All animal usage procedures were in accordance with ethical guidelines laid down by the local governing body (Regierungspr&#228;sidium Karlsruhe, Karlsruhe, Germany).
1. Preparation of siRNA/PEI Complex
 
The siRNA/PEI complex solution is prepared using manufacturer&#39;s directions as follows:
<ol>
	<li>Solution A: Dilute the desired amount of siRNA with sterile water (if necessary) up to a quarter of the end volume and dilute this further with 10% glucose solution up to half of end volume. Vortex gently or mix by pipetting up and down. The optimal amount of siRNA needs to be determined empirically but 1 &#181;g siRNA in 10 &#181;l complex solution per animal is a good starting point for optimization.</li>
	<li>Solution B: Dilute the needed volume of PEI reagent with sterile water up to a quarter of the end volume and dilute this further with 10% glucose solution up to half of the end volume. Vortex gently or mix by pipetting up and down. 
	Note: the amount of PEI reagent determines the ionic balance in the complex which influences the efficiency of the transfection. Likewise the optimal amount of PEI solution has to be determined empirically. In our hands, the optimal amount is 0.12 &#956;l of PEI solution per 1 &#956;g siRNA.</li>
	<li>Mix solution A with solution B all at once, vortex gently.</li>
	<li>Incubate the mixed solution for 15 min at RT before use. This complex is stable for 2 hr at RT and for 24 hr at 4 &#176;C.</li>
</ol>
2. Intrathecal Injection
<ol>
	<li>Anesthetize the mouse with 3% isoflurane, until it shows no signs of righting reflex.&#160;In addition, check for tail and/or paw pinch reflex to further ensure the state of anesthesia. &#160;</li>
	<li>Shave around 2 cm2 of fur at the posterior end of the animal near the base of the tail to facilitate a better visualization during needle insertion.</li>
	<li>Place mouse in a nose cone for a continued isoflurane administration during the procedure, reduce the isoflurane to 1.5%, and cover the eyes of the mouse with eye lubricant.</li>
	<li>Prepare the ready to use siRNA mixed solution using a 25 &#181;l Hamilton syringe attached to a 30 G 0.5 in needle.</li>
	<li>Locate the spinous process of the L6, which should be the most prominent one and fix the vertebrate column around this area by pressing it gently.</li>
	<li>Carefully insert the needle between the groove of L5 and L6 vertebrae and observe for a tail flick as this sign indicates a successful entry of the needle in the intradural space. 
	Tip: Using fingernail, one should be able to locate the groove as well.</li>
	<li>Once tail flick is observed, immediately, but carefully, secure the needle position with one hand and inject the desired volume of substance with the other hand slowly. 
	Tip: a volume between 5-10 &#181;l is optimal as volume less than 5 &#181;l is unreliable and a volume bigger than 10 &#181;l leads to too much pressure.</li>
	<li>Once injection is performed, move the mouse back to the cage to recover from anesthesia.</li>
	<li>Repeat this injection at least 2 more times every 24 hr to achieve optimal downregulation of the targeted gene.</li>
</ol>

<ol>
	<li>Hylden, J. L., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrathecal+morphine+in+mice:+a+new+technique.">Intrathecal morphine in mice: a new technique.</a> Eur. J. Pharmacol. 67, 313-316 (1980).</li><li>Stokes, J. A., Corr, M., Yaksh, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+tactile+allodynia+following+intrathecal+puncture+in+mouse:+contributions+of+Toll-like+receptor+signaling.">Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling.</a> Neurosci. Lett. 504, 215-218 (2011).</li><li>Goula, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+intravenous+delivery+of+transgenes+to+mouse+lung.">Polyethylenimine-based intravenous delivery of transgenes to mouse lung.</a> Gene Ther. , 1291-1295 (1998).</li><li>Fairbanks, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+delivery+of+analgesics+in+experimental+models+of+pain+and+analgesia.">Spinal delivery of analgesics in experimental models of pain and analgesia.</a> Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).</li><li>Hohmann, A. G., Tsou, K., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cannabinoid+modulation+of+wide+dynamic+range+neurons+in+the+lumbar+dorsal+horn+of+the+rat+by+spinally+administered+WIN55,212-2.">Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2.</a> Neurosci. Lett. 257, 119-122 (1998).</li><li>Song, Z. H., Takemori, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+spinal+kappa+opioid+receptors+in+the+antinociception+produced+by+intrathecally+administered+corticotropin-releasing+factor+in+mice.">Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice.</a> J. Pharmacol. Exp. Ther. 254, 363-368 (1990).</li><li>Trang, T., Sutak, M., Jhamandas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+cannabinoid+(CB1)-receptors+in+the+development+and+maintenance+of+opioid+tolerance.">Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance.</a> Neuroscience. , 1275-1288 (2007).</li><li>Yaksh, T. L., Rudy, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chronic+catheterization+of+the+spinal+subarachnoid+space.">Chronic catheterization of the spinal subarachnoid space.</a> Physiol. Behav. 17, 1031-1036 (1976).</li><li>Tappe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+scaffolding+protein+Homer1a+protects+against+chronic+inflammatory+pain.">Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain.</a> Nat. Med. , 677-681 (2006).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+Cav3.2+T-type+calcium+channel+gene+in+sensory+neurons+demonstrates+its+major+role+in+nociception.">Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.</a> EMBO J. 24, 315-324 (2005).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+to+dorsal+root+ganglia+by+intrathecal+injection:+effects+on+regeneration+of+peripheral+nerves.">Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves.</a> Mol. Ther. 12, 314-320 (2005).</li><li>Wigdor, S., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+and+systemic+morphine-induced+antinociception+in+mice:+contribution+of+descending+serotonergic+and+noradrenergic+pathways.">Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways.</a> J. Pharmacol. Exp. Ther. 242, 90-95 (1987).</li></ol>

The authors declare no competing financial interests.

Thus, the above-described technique of intrathecal needle injections is efficacious, fast, specifically-localized, and nondestructive. Technically, the most critical aspect of this procedure is the point of needle insertion into the groove. It is crucial that this procedure is done with very calm hands and patience. Like many surgical procedures, training improves the rate of successful injection. This is also important because during an actual experiment, this technique does not provide an obvious indicator to directly ...

The spinal cord is a very important center in a variety of key biological processes and physiological functions, including processing and transmission of painful (nociceptive) inputs4-7. Various experimental techniques have been developed to facilitate pharmacological modulation of the spinal cord, such as chronic implantation of intrathecal catheters8, spinal cord microinjection, and intrathecal needle injection9. Each technique has its own advantages and drawbacks, and depending on the experiment paradigm one technique might be more suitable than the others. Whereas chronic implantation of intrathecal catheters is readily feasible in rat, this method is very difficult in the mouse, given size restrictions. Success rate is very low and motor deficits often occur due to the bulky presence of a catheter in the severely confined subdural space in the mouse. Moreover, long term delivery of drugs is rendered due to frequent clotting of chronically implanted catheters. Finally, immune reactions are common.
These problems can be circumvented using the method of acute intrathecal injection via a needle in the absence of a preimplanted catheter, which enables a fast and anatomically limited application of drugs and reagents to the spinal cords in mice. This method fully retains the benefits of intrathecal delivery over other systemic delivery routes (e.g. oral, intravenous, intraperitoneal, etc.) such as specificity of spinal modulation, which permits reduced dosages and limit side effects, as well as ability to deliver substances do not&#160;normally do not cross the blood brain barrier since during intrathecal injection, the needle is inserted between the dura mater and the spinal cord. Importantly however, in comparison to other methods of intrathecal delivery, the intrathecal needle injection method is the least invasive, allowing numerous applications in the same animal without causing any considerable tissue damage or evoking immune reaction due to implantation of foreign material. However, it requires technical skills for a very precise targeting of the needle to permit efficacy.
Here, we visually demonstrate the method for achieving an optimal rate of success for specifically targeting the lumbar spinal cord. The site of injection that is chosen in this experiment is the groove between L5 and L6 vertebrate column, near to where the spinal cord ends, to minimize the possibility of damaging the spine. Moreover, we demonstrate the use of this technique to knock down genes in the spinal cord using siRNAs.

<table><tbody><tr><td>&lt;em&gt;In Vivo&lt;/em&gt;-jetPEI</td><td>Polyplus</td><td>201-10G</td><td>&amp;nbsp;</td></tr><tr><td>WAVE1 siRNA</td><td>Santa Cruz</td><td>sc-36832</td><td>&amp;nbsp;</td></tr><tr><td>Control siRNA-A</td><td>Santa Cruz</td><td>sc-37007</td><td>&amp;nbsp;</td></tr><tr><td>Anti-&amp;szlig;-Tubulin III antibody</td><td>Sigma</td><td>T2200</td><td>&amp;nbsp;</td></tr><tr><td>Anti-WAVE1 antibody</td><td>R&amp;amp;D Systems</td><td>AF5514</td><td>&amp;nbsp;</td></tr><tr><td>Fast green dye</td><td>Sigma</td><td>F-7252</td><td>&amp;nbsp;</td></tr><tr><td>Isoflurane</td><td>Baxter</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Isoflurane setup</td><td>Dr&amp;auml;ger L&amp;uuml;beck</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Shaver</td><td>Wella</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Hamilton syringe Gastight 1702</td><td>Hamilton</td><td></td><td>&amp;nbsp;</td></tr><tr><td>30 G 1/2 in 13 mm Needle</td><td>BD Microlance</td><td>304000</td><td>&amp;nbsp;</td></tr><tr><td>Microscope Leica MS5</td><td>Leica</td><td></td><td>&amp;nbsp;</td></tr><tr><td>WAVE1 forward primer for qRT-PCR</td><td>Sigma</td><td></td><td>cacagagcctcaggacagg</td></tr><tr><td>WAVE1 reversed primer for qRT-PCR</td><td>Sigma</td><td></td><td>cttttcaccaacggcatctt</td></tr><tr><td>FastStart Essential DNA Green Master</td><td>Roche</td><td>6402712001</td><td>&amp;nbsp;</td></tr></tbody></table>

in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter implantation. The technical limitation of this surgical technique lies in the finesse of the hands. The injection is rapid, especially for a trained experimenter, and since tissue disruption with this technique is minimal, repeated injections are possible; moreover immune reaction to foreign tools (e.g. catheter) does not occur, thereby giving a better and more specific read out of spinal cord modulation. Since the application of the substance is largely limited to the target region of the spinal cord, drugs do not need to be applied in large dosages, and more importantly unwanted effects on other tissue, as observed with a systemic delivery, could be circumvented1,2. Moreover, we combine this technique with in vivo transfection of nucleic acid with the help of polyethylenimine (PEI) reagent3, which provides tremendous versatility for studying spinal functions via delivery of pharmacological agents as well as gene, RNA, and protein modulators.

In order to illustrate a successful injection, we performed this technique using Fast Green FCF dye in adult C57Bl6 mice (8-10 weeks of age). The animal was allowed to recover for a few minutes after the injection to provide enough time for the dye to spread and then killed with an overdose of CO2. Subsequently, the vertebrate column was dissected and the spinal cord was exposed. The blue puncta corresponding to the diffused dye, marked the injection site. No sign of injury to the spinal cord could be seen, co...

Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

This report describes a simple and rapid technique of intrathecal needle puncture for a localized transfection of siRNA in the lumbar spinal cord in mouse under short lasting light anesthesia.

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter ...

in-vivo-sirna-transfection-gene-knockdown-spinal-cord-via-rapid

Research

JoVE Journal

Biology

46.4K Views.  University of Heidelberg. This report describes a simple and rapid technique of intrathecal needle puncture for a localized transfection of siRNA in the lumbar spinal cord in mouse under short lasting light anesthesia.

Video: In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

In vivo Imaging of the Mouse Spinal Cord Using Two-photon Microscopy

In vivo imaging using two-photon microscopy 1 in mice that have been genetically engineered to express fluorescent proteins in specific cell types 2-3 has significantly broadened our knowledge of physiological and pathological processes in numerous tissues in vivo 4-7. In studies of the central nervous system (CNS), there has been a broad application of in vivo imaging in the brain, which has produced a plethora of novel and often unexpected findings about the behavior of cells such as neurons, astrocytes, microglia, under physiological or pathological conditions 8-17. However, mostly technical complications have limited the implementation of in vivo imaging in studies of the living mouse spinal cord. In particular, the anatomical proximity of the spinal cord to the lungs and heart generates significant movement artifact that makes imaging the living spinal cord a challenging task.
We developed a novel method that overcomes the inherent limitations of spinal cord imaging by stabilizing the spinal column, reducing respiratory-induced movements and thereby facilitating the use of two-photon microscopy to image the mouse spinal cord in vivo. This is achieved by combining a customized spinal stabilization device with a method of deep anesthesia, resulting in a significant reduction of respiratory-induced movements. This video protocol shows how to expose a small area of the living spinal cord that can be maintained under stable physiological conditions over extended periods of time by keeping tissue injury and bleeding to a minimum. Representative raw images acquired in vivo detail in high resolution the close relationship between microglia and the vasculature. A timelapse sequence shows the dynamic behavior of microglial processes in the living mouse spinal cord. Moreover, a continuous scan of the same z-frame demonstrates the outstanding stability that this method can achieve to generate stacks of images and/or timelapse movies that do not require image alignment post-acquisition. Finally, we show how this method can be used to revisit and reimage the same area of the spinal cord at later timepoints, allowing for longitudinal studies of ongoing physiological or pathological processes in vivo.

In vivo Imaging of the Mouse Spinal Cord Using Two-photon Microscopy

A minimally invasive protocol to stabilize the mouse spinal column and perform repetitive in vivo spinal cord imaging using two-photon microscopy is described. This method combines a spinal stabilization device and an anesthetic regimen to minimize respiratory-induced movements and produce raw imaging data that require no alignment or other post-processing.

In vivo imaging using two-photon microscopy 1 in mice that have been genetically engineered to express fluorescent proteins in specific cell types 2-3 has ...

Neuroscience

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central nervous system. We demonstrate a stereotaxic injection technique that allows targeted gene expression or silencing in the dorsal horn of the mouse spinal cord. The surgical procedure is brief. It requires laminectomy of a single vertebra, providing for quick recovery of the animal and unimpaired motility of the spine. Controlled injection of a small vector suspension volume at low speed and use of a microsyringe with beveled glass cannula minimize the tissue lesion. The local immune response to the vector depends on the intrinsic properties of the virus employed; in our experience, it is minor and short-lived when a recombinant adeno-associated virus is used. A reporter gene such as enhanced green fluorescent protein facilitates monitoring spatial distribution of the vector, and the efficacy and cellular specificity of the transfection.

Viral vectors allow for targeted gene manipulation. We demonstrate a method for conditional gene expression or ablation in the mouse spinal cord, using stereotaxic injection of a viral vector into the dorsal horn, a prominent site of synaptic contact between primary somatosensory afferents and neurons of the central nervous system.

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central ...

Developing Efficient and Precise Mouse Model for Spinal Cord Glioma

Surgical Transplantation of Tumor Cells into the Spinal Cord of Mice

Spinal cord gliomas are commonly malignant tumors of the spinal cord, leading to a high rate of disability. However, uniform treatment guidelines and comprehensive data on spinal cord gliomas remain limited due to the lack of suitable preclinical animal models. Developing a simple and reproducible animal model has become essential for advancing basic and translational research. A murine model is ideal, as the murine spinal cord shares structural similarities with the human spinal cord. This protocol describes the generation of a reproducible murine model of spinal cord glioma by directly injecting tumor cells into the intervertebral space using the spinous process of the seventh cervical vertebra as a guide. Compared to other methods, this approach is more effective and convenient, involving a smaller incision, reduced invasiveness and blood loss, faster recovery, and more stable tumor formation. This model is expected to advance the understanding of disease mechanisms, optimize surgical strategies, and support the development of therapeutic drugs for spinal cord gliomas.

The present protocol describes the development of a reproducible murine model of spinal cord glioma by injecting tumor cells into the intervertebral space, offering a more effective and less invasive approach for research and therapeutic development.

Spinal cord gliomas are commonly malignant tumors of the spinal cord, leading to a high rate of disability. However, uniform treatment guidelines and ...

Cancer Research

In Vivo Gene Transfer to Schwann Cells in the Rodent Sciatic Nerve by Electroporation

The formation of the myelin sheath by Schwann cells (SCs) is essential for rapid conduction of nerve impulses along axons in the peripheral nervous system. SC-selective genetic manipulation in living animals is a powerful technique for studying the molecular and cellular mechanisms of SC myelination and demyelination in vivo. While knockout/knockin and transgenic mice are powerful tools for studying SC biology, these methods are costly and time consuming. Viral vector-mediated transgene introduction into the sciatic nerve is a simpler and less laborious method. However, viral methods have limitations, such as toxicity, transgene size constraints, and infectivity restricted to certain developmental stages. Here, we describe a new method that allows selective transfection of myelinating SCs in the rodent sciatic nerve using electroporation. By applying electric pulses to the sciatic nerve at the site of plasmid DNA injection, genes of interest can be easily silenced or overexpressed in SCs in both neonatal and more mature animals. Furthermore, this in vivo electroporation method allows for highly efficient simultaneous expression of multiple transgenes. Our novel technique should enable researchers to efficiently manipulate SC gene expression, and facilitate studies on SC development and function.

In Vivo Gene Transfer to Schwann Cells in the Rodent Sciatic Nerve by Electroporation

Here, we present an in vivo technique for gene transfer to Schwann cells (SCs) in the rodent sciatic nerve. This simple technique is useful for investigating signaling mechanisms involved in the development and maintenance of myelinating SCs.

The formation of the myelin sheath by Schwann cells (SCs) is essential for rapid conduction of nerve impulses along axons in the peripheral nervous ...

Subpial Adeno-associated Virus 9 (AAV9) Vector Delivery in Adult Mice

The successful development of a subpial adeno-associated virus 9 (AAV9) vector delivery technique in adult rats and pigs has been reported on previously. Using subpially-placed polyethylene catheters (PE-10 or PE-5) for AAV9 delivery, potent transgene expression through the spinal parenchyma (white and gray matter) in subpially-injected spinal segments has been demonstrated. Because of the wide range of transgenic mouse models of neurodegenerative diseases, there is a strong desire for the development of a potent central nervous system (CNS)-targeted vector delivery technique in adult mice. Accordingly, the present study describes the development of a spinal subpial vector delivery device and technique to permit safe and effective spinal AAV9 delivery in adult C57BL/6J mice. In spinally immobilized and anesthetized mice, the pia mater (cervical 1 and lumbar 1-2 spinal segmental level) was incised with a sharp 34 G needle using an XYZ manipulator. A second XYZ manipulator was then used to advance a blunt 36G needle into the lumbar and/or cervical subpial space. The AAV9 vector (3-5 &#181;L; 1.2 x 1013 genome copies (gc)) encoding green fluorescent protein (GFP) was then injected subpially. After injections, neurological function (motor and sensory) was assessed periodically, and animals were perfusion-fixed 14 days after AAV9 delivery with 4% paraformaldehyde. Analysis of horizontal or transverse spinal cord sections showed transgene expression throughout the entire spinal cord, in both gray and white matter. In addition, intense retrogradely-mediated GFP expression was seen in the descending motor axons and neurons in the motor cortex, nucleus ruber, and formatio reticularis. No neurological dysfunction was noted in any animals. These data show that the subpial vector delivery technique can successfully be used in adult mice, without causing procedure-related spinal cord injury, and is associated with highly potent transgene expression throughout the spinal neuraxis.

Subpial Adeno-associated Virus 9 AAV9 Vector Delivery in Adult Mice

The goal of the present study was to develop and validate the potency and safety of spinal adeno-associated virus 9 (AAV9)-mediated gene delivery by using a novel subpial gene delivery technique in adult mice.

The successful development of a subpial adeno-associated virus 9 (AAV9) vector delivery technique in adult rats and pigs has been reported on previously. ...

Adeno-associated Virus-mediated Transgene Expression in Genetically Defined Neurons of the Spinal Cord

Selective manipulation of spinal neuronal subpopulations has mainly been achieved by two different methods: 1) Intersectional genetics, whereby double or triple transgenic mice are generated in order to achieve selective expression of a reporter or effector gene (e.g., from the Rosa26 locus) in the desired spinal population. 2) Intraspinal injection of Cre-dependent recombinant adeno-associated virus (rAAV); here Cre-dependent AAV vectors coding for the reporter or effector gene of choice are injected into the spinal cord of mice expressing Cre recombinase in the desired neuronal subpopulation. This protocol describes how to generate Cre-dependent rAAV vectors and how to transduce neurons in the dorsal horn of the lumbar spinal cord segments L3-L5 with rAAVs. As the lumbar spinal segments L3-L5 are innervated by those peripheral sensory neurons that transmit sensory information from the hindlimbs, spontaneous behavior and responses to sensory tests applied to the hindlimb ipsilateral to the injection side can be analyzed in order to interrogate the function of the manipulated neurons in sensory processing. We provide examples of how this technique can be used to analyze genetically defined subsets of spinal neurons. The main advantages of virus-mediated transgene expression in Cre transgenic mice compared to classical reporter mouse-induced transgene expression are the following: 1) Different Cre-dependent rAAVs encoding various reporter or effector proteins can be injected into a single Cre transgenic line, thus overcoming the need to create several multiple transgenic mouse lines. 2) Intraspinal injection limits manipulation of Cre-expressing cells to the injection site and to the time after injection. The main disadvantages are: 1) Reporter gene expression from rAAVs is more variable. 2) Surgery is required to transduce the spinal neurons of interest. Which of the two methods is more appropriate depends on the neuron population and research question to be addressed.

Intraspinal injection of recombinase dependent recombinant adeno-associated virus (rAAV) can be used to manipulate any genetically labelled cell type in the spinal cord. Here we describe how to transduce neurons in the dorsal horn of the lumbar spinal cord. This technique enables functional interrogation of the manipulated neuron subtype.

Selective manipulation of spinal neuronal subpopulations has mainly been achieved by two different methods: 1) Intersectional genetics, whereby double or ...

Direct Intrathecal Injection of Recombinant Adeno-associated Viruses in Adult Mice

Intrathecal (IT) injection of adeno-associated virus (AAV) has drawn considerable interest in CNS gene therapy by virtue of its safety, noninvasiveness, and excellent transduction efficacy in the CNS.&#160;Previous studies have demonstrated the therapeutic potency of AAV-delivered gene therapy in neurodegenerative disorders by IT administration. However, high rates of unpredictable failure due to the technical limitation of IT administration in small animals have been reported. Here, we established a scoring system to indicate the success extent of lumbar puncture in small animals by adding 1% lidocaine hydrochloride into the injection solution. We further show that the extent of transient weakness following injection can predict the transduction efficiency of AAV. Thus, this IT injection method can be used to optimize therapeutic trials in mouse models of CNS diseases that afflict wide regions of the CNS.

Here we present a direct intrathecal injection technique using 1% lidocaine hydrochloride in a viral solution to ensure efficient adeno-associated virus delivery to small animals and establish a scoring system to predict transduction efficiency in the central nervous system according to the degree of transient weakness induced by lidocaine.

Intrathecal (IT) injection of adeno-associated virus (AAV) has drawn considerable interest in CNS gene therapy by virtue of its safety, noninvasiveness, ...

Direct Injection of a Lentiviral Vector Highlights Multiple Motor Pathways in the Rat Spinal Cord

Introducing proteins of interest into cells in the nervous system is challenging due to innate biological barriers that limit access to most molecules. Injection directly into spinal cord tissue bypasses these barriers, providing access to cell bodies or synapses where molecules can be incorporated. Combining viral vector technology with this method allows for introduction of target genes into nervous tissue for the purpose of gene therapy or tract tracing. Here a virus engineered for highly efficient retrograde transport (HiRet) is introduced at the synapses of propriospinal interneurons (PNs) to encourage specific transport to neurons in the spinal cord and brainstem nuclei. Targeting PNs takes advantage of the numerous connections they receive from motor pathways such as the rubrospinal and reticulospinal tracts, as well as their interconnection with each other throughout spinal cord segments. Representative tracing using the HiRet vector with constitutively active green fluorescent protein (GFP) shows high fidelity details of cell bodies, axons and dendritic arbors in thoracic PNs and in reticulospinal neurons in the pontine reticular formation. HiRet incorporates well into brainstem pathways and PNs but shows age dependent integration into corticospinal tract neurons. In summary, spinal cord injection using viral vectors is a suitable method for introduction of proteins of interest into neurons of targeted tracts.

This protocol demonstrates injection of a retrogradely transportable viral vector into rat spinal cord tissue. The vector is taken up at the synapse and transported to the cell body of target neurons. This model is suitable for retrograde tracing of important spinal pathways or targeting cells for gene therapy applications.

Introducing proteins of interest into cells in the nervous system is challenging due to innate biological barriers that limit access to most molecules. ...

Intrathecal Delivery of Antisense Oligonucleotides in the Rat Central Nervous System

The blood brain barrier (BBB) is an important defense against the entrance of potentially toxic or pathogenic agents from the blood into the central nervous system (CNS). However, its existence also dramatically lowers the accessibility of systemically administered therapeutic agents to the CNS. One method to overcome this, is to inject those agents directly into the cerebrospinal fluid (CSF), thus bypassing the BBB. This can be done via implantation of a catheter for either continuous infusion using an osmotic pump, or for single bolus delivery. In this article, we describe a surgical protocol for delivery of CNS-targeting antisense oligonucleotides (ASOs) via a catheter implanted directly into the cauda equina space of the adult rat spine. As representative results, we show the efficacy of a single bolus ASO intrathecal (IT) injection via this catheterization system in knocking down the target RNA in different regions of the rat CNS. The procedure is safe, effective and does not require expensive equipment or surgical tools. The technique described here can be adapted to deliver drugs in other modalities as well.

Here, we describe a method for delivering drugs to the rat central nervous system by implanting a catheter into the lumbar intrathecal space of the spine. We focus on the delivery of antisense oligonucleotides, though this method is suitable for delivery of other therapeutic modalities as well.

The blood brain barrier (BBB) is an important defense against the entrance of potentially toxic or pathogenic agents from the blood into the central ...

A Comprehensive Protocol for Delivering Intrathecal Injections in Neonatal Mice

Intrathecal Injection of Newborn Mouse for Genome Editing and Drug Delivery

Intrathecal injection is a commonly employed procedure in both pediatric and adult clinics, serving as an effective means to administer medications and treatments. By directly delivering medications and treatments into the cerebrospinal fluid of the central nervous system, this method achieves higher localized drug concentrations while reducing systemic side-effects compared to other routes such as intravenous, subcutaneous, or intramuscular injections. Its importance extends beyond clinical settings, as intrathecal injection plays a vital role in preclinical studies focused on treating neurogenetic disorders in rodents and other large animals, including non-human primates. However, despite its widespread application, intrathecal injection in young, particularly neonatal pups, poses significant technical challenges due to their small size and fragile nature. Successful and reliable administration of intrathecal injections in newborn mice requires meticulous attention to detail and careful consideration of various factors. Thus, there is a crucial need for a standardized protocol that not only provides instructions but also highlights key technical considerations and good laboratory practices to ensure procedural consistency, as well as the safety and welfare of the animals.
To address this unmet need, we present a detailed and comprehensive protocol for performing intrathecal injections specifically in newborn pups on postnatal day 1 (P1). By following the step-by-step instructions, researchers can confidently perform intrathecal injections in neonatal pups, enabling the accurate delivery of drugs, antisense oligos, and viruses for gene replacement or genome editing-based treatments. Furthermore, the importance of adhering to good laboratory practices is emphasized to maintain the well-being of animals and ensure reliable experimental outcomes. This protocol aims to address the technical challenges associated with intrathecal injections in neonatal mice, ultimately facilitating advances in the field of neurogenetic research that aims to develop potential therapeutic interventions.

Author Spotlight: Intrathecal Injection &#8211; An Efficient and Reliable Delivery Method to Test the Efficacy of Gene Editing in Neonatal Mouse Brains

The present protocol outlines step-by-step instructions for performing intrathecal injections in neonatal mice for gene editing and drug delivery.

Intrathecal injection is a commonly employed procedure in both pediatric and adult clinics, serving as an effective means to administer medications and ...

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

In vivo Imaging of the Mouse Spinal Cord Using Two-photon Microscopy

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Surgical Transplantation of Tumor Cells into the Spinal Cord of Mice

In Vivo Gene Transfer to Schwann Cells in the Rodent Sciatic Nerve by Electroporation

Subpial Adeno-associated Virus 9 (AAV9) Vector Delivery in Adult Mice

Adeno-associated Virus-mediated Transgene Expression in Genetically Defined Neurons of the Spinal Cord

Direct Intrathecal Injection of Recombinant Adeno-associated Viruses in Adult Mice

Direct Injection of a Lentiviral Vector Highlights Multiple Motor Pathways in the Rat Spinal Cord

Intrathecal Delivery of Antisense Oligonucleotides in the Rat Central Nervous System

Intrathecal Injection of Newborn Mouse for Genome Editing and Drug Delivery