وكانت جميع الإجراءات استخدام الحيوانات وفقا للمبادئ التوجيهية الأخلاقية التي وضعتها هيئة الإدارة المحلية (Regierungspräsidium كارلسروه، كارلسروه، ألمانيا). 1. إعداد مجمع سيرنا / جزيرة الأمير إدوارد يتم إعداد الحل سيرنا / PEI معقدة باستخدام توجيهات المصنع على النحو التالي: <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> الحل ج: تمييع المبلغ المطلوب من سيرنا مع الماء المعقم (إذا لزم الأمر) ما يصل الى ربع حجم نهاية وتمييع هذا أيضا مع 10٪ محلول الجلوكوز تصل إلى نصف حجم النهاية. دوامة بلطف أو مزيج من قبل pipetting صعودا وهبوطا. كمية الأمثل للسيرنا يحتاج إلى أن تحدد تجريبيا ولكن 1 ميكروغرام سيرنا في 10 ميكرولتر حل معقد للحيوان الواحد هو نقطة انطلاق جيدة لتعظيم الاستفادة. </li><li style=";text-align:right;direction:rtl"> الحل ب: تمييع حجم الحاجة من PEI كاشف مع الماء المعقم تصل إلى ربع حجم نهاية وتمييع هذا أيضا مع 10٪ محلول الجلوكوز تصل إلى نصف حجم النهاية. دوامة جنرال الكتريكntly أو مزيج من قبل pipetting صعودا وهبوطا. ملاحظة: كمية PEI كاشف يحدد التوازن الأيوني في المجمع الذي يؤثر على كفاءة ترنسفكأيشن. كذلك كمية الأمثل للحل PEI لابد من تحديد تجريبيا. في أيدينا، فإن المبلغ الأمثل هو 0.12 ميكرولتر من PEI الحل لكل 1 ميكروغرام سيرنا. </li><li style=";text-align:right;direction:rtl"> مزيج الحل A B مع الحل في كل مرة، دوامة بلطف. </li><li style=";text-align:right;direction:rtl"> احتضان الحل مختلطة لمدة 15 دقيقة في RT قبل الاستخدام. هذا المجمع هو مستقر لمدة 2 ساعة على RT ولمدة 24 ساعة في 4 درجات مئوية. </li></ol> 2. حقن داخل القراب <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تخدير الفأر مع 3٪ isoflurane و، حتى لا يظهر أي علامات على المقوم منعكس. بالإضافة إلى ذلك، تحقق من وجود الذيل و / أو قرصة مخلب العاكسة لضمان مزيد من حالة التخدير. </li><li style=";text-align:right;direction:rtl"> يحلق حوالي 2 سم 2 من الفراء في نهاية الخلفي من الحيوان بالقرب من قاعدة الذيل لتسهيل التصور أفضل أثناء غرز الإبرة. </li><li style=";text-align:right;direction:rtl"> وضع الماوس فيمخروط الأنف لإدارة isoflurane واستمرت أثناء الإجراء، والحد من isoflurane وإلى 1.5٪، وتغطية عيون الماوس مع زيوت التشحيم العين. </li><li style=";text-align:right;direction:rtl"> إعداد جاهزة للاستخدام سيرنا حل مختلطة باستخدام حقنة هاميلتون 25 ميكرولتر تعلق على 30 G 0.5 في الإبرة. </li><li style=";text-align:right;direction:rtl"> تحديد موقع العملية الشائكة من L6، والتي ينبغي أن تكون واحدة من أبرز وإصلاح العمود الفقاريات حول هذه المنطقة عن طريق الضغط عليه برفق. </li><li style=";text-align:right;direction:rtl"> إدراج بعناية الإبرة بين أخدود من L5 L6 وفقرات ومراعاة لنفض الغبار الذيل كما يشير هذا التوقيع إدخال الناجح للإبرة في الفضاء داخل الجافية. تلميح: استخدام ظفر، ينبغي للمرء أن يكون قادرا على تحديد موقع الأخدود أيضا. </li><li style=";text-align:right;direction:rtl"> مرة واحدة ويلاحظ الذيل نفض الغبار، وعلى الفور، ولكن بعناية، وتأمين موقف إبرة بيد واحدة وحقن حجم المطلوب من مادة مع جهة أخرى ببطء. نصيحة: حجم بين 5-10 ميكرولتر هو الأمثل حيث حجم أقل من 5 و# 181؛ ل لا يمكن الاعتماد عليها، وبحجم أكبر من 10 ميكرولتر يؤدي إلى الكثير من الضغوط. </li><li style=";text-align:right;direction:rtl"> مرة واحدة يتم تنفيذ الحقن، وتحريك الماوس مرة أخرى إلى قفص للتعافي من التخدير. </li><li style=";text-align:right;direction:rtl"> تكرار هذه الحقن لا يقل عن 2 مرات كل 24 ساعة لتحقيق downregulation المثلى من الجينات المستهدفة. </li></ol>

<ol>
	<li>Hylden, J. L., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrathecal+morphine+in+mice:+a+new+technique.">Intrathecal morphine in mice: a new technique.</a> Eur. J. Pharmacol. 67, 313-316 (1980).</li><li>Stokes, J. A., Corr, M., Yaksh, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+tactile+allodynia+following+intrathecal+puncture+in+mouse:+contributions+of+Toll-like+receptor+signaling.">Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling.</a> Neurosci. Lett. 504, 215-218 (2011).</li><li>Goula, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+intravenous+delivery+of+transgenes+to+mouse+lung.">Polyethylenimine-based intravenous delivery of transgenes to mouse lung.</a> Gene Ther. , 1291-1295 (1998).</li><li>Fairbanks, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+delivery+of+analgesics+in+experimental+models+of+pain+and+analgesia.">Spinal delivery of analgesics in experimental models of pain and analgesia.</a> Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).</li><li>Hohmann, A. G., Tsou, K., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cannabinoid+modulation+of+wide+dynamic+range+neurons+in+the+lumbar+dorsal+horn+of+the+rat+by+spinally+administered+WIN55,212-2.">Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2.</a> Neurosci. Lett. 257, 119-122 (1998).</li><li>Song, Z. H., Takemori, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+spinal+kappa+opioid+receptors+in+the+antinociception+produced+by+intrathecally+administered+corticotropin-releasing+factor+in+mice.">Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice.</a> J. Pharmacol. Exp. Ther. 254, 363-368 (1990).</li><li>Trang, T., Sutak, M., Jhamandas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+cannabinoid+(CB1)-receptors+in+the+development+and+maintenance+of+opioid+tolerance.">Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance.</a> Neuroscience. , 1275-1288 (2007).</li><li>Yaksh, T. L., Rudy, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chronic+catheterization+of+the+spinal+subarachnoid+space.">Chronic catheterization of the spinal subarachnoid space.</a> Physiol. Behav. 17, 1031-1036 (1976).</li><li>Tappe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+scaffolding+protein+Homer1a+protects+against+chronic+inflammatory+pain.">Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain.</a> Nat. Med. , 677-681 (2006).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+Cav3.2+T-type+calcium+channel+gene+in+sensory+neurons+demonstrates+its+major+role+in+nociception.">Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.</a> EMBO J. 24, 315-324 (2005).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+to+dorsal+root+ganglia+by+intrathecal+injection:+effects+on+regeneration+of+peripheral+nerves.">Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves.</a> Mol. Ther. 12, 314-320 (2005).</li><li>Wigdor, S., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+and+systemic+morphine-induced+antinociception+in+mice:+contribution+of+descending+serotonergic+and+noradrenergic+pathways.">Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways.</a> J. Pharmacol. Exp. Ther. 242, 90-95 (1987).</li></ol>

الكتاب تعلن أي المصالح المالية المتنافسة.

وبالتالي، فإن تقنية المبين أعلاه حقن إبرة داخل القراب هو فعال وسريع، مترجمة على وجه التحديد، وغير تدميري. من الناحية الفنية، فإن الجانب الأكثر أهمية من هذا الإجراء هو نقطة الإدراج الإبرة في الأخدود. فمن الأهمية بمكان أن يتم هذا الإجراء مع أيدي هادئة جدا والصبر. مثل ا?...

الحبل الشوكي هو مركز مهم جدا في مجموعة متنوعة من العمليات البيولوجية الأساسية والوظائف الفسيولوجية، بما في ذلك تجهيز ونقل مؤلمة (مسبب للألم) المدخلات 4-7. وقد تم تطوير تقنيات تجريبية مختلفة لتسهيل التشكيل الدوائية من الحبل الشوكي، مثل زرع المزمنة القسطرة داخل القراب 8، حقن مكروي الحبل الشوكي، وحقن إبرة داخل القراب 9. كل تقنية مزاياه وعيوبه، واعتمادا على نموذج التجربة أسلوب واحد قد يكون أكثر ملاءمة من غيرها. في حين زرع المزمنة القسطرة داخل القراب هو ممكن بسهولة في الفئران، وهذه الطريقة من الصعب جدا في الماوس، ونظرا حجم القيود. نسبة نجاح منخفضة جدا والعجز الحركي وغالبا ما تحدث بسبب وجود ضخمة من قسطرة في الفضاء تحت الجافية تقتصر بشدة في الماوس. وعلاوة على ذلك، يتم تقديم التسليم على المدى الطويل من الأدوية بسبب تخثر المتكررةمن مزروع مزمنة القسطرة. أخيرا، وردود الفعل المناعي شائعة. يمكن التحايل هذه المشاكل باستخدام طريقة الحقن داخل القراب الحادة عن طريق إبرة في غياب قسطرة preimplanted، والتي تمكن التطبيق السريع وتشريحيا محدودة من الأدوية والكواشف إلى النخاع الشوكي لدى الفئران. هذا الأسلوب يحتفظ بالكامل فوائد التسليم داخل القراب على طرق أخرى النظامية التسليم (على سبيل المثال عن طريق الفم، في الوريد، داخل الصفاق، الخ) مثل خصوصية التشكيل الشوكي، والذي يسمح تخفيض الجرعات والآثار الجانبية الحد، وكذلك القدرة على تقديم المواد لا عادة لا عبور حاجز الدم في الدماغ منذ خلال حقن داخل القراب، يتم إدخال الإبرة بين الأم الجافية والحبل الشوكي. ولكن الأهم من ذلك، بالمقارنة مع غيرها من أساليب التسليم داخل القراب، وطريقة الحقن داخل القراب إبرة هو أقل الغازية، مما يتيح العديد من التطبيقات فينفس الحيوان دون أن تسبب أي تلف الأنسجة كبيرة أو إثارة رد فعل جهاز المناعة بسبب زرع المواد الأجنبية. ومع ذلك، فإنه يتطلب المهارات الفنية لاستهداف دقيقة جدا من الإبرة للسماح فعالية. هنا، علينا أن نظهر بصريا طريقة لتحقيق المعدل الأمثل لنجاح تستهدف على وجه التحديد الحبل الشوكي القطني. موقع الحقن الذي يتم اختياره في هذه التجربة هو الأخدود بين L5 L6 وعمود فقاري، وبالقرب من حيث ينتهي الحبل الشوكي، للتقليل من إمكانية الإضرار العمود الفقري. علاوة على ذلك، ونحن لشرح استخدام هذه التقنية لنهدم الجينات في النخاع الشوكي باستخدام الرناوات siRNAs.

<table border="0" cellpadding="0" cellspacing="0" width="1012">
	<colgroup>
		<col /> 
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:283px;">in vivo-jetPEI</td>
			<td style="width:255px;">Polyplus</td>
			<td style="width:288px;">201-10G</td>
			<td style="width:188px;"> </td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 siRNA</td>
			<td>Santa Cruz</td>
			<td>sc-36832</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Control siRNA-A</td>
			<td>Santa Cruz</td>
			<td>sc-37007</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-&#223;-Tubulin III antibody</td>
			<td>Sigma</td>
			<td>T2200</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-WAVE1 antibody</td>
			<td>R&#38;D Systems</td>
			<td>AF5514</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fast green dye</td>
			<td>Sigma</td>
			<td>F-7252</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane</td>
			<td>Baxter</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane setup</td>
			<td>Dr&#228;ger L&#252;beck</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Shaver</td>
			<td>Wella</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Hamilton syringe Gastight 1702</td>
			<td>Hamilton</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">30G 1/2, 0,3 * 13mm Needle</td>
			<td>BD Microlance</td>
			<td>304000</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Microscope Leica MS5</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 forward primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cacagagcctcaggacagg</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 reversed primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cttttcaccaacggcatctt</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">FastStart Essential DNA Green Master</td>
			<td>Roche</td>
			<td>6402712001</td>
			<td></td>
		</tr>
	</tbody>
</table>

in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice

ويصف هذا التقرير دليل خطوة بخطوة لأسلوب الحقن داخل القراب إبرة حادة بطريقة موسع، أي مستقلة عن القسطرة زرع. الحد التقنية لهذه التقنية الجراحية تكمن في براعة من اليدين. حقن سريع، وخاصة بالنسبة للمجرب المدربين، ومنذ تعطل الأنسجة مع هذه التقنية هو الحد الأدنى، تكرار الحقن ممكنة؛ لا يحدث رد فعل وعلاوة على ذلك في مأمن من الأدوات الخارجية (مثل القسطرة.)، وبالتالي إعطاء محددة أفضل وأكثر من قراءة التشكيل الحبل الشوكي. منذ تطبيق هذه المادة يقتصر إلى حد كبير في المنطقة المستهدفة من الحبل الشوكي، والمخدرات، لا تحتاج إلى أن تطبق في جرعات كبيرة، والآثار غير المرغوب فيها الأهم على الأنسجة الأخرى، كما لوحظ مع التسليم النظامية، يمكن التحايل 1، 2. علاوة على ذلك، فإننا نقوم بدمج هذه التقنية في الجسم الحي مع ترنسفكأيشن من الحمض النووي بمساعدة polyethylenimالمعهد الوطني للإحصاء (PEI) كاشف 3، التي تنص على براعة هائلة لدراسة وظائف العمود الفقري عن طريق تسليم كلاء الدوائية وكذلك الجينات، والجيش الملكي النيبالي، وجهري البروتين.

<html> من أجل توضيح حقن ناجحة، أجرينا هذه التقنية باستخدام سريع الخضراء FCF الصبغة في الفئران الكبار C57BL6 (8-10 أسابيع من العمر). سمح للحيوان لاسترداد لبضع دقائق بعد الحقن لتوفير ما يكفي من الوقت للصبغة لنشر ثم قتل مع جرعة زائدة من ثاني أكسيد الكربون 2. في وقت لاحق، تم تش?...

Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

ويصف هذا التقرير تقنية بسيطة وسريعة من داخل القراب ثقب إبرة لترنسفكأيشن المترجمة من سيرنا في النخاع الشوكي القطني في الماوس تحت التخدير قصيرة ضوء دائم.

في فيفو سيرنا ترنسفكأيشن والجينات ضربة قاضية في الحبل الشوكي عن طريق السريع موسع قطني داخل القراب الحقن في الفئران

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter ...

in-vivo-sirna-transfection-gene-knockdown-spinal-cord-via-rapid

Research

JoVE Journal

Biology

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

46.3K Views.  University of Heidelberg.  ويصف هذا التقرير تقنية بسيطة وسريعة من داخل القراب ثقب إبرة لترنسفكأيشن المترجمة من سيرنا في النخاع الشوكي القطني في الماوس تحت التخدير قصيرة ضوء دائم. 

Video: In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Spinal Cord Electrophysiology

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord dissection and preparation of recording bath artificial cerebrospinal fluid used for locomotor studies. Once dissected, the spinal cord ventral nerve roots can be attached to a recording electrode to record the electrophysiologic signals of the central pattern generating circuitry within the lumbar cord.

A demonstration of the isolation of neonatal mouse spinal cord for electrophysiologic studies.

الحبل الشوكي الكهربية

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord ...

Using an Automated Cell Counter to Simplify Gene Expression Studies: siRNA Knockdown of IL-4 Dependent Gene Expression in Namalwa Cells

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only to study the effects of downregulating single genes, but also to interrogate signaling pathways and other complex interaction networks.  These pathway analyses require both the use of relevant cellular models and methods that cause less perturbation to the cellular physiology.  Electroporation is increasingly being used as an effective way to introduce siRNA and other nucleic acids into difficult to transfect cell lines and primary cells without altering the signaling pathway under investigation. There are multiple critical steps to a successful siRNA experiment, and there are ways to simplify the work while improving the data quality at several experimental stages.  To help you get started with your siRNA mediated gene knockdown project, we will demonstrate how to perform a pathway study complete from collecting and counting the cells prior to electroporation through post transfection real-time PCR gene expression analysis.  The following study investigates the role of the transcriptional activator STAT6 in IL-4 dependent gene expression of CCL17 in a Burkitt lymphoma cell line (Namalwa).  The techniques demonstrated are useful for a wide range of siRNA-based experiments on both adherent and suspension cells.  We will also show how to streamline cell counting with the TC10 automated cell counter, how to electroporate multiple samples simultaneously using the MXcell electroporation system, and how to simultaneously assess RNA quality and quantity with the Experion automated electrophoresis system.

This procedure describes a quick and easy workflow to introduce siRNA into difficult to transfect cell lines and follow gene expression by real-time PCR. Use of an automated cell counter, multi-well electroporation plate, and automated electrophoresis station provide quick and reliable results without the need for expensive robotic handling.

باستخدام خلية مكافحة الآلي لتبسيط دراسات التعبير الجيني : ضربة قاضية سيرنا من IL - 4 التعبير الجيني في الخلايا التابعة Namalwa

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only ...

Patch Clamp and Perfusion Techniques for Studying Ion Channels Expressed in Xenopus oocytes

The protocol presented here is designed to study the activation of the large conductance, voltage- and Ca2+-activated K+ (BK) channels. The protocol may also be used to study the structure-function relationship for other ion channels and neurotransmitter receptors1. BK channels are widely expressed in different tissues and have been implicated in many physiological functions, including regulation of smooth muscle contraction, frequency tuning of inner hair cells and regulation of neurotransmitter release2-6. BK channels are activated by membrane depolarization and by intracellular Ca2+ and Mg2+ 6-9. Therefore, the protocol is designed to control both the membrane voltage and the intracellular solution. In this protocol, messenger RNA of BK channels is injected into Xenopus laevis oocytes (stage V-VI) followed by 2-5 days of incubation at 18&deg;C10-13. Membrane patches that contain single or multiple BK channels are excised with the inside-out configuration using patch clamp techniques10-13. The intracellular side of the patch is perfused with desired solutions during recording so that the channel activation under different conditions can be examined. To summarize, the mRNA of BK channels is injected into Xenopus laevis oocytes to express channel proteins on the oocyte membrane; patch clamp techniques are used to record currents flowing through the channels under controlled voltage and intracellular solutions.

Patch Clamp and Perfusion Techniques for Studying Ion Channels Expressed in Xenopus oocytes

Ionic current of BK channels is recorded using patch clamp techniques. BK channels are expressed in Xenopus oocytes by injecting messenger RNA. The intracellular solution during patch clamp recordings is controlled by a perfusion system.

أعربت المشبك التصحيح وتقنيات الإرواء لدراسة في قنوات ايون القيطم البويضات

The protocol presented here is designed to study the activation of the large conductance, voltage- and Ca2+-activated K+ (BK) channels. The protocol may ...

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

This video protocol demonstrates an effective technique to knockdown a particular gene in an insect and conduct a novel bioassay to measure excretion rate. This method can be used to obtain a better understanding of the process of diuresis in insects and is especially useful in the study of diuresis in blood-feeding arthropods that are able to take up huge amounts of liquid in a single blood meal. 
This RNAi-mediated gene knockdown combined with an in vivo diuresis assay was developed by the Hansen lab to study the effects of RNAi-mediated knockdown of aquaporin genes on Aedes aegypti mosquito diuresis1. 
The protocol is setup in two parts: the first demonstration illustrates how to construct a simple mosquito injection device and how to prepare and inject dsRNA into the thorax of mosquitoes for RNAi-mediated gene knockdown. The second demonstration illustrates how to determine excretion rates in mosquitoes using an in vivo bioassay.

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

In this protocol we combine RNAi-mediated gene silencing with an in vivo diuresis assay to study the effects knockdown of genes of interest has on mosquito fluid excretion.

رني ضربة قاضية بوساطة الجينات و<em&gt; في الجسم الحي</em&gt; فحص إدرار البول في الإناث البالغات<em&gt; الزاعجة المصرية</em&gt; البعوض

This video protocol demonstrates an effective technique to knockdown a particular gene in an insect and conduct a novel bioassay to measure excretion ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the messagefor review see 1. However, it's now widely accepted that synonymous codon usage is the primary cause of non-uniform translational elongation rates1. Synonymous codons are not used with identical frequency. A bias exists in the use of synonymous codons with some codons used more frequently than others2. Codon bias is organism as well as tissue specific2,3. Moreover, frequency of codon usage is directly proportional to the concentrations of cognate tRNAs4. Thus, a frequently used codon will have higher multitude of corresponding tRNAs, which further implies that a frequent codon will be translated faster than an infrequent one. Thus, regions on mRNA enriched in rare codons (potential pause sites) will as a rule slow down ribosome movement on the message and cause accumulation of nascent peptides of the respective sizes5-8. These pause sites can have functional impact on the protein expression, mRNA stability and protein foldingfor review see 9. Indeed, it was shown that alleviation of such pause sites can alter ribosome movement on mRNA and subsequently may affect the efficiency of co-translational (in vivo) protein folding1,7,10,11. To understand the process of protein folding in vivo, in the cell, that is ultimately coupled to the process of protein synthesis it is essential to gain comprehensive insights into the impact of codon usage/tRNA content on the movement of ribosomes along mRNA during translational elongation.
Here we describe a simple technique that can be used to locate major translation pause sites for a given mRNA translated in various cell-free systems6-8. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA. The rationale is that at low-frequency codons, the increase in the residence time of the ribosomes results in increased amounts of nascent peptides of the corresponding sizes. In vitro transcribed mRNA is used for in vitro translational reactions in the presence of radioactively labeled amino acids to allow the detection of the nascent chains. In order to isolate ribosome bound nascent polypeptide complexes the translation reaction is layered on top of 30% glycerol solution followed by centrifugation. Nascent polypeptides in polysomal pellet are further treated with ribonuclease A and resolved by SDS PAGE. This technique can be potentially used for any protein and allows analysis of ribosome movement along mRNA and the detection of the major pause sites. Additionally, this protocol can be adapted to study factors and conditions that can alter ribosome movement and thus potentially can also alter the function/conformation of the protein.

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

A technique to identify translational pause sites on mRNA is described. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA, followed by the size analysis of the nascent chains using a denaturing gel electrophoresis.

عزلة البروتينية ريبوسوم الوليدة منضم<em&gt; في المختبر</em&gt; لتحديد المواقع وقفة بالحركة على طول مرنا

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

Using SecM Arrest Sequence as a Tool to Isolate Ribosome Bound Polypeptides

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway that polypeptide chain follows during co-translational folding to achieve its functional form is still an enigma. In order to understand this process and to determine the exact conformation of the co-translational folding intermediates, it is essential to develop techniques that allow the isolation of RNCs carrying nascent chains of predetermined sizes to allow their further structural analysis.
SecM (secretion monitor) is a 170 amino acid E. coli protein that regulates expression of the downstream SecA (secretion driving) ATPase in the secM-secA operon6. Nakatogawa and Ito originally found that a 17 amino acid long sequence (150-FSTPVWISQAQGIRAGP-166) in the C-terminal region of the SecM protein is sufficient and necessary to cause stalling of SecM elongation at Gly165, thereby producing peptidyl-glycyl-tRNA stably bound to the ribosomal P-site7-9. More importantly, it was found that this 17 amino acid long sequence can be fused to the C-terminus of virtually any full-length and/or truncated protein thus allowing the production of RNCs carrying nascent chains of predetermined sizes7. Thus, when fused or inserted into the target protein, SecM stalling sequence produces arrest of the polypeptide chain elongation and generates stable RNCs both in vivo in E. coli cells and in vitro in a cell-free system. Sucrose gradient centrifugation is further utilized to isolate RNCs.
The isolated RNCs can be used to analyze structural and functional features of the co-translational folding intermediates. Recently, this technique has been successfully used to gain insights into the structure of several ribosome bound nascent chains10,11. Here we describe the isolation of bovine Gamma-B Crystallin RNCs fused to SecM and generated in an in vitro translation system.

We describe here a technique that is now routinely used to isolate stably bound ribosome nascent chain complexes (RNCs). This technique takes advantage of the discovery that a 17 amino acid long SecM "arrest sequence" can halt translation elongation in a prokaryotic (E. coli) system, when inserted into (or fused to the C-terminus) of virtually any protein.

باستخدام SecM تسلسل توقيف كأداة لعزل البروتينية منضم ريبوسوم

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway ...

Rapid Genetic Analysis of Epithelial-Mesenchymal Signaling During Hair Regeneration

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an attractive model system to study organ development and tissue-specific signaling. Although hair follicle development is genetically tractable, fast and reproducible analysis of factors essential for this process remains a challenge. Here we describe a procedure to generate targeted overexpression or shRNA-mediated knockdown of factors using lentivirus in a tissue-specific manner. Using a modified version of a hair regeneration model 5, 6, 11, we can achieve robust gain- or loss-of-function analysis in primary mouse keratinocytes or dermal cells to facilitate study of epithelial-mesenchymal signaling pathways that lead to hair follicle morphogenesis. We describe how to isolate fresh primary mouse keratinocytes and dermal cells, which contain dermal papilla cells and their precursors, deliver lentivirus containing either shRNA or cDNA to one of the cell populations, and combine the cells to generate fully formed hair follicles on the backs of nude mice. This approach allows analysis of tissue-specific factors required to generate hair follicles within three weeks and provides a fast and convenient companion to existing genetic models.

Tissue-specific analysis of a hair follicle regeneration model using lentivirus to mediate gain- or loss-of-function.

تحليل سريع لالوراثية طلائي-الوسيطة اشارة خلال تجديد الشعر

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an ...

Intravenous Injections in Neonatal Mice

Intravenous injection is a clinically applicable manner to deliver therapeutics. For adult rodents and larger animals, intravenous injections are technically feasible and routine. However, some mouse models can have early onset of disease with a rapid progression that makes administration of potential therapies difficult. The temporal (or facial) vein is just anterior to the ear bud in mice and is clearly visible for the first two days after birth on either side of the head using a dissecting microscope. During this window, the temporal vein can be injected with volumes up to 50 &#956;l. The injection is safe and well tolerated by both the pups and the dams. A typical injection procedure is completed within 1-2 min, after which the pup is returned to the home cage. By the third postnatal day the vein is difficult to visualize and the injection procedure becomes technically unreliable. This technique has been used for delivery of adeno-associated virus (AAV) vectors, which in turn can provide almost body-wide, stable transgene expression for the life of the animal depending on the viral serotype chosen.

Animal models of pediatric disease can experience early onset and aggressive disease progression. Clinically relevant therapy delivery to young mouse models can be technically difficult. This protocol describes a non-invasive intravenous injection method for newborn mice within the first two postnatal days of life.

الحقن في الوريد في الفئران حديثي الولادة

Intravenous injection is a clinically applicable manner to deliver therapeutics. For adult rodents and larger animals, intravenous injections are ...

Cystometric and External Urethral Sphincter Measurements in Awake Rats with Implanted Catheter and Electrodes Allowing for Repeated Measurements

Lower urinary tract function is mainly assessed by means of cystometric bladder function analysis in rodents. Conventional cystometries are usually performed as terminal analysis under urethane anesthesia. It is well known that anesthetic drugs can influence bladder function. Hence, the aim of this technique is to perform cystometric measurements of the urinary bladder and external urethral sphincter in lightly restrained awake rats. For this purpose, a bladder catheter is implanted into the bladder dome. Subsequently, two electrodes are implanted bilateral to the external urethral sphincter and a ground electrode is sutured to a non-responsive skeletal muscle. The bladder catheter and the three electrodes are finally tunneled subcutaneously to the neck region and affixed to a harness. With this technique, the lower urinary tract can be measured at multiple time points in the same animal to assess lower urinary tract function. The main application of this technique is the follow-up of simultaneous urinary bladder and external urethral sphincter function in awake healthy rats and after induction of a disease or injury. Moreover, subsequent lower urinary tract monitoring can be performed during evaluation of the disease/injury and to monitor treatment efficacy.

This protocol first describes the surgical procedure of the permanent implantation of a urinary bladder catheter combined with external urethral sphincter electrodes, and second, the measurement of the function of the urinary bladder and external urethral sphincter in implanted awake animals.

قياسات العضلة العاصرة الاحليل سيستوميتريك والخارجية في الفئران مستيقظا مع القسطرة مزروع واقطاب السماح للقياسات المتكررة

Lower urinary tract function is mainly assessed by means of cystometric bladder function analysis in rodents. Conventional cystometries are usually ...

Microbiota Analysis Using Two-step PCR and Next-generation 16S rRNA Gene Sequencing

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the immune system. Perturbation of the healthy gut microbiome has been suggested to play a role in the development of inflammatory diseases, including multiple sclerosis (MS). Environmental and genetic factors can influence the composition of the microbiome; therefore, identification of microbial communities linked with a disease phenotype has become the first step towards defining the microbiome&#8217;s role in health and disease. Use of 16S rRNA metagenomic sequencing for profiling bacterial community has helped in advancing microbiome research. Despite its wide use, there is no uniform protocol for 16S rRNA-based taxonomic profiling analysis. Another limitation is the low resolution of taxonomic assignment due to technical difficulties such as smaller sequencing reads, as well as use of only forward (R1) reads in the final analysis due to low quality of reverse (R2) reads. There is need for a simplified method with high resolution to characterize bacterial diversity in a given biospecimen. Advancements in sequencing technology with the ability to sequence longer reads at high resolution have helped to overcome some of these challenges. Present sequencing technology combined with a publicly available metagenomic analysis pipeline such as R-based Divisive Amplicon Denoising Algorithm-2 (DADA2) has helped advance microbial profiling at high resolution, as DADA2 can assign sequence at the genus and species levels. Described here is a guide for performing bacterial profiling using two-step amplification of the V3-V4 region of the 16S rRNA gene, followed by analysis using freely available analysis tools (i.e., DADA2, Phyloseq, and METAGENassist). It is believed that this simple and complete workflow will serve as an excellent tool for researchers interested in performing microbiome profiling studies.

Described here is a simplified standard operating procedure for microbiome profiling using 16S rRNA metagenomic sequencing and analysis using freely available tools. This protocol will help researchers who are new to the microbiome field as well as those requiring updates on methods to achieve bacterial profiling at a higher resolution.

تحليل الكائنات المجهرية باستخدام ثنائي الخطوة PCR والجيل التالي من 16S rRNA التسلسل الجيني

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the ...