated into mtDNA using the immunofluorescence of anti-BrdU antibodies.
The approach allows for the high-throughput quantification of mtDNA synthesis and distribution in human cells cultured in vitro. A high-throughput strategy is necessary to conduct tests under different experimental conditions in a relatively short time; therefore, it is proposed in the protocol to utilize a multi-well format for cell culturing and automated fluorescence microscopy for imaging. The protocol includes the transfection of human HeLa cells with an siRNA library and the subsequent monitoring of mtDNA replication or repair using the metabolic labeling of newly synthesized DNA with BrdU. This approach is combined with immunostaining of the DNA with the help of anti-DNA antibodies. Both parameters are analyzed using quantitative fluorescence microscopy. Additionally, mitochondria are visualized with a specific dye. To demonstrate the specificity of the protocol, BrdU staining was tested on cells devoid of mtDNA (rho0 cells), on HeLa cells upon the silencing of well-known mtDNA maintenance factors, and on HeLa cells after treatment with an mtDNA replication inhibitor. The mtDNA levels were also measured by an independent method, namely qPCR.

저자 스포트라이트: 미토콘드리아 DNA 합성 및 분포의 고처리량 이미지 기반 정량화  

미토콘드리아 DNA 합성 및 분포의 고처리량 이미지 기반 정량화

The protocol aims to identify proteins with dysfunction leads to changes in the number of mitochondrial DNA molecules. This research may also reveal the factors involving the distribution of mitochondrial DNA within the mitochondria. Mitochondrial replication and maintenance mechanisms are still not fully understood.Much less is known about regulating the distribution of mitochondrial genomes within organoids and the proteins involved in it. As a result, identifying and characterizing some new players will be of great importance. The main advantage of the technique is its high-throughput and high content protocol.We can simultaneously test many experimental conditions and measure various parameters during a single experiment. In genome-wide studies, the proposed protocol provides an opportunity to outline a global picture of how nuclear encoded genetic information regulates its mitochondrial counterpart. Additionally, it has the potential to identify proteins whose dysfunction causes mitochondrial DNA stress and activates the interferon response pathway.

mtDNA 합성 및 분포의 역학에 대한 고처리량 연구를 위한 절차 계획이 그림 1에 나와 있습니다. 멀티웰 플레이트 형식을 사용하면 siRNA 라이브러리를 사용하여 서로 다른 유전자의 침묵과 같은 다양한 실험 조건을 동시에 분석할 수 있습니다. BrdU로 새로 합성된 DNA 분자의 표지에 사용되는 조건은 HeLa 세포의 미토콘드리아에서 BrdU 표지 DNA의 검출을 허용하지만(?...

Watch this Scientific Journal Video about High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution at JoVE.com

mtDNA 합성 및 분포를 검출하고 정량화하기 위해 다중 웰 플레이트 형식 및 자동화된 면역형광 이미징을 사용하여 세포에서 미토콘드리아 DNA(mtDNA) 대사의 역학을 연구하는 절차가 설명되어 있습니다. 이것은 mtDNA 대사에 대한 다양한 억제제, 세포 스트레스 및 유전자 침묵의 효과를 조사하는 데 추가로 사용될 수 있습니다.

The vast majority of cellular processes require a continuous supply of energy, the most common carrier of which is the ATP molecule. Eukaryotic cells ...

이 프로토콜은 기능 장애가 있는 단백질을 식별하여 미토콘드리아 DNA 분자 수의 변화를 유도하는 것을 목표로 합니다. 이 연구는 또한 미토콘드리아 내에서 미토콘드리아 DNA의 분포와 관련된 요인을 밝힐 수 있습니다. 미토콘드리아 복제 및 유지 메커니즘은 아직 완전히 이해되지 않았습니다.오가노이드 내에서 미토콘드리아 게놈과 이에 관련된 단백질의 분포를 조절하는 것에 대해서는 알려진 바가 거의 없습니다. 결과적으로 일부 새로운 플레이어를 식별하고 특성화하는 것이 매우 중요합니다. 이 기술의 주요 장점은 높은 처리량과 높은 콘텐츠 프로토콜입니다.단일 실험 중에 많은 실험 조건을 동시에 테스트하고 다양한 매개 변수를 측정 할 수 있습니다. 게놈 전체 연구에서 제안된 프로토콜은 핵으로 암호화된 유전 정보가 미토콘드리아 대응물을 조절하는 방법에 대한 글로벌 그림을 개략적으로 설명할 수 있는 기회를 제공합니다. 또한 기능 장애가 미토콘드리아 DNA 스트레스를 유발하고 인터페론 반응 경로를 활성화하는 단백질을 식별할 가능성이 있습니다.

high-throughput-image-based-quantification-mitochondrial-dna

Research

JoVE Journal

Biochemistry

High-Throughput Image-Based Quantification of Mitochondrial DNA Synthesis and Distribution

1.5K 조회수.  University of Warsaw. 이 프로토콜은 기능 장애가 있는 단백질을 식별하여 미토콘드리아 DNA 분자 수의 변화를 유도하는 것을 목표로 합니다. 이 연구는 또한 미토콘드리아 내에서 미토콘드리아 DNA의 분포와 관련된 요인을 밝힐 수 있습니다. 미토콘드리아 복제 및 유지 메커니즘은 아직 완전히 이해되지 않았습니다.오가노이드 내에서 미토콘드리아 게놈과 이에 관련된 단백질의 분포를 조절?...