Tutte le procedure di utilizzo di animali erano in conformità con le linee guida etiche stabilite dal Consiglio di amministrazione locale (Regierungspräsidium Karlsruhe, Karlsruhe, Germania). 1. Preparazione di siRNA / PEI Complex La soluzione complesso siRNA / PEI viene preparato utilizzando le indicazioni del produttore come segue: <ol><li> Soluzione A: Diluire la quantità desiderata di siRNA con acqua sterile (se necessario) fino ad un quarto del volume finale e diluire ulteriormente con soluzione di glucosio al 10% fino a metà del volume di fine. Vortex delicatamente o mescolare pipettando su e giù. La quantità ottimale di siRNA deve essere determinato empiricamente, ma 1 mg siRNA in 10 microlitri soluzione complessa per animale è un buon punto di partenza per l&#39;ottimizzazione. </li><li> Soluzione B: Diluire il volume necessario di PEI reagente con acqua sterile fino a un quarto del volume finale e diluire ulteriormente con soluzione di glucosio al 10% fino a metà del volume finale. Vortex gente o mescolare pipettando su e giù. Nota: la quantità di PEI reagente determina l&#39;equilibrio ionico nel complesso che influenza l&#39;efficienza della trasfezione. Allo stesso modo la quantità ottimale di soluzione di PEI deve essere determinato empiricamente. Nelle nostre mani, la quantità ottimale è di 0.12 ml di soluzione di PEI per 1 mg siRNA. </li><li> Mescolare la soluzione A con soluzione B tutti in una volta, vortice delicatamente. </li><li> Incubare la soluzione mista per 15 minuti a temperatura ambiente prima dell&#39;uso. Questo complesso è stabile per 2 ore a temperatura ambiente e per 24 ore a 4 ° C. </li></ol> 2. Iniezione intratecale <ol><li> Anestetizzare il mouse con il 3% isoflurano, fino a che non mostra segni di riflesso di raddrizzamento. Inoltre, controllare la coda e / o zampa pizzico riflesso per garantire ulteriormente lo stato di anestesia. </li><li> Radere circa 2 cm 2 di pelliccia alla fine posteriore dell&#39;animale vicino alla base della coda per facilitare una migliore visualizzazione durante l&#39;inserimento dell&#39;ago. </li><li> Posizionare il mouse inun&#39;ogiva di una amministrazione isoflurano proseguito nel corso del procedimento, ridurre l&#39;isoflurano al 1,5%, e coprire gli occhi del mouse con lubrificante occhio. </li><li> Preparare la soluzione pronta all&#39;uso mista siRNA usando una siringa Hamilton 25 microlitri collegato a un 30 G 0.5 a spillo. </li><li> Individuare il processo spinoso della L6, che dovrebbe essere il più importante e fissare la colonna vertebrato intorno a questa zona premendo delicatamente. </li><li> Inserire con cautela l&#39;ago tra la scanalatura di L5 e L6 vertebre e osservare per un colpo di coda come questo segno indica un lancio di successo dell&#39;ago nello spazio intradurale. Suggerimento: Utilizzando unghia, si dovrebbe essere in grado di individuare la scanalatura pure. </li><li> Una volta tail flick si osserva, immediatamente, ma attenzione, fissare la posizione dell&#39;ago con una mano e iniettare il volume desiderato di sostanza con l&#39;altra mano lentamente. Suggerimento: un volume compreso tra 5-10 microlitri è ottimale in quanto il volume a meno di 5 &amp;# 181; l è inaffidabile e un maggior volume di 10 microlitri porta a troppa pressione. </li><li> Una volta eseguita l&#39;iniezione, spostare il mouse torna alla gabbia di recupero dall&#39;anestesia. </li><li> Ripetere questa iniezione più almeno 2 volte ogni 24 ore per raggiungere down-regulation ottimale del gene bersaglio. </li></ol>

<ol>
	<li>Hylden, J. L., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrathecal+morphine+in+mice:+a+new+technique.">Intrathecal morphine in mice: a new technique.</a> Eur. J. Pharmacol. 67, 313-316 (1980).</li><li>Stokes, J. A., Corr, M., Yaksh, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+tactile+allodynia+following+intrathecal+puncture+in+mouse:+contributions+of+Toll-like+receptor+signaling.">Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling.</a> Neurosci. Lett. 504, 215-218 (2011).</li><li>Goula, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+intravenous+delivery+of+transgenes+to+mouse+lung.">Polyethylenimine-based intravenous delivery of transgenes to mouse lung.</a> Gene Ther. , 1291-1295 (1998).</li><li>Fairbanks, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+delivery+of+analgesics+in+experimental+models+of+pain+and+analgesia.">Spinal delivery of analgesics in experimental models of pain and analgesia.</a> Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).</li><li>Hohmann, A. G., Tsou, K., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cannabinoid+modulation+of+wide+dynamic+range+neurons+in+the+lumbar+dorsal+horn+of+the+rat+by+spinally+administered+WIN55,212-2.">Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2.</a> Neurosci. Lett. 257, 119-122 (1998).</li><li>Song, Z. H., Takemori, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+spinal+kappa+opioid+receptors+in+the+antinociception+produced+by+intrathecally+administered+corticotropin-releasing+factor+in+mice.">Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice.</a> J. Pharmacol. Exp. Ther. 254, 363-368 (1990).</li><li>Trang, T., Sutak, M., Jhamandas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+cannabinoid+(CB1)-receptors+in+the+development+and+maintenance+of+opioid+tolerance.">Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance.</a> Neuroscience. , 1275-1288 (2007).</li><li>Yaksh, T. L., Rudy, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chronic+catheterization+of+the+spinal+subarachnoid+space.">Chronic catheterization of the spinal subarachnoid space.</a> Physiol. Behav. 17, 1031-1036 (1976).</li><li>Tappe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+scaffolding+protein+Homer1a+protects+against+chronic+inflammatory+pain.">Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain.</a> Nat. Med. , 677-681 (2006).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+Cav3.2+T-type+calcium+channel+gene+in+sensory+neurons+demonstrates+its+major+role+in+nociception.">Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.</a> EMBO J. 24, 315-324 (2005).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+to+dorsal+root+ganglia+by+intrathecal+injection:+effects+on+regeneration+of+peripheral+nerves.">Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves.</a> Mol. Ther. 12, 314-320 (2005).</li><li>Wigdor, S., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+and+systemic+morphine-induced+antinociception+in+mice:+contribution+of+descending+serotonergic+and+noradrenergic+pathways.">Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways.</a> J. Pharmacol. Exp. Ther. 242, 90-95 (1987).</li></ol>

Gli autori dichiarano interessi finanziari concorrenti.

Pertanto, la tecnica di iniezioni intratecale aghi sopra descritta è efficace, veloce, specificamente localizzate, e non distruttivo. Tecnicamente, l&#39;aspetto più critico di questa procedura è il punto di inserimento dell&#39;ago nella scanalatura. E &#39;fondamentale che questa procedura è fatta con le mani molto calma e pazienza. Come molte procedure chirurgiche, la formazione migliora la velocità di iniezione di successo. Questo è importante anche perché durante un esperimento reale, questa tecnica non forn...

Il midollo spinale è un centro molto importante in una varietà di processi biologici chiave e funzioni fisiologiche, tra cui l&#39;elaborazione e la trasmissione di dolorose (nocicettivi) ingressi 4-7. Sono state sviluppate varie tecniche sperimentali per facilitare modulazione farmacologica del midollo spinale, come impianto cronica di cateteri intratecali 8, microiniezione del midollo spinale, e intratecale ago di iniezione 9. Ogni tecnica ha i suoi vantaggi e svantaggi, e in funzione del paradigma esperimento una tecnica potrebbe essere più adatto rispetto agli altri. Considerando impianto cronica di cateteri intratecali è facilmente realizzabile in ratto, questo metodo è molto difficile nel topo, dato restrizioni di dimensione. Tasso di successo è molto bassa e deficit motori spesso si verificano a causa della presenza ingombrante di un catetere nello spazio subdurale fortemente confinato nel topo. Inoltre, la consegna a lungo termine di farmaci è resa a causa di frequenti coagulazionedi cronicamente impiantati cateteri. Infine, reazioni immunitarie sono comuni. Questi problemi possono essere aggirate utilizzando il metodo di iniezione intratecale acuta tramite un ago in assenza di un catetere preimplanted, che permette un facile e anatomicamente limitata applicazione di farmaci e reagenti per midolli spinali di topi. Questo metodo mantiene pienamente i vantaggi della somministrazione intratecale su altri percorsi di consegna sistemici (per esempio orale, endovenosa, intraperitoneale, ecc) come specificità di modulazione spinale, che permette dosaggi ridotti ed effetti collaterali limite, così come la capacità di fornire sostanze non fanno normalmente non attraversa la barriera ematoencefalica in quanto durante l&#39;iniezione intratecale, l&#39;ago viene inserito tra la dura madre e il midollo spinale. Importante, tuttavia, in confronto ad altri metodi di somministrazione intratecale, il metodo di iniezione dell&#39;ago intratecale è la meno invasiva, consentendo numerose applicazioni nelstesso animale senza causare notevoli danni ai tessuti o evocando reazione immunitaria a causa di impianto di materiale estraneo. Tuttavia, esso richiede competenze tecniche per una targeting preciso dell&#39;ago per permettere efficacia. Qui, dimostriamo visivamente il metodo per raggiungere un tasso ottimale di successo per specificamente rivolti midollo spinale lombare. Il sito di iniezione che viene scelto in questo esperimento è il solco tra L5 e L6 colonna vertebrato, vicino a dove termina il midollo spinale, per minimizzare la possibilità di danneggiare il dorso. Inoltre, dimostriamo l&#39;uso di questa tecnica per abbattere i geni nel midollo spinale con siRNA.

<table><tbody><tr><td>&lt;em&gt;In Vivo&lt;/em&gt;-jetPEI</td><td>Polyplus</td><td>201-10G</td><td>&amp;nbsp;</td></tr><tr><td>WAVE1 siRNA</td><td>Santa Cruz</td><td>sc-36832</td><td>&amp;nbsp;</td></tr><tr><td>Control siRNA-A</td><td>Santa Cruz</td><td>sc-37007</td><td>&amp;nbsp;</td></tr><tr><td>Anti-&amp;szlig;-Tubulin III antibody</td><td>Sigma</td><td>T2200</td><td>&amp;nbsp;</td></tr><tr><td>Anti-WAVE1 antibody</td><td>R&amp;amp;D Systems</td><td>AF5514</td><td>&amp;nbsp;</td></tr><tr><td>Fast green dye</td><td>Sigma</td><td>F-7252</td><td>&amp;nbsp;</td></tr><tr><td>Isoflurane</td><td>Baxter</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Isoflurane setup</td><td>Dr&amp;auml;ger L&amp;uuml;beck</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Shaver</td><td>Wella</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Hamilton syringe Gastight 1702</td><td>Hamilton</td><td></td><td>&amp;nbsp;</td></tr><tr><td>30 G 1/2 in 13 mm Needle</td><td>BD Microlance</td><td>304000</td><td>&amp;nbsp;</td></tr><tr><td>Microscope Leica MS5</td><td>Leica</td><td></td><td>&amp;nbsp;</td></tr><tr><td>WAVE1 forward primer for qRT-PCR</td><td>Sigma</td><td></td><td>cacagagcctcaggacagg</td></tr><tr><td>WAVE1 reversed primer for qRT-PCR</td><td>Sigma</td><td></td><td>cttttcaccaacggcatctt</td></tr><tr><td>FastStart Essential DNA Green Master</td><td>Roche</td><td>6402712001</td><td>&amp;nbsp;</td></tr></tbody></table>

in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice

Questo rapporto descrive una guida step-by-step per la tecnica di iniezioni ago intratecale acuti in maniera non invasiva, cioè indipendente catetere impianto. La limitazione tecnica di questa tecnica chirurgica consiste nella finezza delle mani. L&#39;iniezione è rapida, soprattutto per un sperimentatore addestrato, e poiché rottura dei tessuti con questa tecnica è minima, iniezioni ripetute sono possibili; reazione peraltro immune agli strumenti stranieri (. Es. catetere) non si verifica, dando così una migliore e più specifica leggere di modulazione del midollo spinale. Dato che l&#39;applicazione della sostanza è in gran parte limitata alla regione bersaglio del midollo spinale, farmaci non devono essere applicati in grandi dosi, e soprattutto effetti indesiderati su altri tessuti, come osservato con una consegna sistematica, potrebbero essere aggirate 1, 2. Inoltre, si combinano questa tecnica con transfezione in vivo di acido nucleico con l&#39;aiuto di polyethylenimine (PEI) reagente 3, che prevede la versatilità tremenda per studiare le funzioni spinali via la consegna di agenti farmacologici così come gene, RNA, proteine ​​e modulatori.

Al fine di illustrare una iniezione di successo, abbiamo eseguito questa tecnica usando rapidi colorante verde FCF in adulti C57BL6 topi (8-10 settimane di età). L&#39;animale è stato permesso di recuperare per pochi minuti dopo l&#39;iniezione di fornire tempo sufficiente per il colorante di diffondersi e poi ucciso con una overdose di CO 2. Successivamente, la colonna vertebrato stato dissezionato e il midollo spinale è stato esposto. Il puncta blu corrispondente alla tintura diffusa, ha segnato il sito ...

Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Questo rapporto descrive una tecnica semplice e rapida di intratecale ago puntura per una trasfezione di siRNA localizzato nel midollo spinale lombare nel topo sotto breve anestesia leggera durata.

In Vivo trasfezione di siRNA e Gene Knockdown in Spinal Cord via rapida non invasiva lombare spinale iniezioni nei topi

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter ...

in-vivo-sirna-transfection-gene-knockdown-spinal-cord-via-rapid

Research

JoVE Journal

Biology

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

46.4K Views.  University of Heidelberg.  Questo rapporto descrive una tecnica semplice e rapida di intratecale ago puntura per una trasfezione di siRNA localizzato nel midollo spinale lombare nel topo sotto breve anestesia leggera durata. 

Video: In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

In vivo Imaging of the Mouse Spinal Cord Using Two-photon Microscopy

In vivo imaging using two-photon microscopy 1 in mice that have been genetically engineered to express fluorescent proteins in specific cell types 2-3 has significantly broadened our knowledge of physiological and pathological processes in numerous tissues in vivo 4-7. In studies of the central nervous system (CNS), there has been a broad application of in vivo imaging in the brain, which has produced a plethora of novel and often unexpected findings about the behavior of cells such as neurons, astrocytes, microglia, under physiological or pathological conditions 8-17. However, mostly technical complications have limited the implementation of in vivo imaging in studies of the living mouse spinal cord. In particular, the anatomical proximity of the spinal cord to the lungs and heart generates significant movement artifact that makes imaging the living spinal cord a challenging task.
We developed a novel method that overcomes the inherent limitations of spinal cord imaging by stabilizing the spinal column, reducing respiratory-induced movements and thereby facilitating the use of two-photon microscopy to image the mouse spinal cord in vivo. This is achieved by combining a customized spinal stabilization device with a method of deep anesthesia, resulting in a significant reduction of respiratory-induced movements. This video protocol shows how to expose a small area of the living spinal cord that can be maintained under stable physiological conditions over extended periods of time by keeping tissue injury and bleeding to a minimum. Representative raw images acquired in vivo detail in high resolution the close relationship between microglia and the vasculature. A timelapse sequence shows the dynamic behavior of microglial processes in the living mouse spinal cord. Moreover, a continuous scan of the same z-frame demonstrates the outstanding stability that this method can achieve to generate stacks of images and/or timelapse movies that do not require image alignment post-acquisition. Finally, we show how this method can be used to revisit and reimage the same area of the spinal cord at later timepoints, allowing for longitudinal studies of ongoing physiological or pathological processes in vivo.

In vivo Imaging of the Mouse Spinal Cord Using Two-photon Microscopy

A minimally invasive protocol to stabilize the mouse spinal column and perform repetitive in vivo spinal cord imaging using two-photon microscopy is described. This method combines a spinal stabilization device and an anesthetic regimen to minimize respiratory-induced movements and produce raw imaging data that require no alignment or other post-processing.

Imaging in vivo del midollo spinale di topo Utilizzo di due fotoni Microscopia

In vivo imaging using two-photon microscopy 1 in mice that have been genetically engineered to express fluorescent proteins in specific cell types 2-3 has ...

Ricerca

Neuroscienze

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central nervous system. We demonstrate a stereotaxic injection technique that allows targeted gene expression or silencing in the dorsal horn of the mouse spinal cord. The surgical procedure is brief. It requires laminectomy of a single vertebra, providing for quick recovery of the animal and unimpaired motility of the spine. Controlled injection of a small vector suspension volume at low speed and use of a microsyringe with beveled glass cannula minimize the tissue lesion. The local immune response to the vector depends on the intrinsic properties of the virus employed; in our experience, it is minor and short-lived when a recombinant adeno-associated virus is used. A reporter gene such as enhanced green fluorescent protein facilitates monitoring spatial distribution of the vector, and the efficacy and cellular specificity of the transfection.

Viral vectors allow for targeted gene manipulation. We demonstrate a method for conditional gene expression or ablation in the mouse spinal cord, using stereotaxic injection of a viral vector into the dorsal horn, a prominent site of synaptic contact between primary somatosensory afferents and neurons of the central nervous system.

Iniezione stereotassica di un vettore virale per la manipolazione del gene condizionale nel midollo spinale del mouse

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central ...

<meta charset="utf8"></head><body>Sviluppo di un modello murino efficiente e preciso per il glioma del midollo spinale

Surgical Transplantation of Tumor Cells into the Spinal Cord of Mice

Spinal cord gliomas are commonly malignant tumors of the spinal cord, leading to a high rate of disability. However, uniform treatment guidelines and comprehensive data on spinal cord gliomas remain limited due to the lack of suitable preclinical animal models. Developing a simple and reproducible animal model has become essential for advancing basic and translational research. A murine model is ideal, as the murine spinal cord shares structural similarities with the human spinal cord. This protocol describes the generation of a reproducible murine model of spinal cord glioma by directly injecting tumor cells into the intervertebral space using the spinous process of the seventh cervical vertebra as a guide. Compared to other methods, this approach is more effective and convenient, involving a smaller incision, reduced invasiveness and blood loss, faster recovery, and more stable tumor formation. This model is expected to advance the understanding of disease mechanisms, optimize surgical strategies, and support the development of therapeutic drugs for spinal cord gliomas.

<meta charset="utf8"></head><body>Trapianto chirurgico di cellule tumorali nel midollo spinale di topi

The present protocol describes the development of a reproducible murine model of spinal cord glioma by injecting tumor cells into the intervertebral space, offering a more effective and less invasive approach for research and therapeutic development.

Trapianto chirurgico di cellule tumorali nel midollo spinale di topi

Spinal cord gliomas are commonly malignant tumors of the spinal cord, leading to a high rate of disability. However, uniform treatment guidelines and ...

Ricerca sul cancro

In Vivo Gene Transfer to Schwann Cells in the Rodent Sciatic Nerve by Electroporation

The formation of the myelin sheath by Schwann cells (SCs) is essential for rapid conduction of nerve impulses along axons in the peripheral nervous system. SC-selective genetic manipulation in living animals is a powerful technique for studying the molecular and cellular mechanisms of SC myelination and demyelination in vivo. While knockout/knockin and transgenic mice are powerful tools for studying SC biology, these methods are costly and time consuming. Viral vector-mediated transgene introduction into the sciatic nerve is a simpler and less laborious method. However, viral methods have limitations, such as toxicity, transgene size constraints, and infectivity restricted to certain developmental stages. Here, we describe a new method that allows selective transfection of myelinating SCs in the rodent sciatic nerve using electroporation. By applying electric pulses to the sciatic nerve at the site of plasmid DNA injection, genes of interest can be easily silenced or overexpressed in SCs in both neonatal and more mature animals. Furthermore, this in vivo electroporation method allows for highly efficient simultaneous expression of multiple transgenes. Our novel technique should enable researchers to efficiently manipulate SC gene expression, and facilitate studies on SC development and function.

In Vivo Gene Transfer to Schwann Cells in the Rodent Sciatic Nerve by Electroporation

Here, we present an in vivo technique for gene transfer to Schwann cells (SCs) in the rodent sciatic nerve. This simple technique is useful for investigating signaling mechanisms involved in the development and maintenance of myelinating SCs.

In Vivo Gene Transfer di cellule di Schwann nel nervo sciatico roditori da elettroporazione

The formation of the myelin sheath by Schwann cells (SCs) is essential for rapid conduction of nerve impulses along axons in the peripheral nervous ...

Subpial Adeno-associated Virus 9 (AAV9) Vector Delivery in Adult Mice

The successful development of a subpial adeno-associated virus 9 (AAV9) vector delivery technique in adult rats and pigs has been reported on previously. Using subpially-placed polyethylene catheters (PE-10 or PE-5) for AAV9 delivery, potent transgene expression through the spinal parenchyma (white and gray matter) in subpially-injected spinal segments has been demonstrated. Because of the wide range of transgenic mouse models of neurodegenerative diseases, there is a strong desire for the development of a potent central nervous system (CNS)-targeted vector delivery technique in adult mice. Accordingly, the present study describes the development of a spinal subpial vector delivery device and technique to permit safe and effective spinal AAV9 delivery in adult C57BL/6J mice. In spinally immobilized and anesthetized mice, the pia mater (cervical 1 and lumbar 1-2 spinal segmental level) was incised with a sharp 34 G needle using an XYZ manipulator. A second XYZ manipulator was then used to advance a blunt 36G needle into the lumbar and/or cervical subpial space. The AAV9 vector (3-5 &#181;L; 1.2 x 1013 genome copies (gc)) encoding green fluorescent protein (GFP) was then injected subpially. After injections, neurological function (motor and sensory) was assessed periodically, and animals were perfusion-fixed 14 days after AAV9 delivery with 4% paraformaldehyde. Analysis of horizontal or transverse spinal cord sections showed transgene expression throughout the entire spinal cord, in both gray and white matter. In addition, intense retrogradely-mediated GFP expression was seen in the descending motor axons and neurons in the motor cortex, nucleus ruber, and formatio reticularis. No neurological dysfunction was noted in any animals. These data show that the subpial vector delivery technique can successfully be used in adult mice, without causing procedure-related spinal cord injury, and is associated with highly potent transgene expression throughout the spinal neuraxis.

Subpial Adeno-associated Virus 9 AAV9 Vector Delivery in Adult Mice

The goal of the present study was to develop and validate the potency and safety of spinal adeno-associated virus 9 (AAV9)-mediated gene delivery by using a novel subpial gene delivery technique in adult mice.

Subito Adeno associato Virus 9 (AAV9) Consegna vettoriale nei topi adulti

The successful development of a subpial adeno-associated virus 9 (AAV9) vector delivery technique in adult rats and pigs has been reported on previously. ...

Adeno-associated Virus-mediated Transgene Expression in Genetically Defined Neurons of the Spinal Cord

Selective manipulation of spinal neuronal subpopulations has mainly been achieved by two different methods: 1) Intersectional genetics, whereby double or triple transgenic mice are generated in order to achieve selective expression of a reporter or effector gene (e.g., from the Rosa26 locus) in the desired spinal population. 2) Intraspinal injection of Cre-dependent recombinant adeno-associated virus (rAAV); here Cre-dependent AAV vectors coding for the reporter or effector gene of choice are injected into the spinal cord of mice expressing Cre recombinase in the desired neuronal subpopulation. This protocol describes how to generate Cre-dependent rAAV vectors and how to transduce neurons in the dorsal horn of the lumbar spinal cord segments L3-L5 with rAAVs. As the lumbar spinal segments L3-L5 are innervated by those peripheral sensory neurons that transmit sensory information from the hindlimbs, spontaneous behavior and responses to sensory tests applied to the hindlimb ipsilateral to the injection side can be analyzed in order to interrogate the function of the manipulated neurons in sensory processing. We provide examples of how this technique can be used to analyze genetically defined subsets of spinal neurons. The main advantages of virus-mediated transgene expression in Cre transgenic mice compared to classical reporter mouse-induced transgene expression are the following: 1) Different Cre-dependent rAAVs encoding various reporter or effector proteins can be injected into a single Cre transgenic line, thus overcoming the need to create several multiple transgenic mouse lines. 2) Intraspinal injection limits manipulation of Cre-expressing cells to the injection site and to the time after injection. The main disadvantages are: 1) Reporter gene expression from rAAVs is more variable. 2) Surgery is required to transduce the spinal neurons of interest. Which of the two methods is more appropriate depends on the neuron population and research question to be addressed.

Intraspinal injection of recombinase dependent recombinant adeno-associated virus (rAAV) can be used to manipulate any genetically labelled cell type in the spinal cord. Here we describe how to transduce neurons in the dorsal horn of the lumbar spinal cord. This technique enables functional interrogation of the manipulated neuron subtype.

Espressione del Transgene di mediata da Virus adeno-associato in neuroni geneticamente definiti del midollo spinale

Selective manipulation of spinal neuronal subpopulations has mainly been achieved by two different methods: 1) Intersectional genetics, whereby double or ...

Direct Intrathecal Injection of Recombinant Adeno-associated Viruses in Adult Mice

Intrathecal (IT) injection of adeno-associated virus (AAV) has drawn considerable interest in CNS gene therapy by virtue of its safety, noninvasiveness, and excellent transduction efficacy in the CNS.&#160;Previous studies have demonstrated the therapeutic potency of AAV-delivered gene therapy in neurodegenerative disorders by IT administration. However, high rates of unpredictable failure due to the technical limitation of IT administration in small animals have been reported. Here, we established a scoring system to indicate the success extent of lumbar puncture in small animals by adding 1% lidocaine hydrochloride into the injection solution. We further show that the extent of transient weakness following injection can predict the transduction efficiency of AAV. Thus, this IT injection method can be used to optimize therapeutic trials in mouse models of CNS diseases that afflict wide regions of the CNS.

Here we present a direct intrathecal injection technique using 1% lidocaine hydrochloride in a viral solution to ensure efficient adeno-associated virus delivery to small animals and establish a scoring system to predict transduction efficiency in the central nervous system according to the degree of transient weakness induced by lidocaine.

Diretto iniezione intratecale di ricombinanti Virus Adeno-associato in topi adulti

Intrathecal (IT) injection of adeno-associated virus (AAV) has drawn considerable interest in CNS gene therapy by virtue of its safety, noninvasiveness, ...

Direct Injection of a Lentiviral Vector Highlights Multiple Motor Pathways in the Rat Spinal Cord

Introducing proteins of interest into cells in the nervous system is challenging due to innate biological barriers that limit access to most molecules. Injection directly into spinal cord tissue bypasses these barriers, providing access to cell bodies or synapses where molecules can be incorporated. Combining viral vector technology with this method allows for introduction of target genes into nervous tissue for the purpose of gene therapy or tract tracing. Here a virus engineered for highly efficient retrograde transport (HiRet) is introduced at the synapses of propriospinal interneurons (PNs) to encourage specific transport to neurons in the spinal cord and brainstem nuclei. Targeting PNs takes advantage of the numerous connections they receive from motor pathways such as the rubrospinal and reticulospinal tracts, as well as their interconnection with each other throughout spinal cord segments. Representative tracing using the HiRet vector with constitutively active green fluorescent protein (GFP) shows high fidelity details of cell bodies, axons and dendritic arbors in thoracic PNs and in reticulospinal neurons in the pontine reticular formation. HiRet incorporates well into brainstem pathways and PNs but shows age dependent integration into corticospinal tract neurons. In summary, spinal cord injection using viral vectors is a suitable method for introduction of proteins of interest into neurons of targeted tracts.

This protocol demonstrates injection of a retrogradely transportable viral vector into rat spinal cord tissue. The vector is taken up at the synapse and transported to the cell body of target neurons. This model is suitable for retrograde tracing of important spinal pathways or targeting cells for gene therapy applications.

Iniezione diretta di un vettore lentivirale evidenzia più vie motorie del midollo spinale del ratto

Introducing proteins of interest into cells in the nervous system is challenging due to innate biological barriers that limit access to most molecules. ...

In Vivo trasfezione di siRNA e Gene Knockdown in Spinal Cord via rapida non invasiva lombare spinale iniezioni nei topi

Riepilogo

Esplora Altri Video

Capitoli in questo video

Imaging in vivo del midollo spinale di topo Utilizzo di due fotoni Microscopia

Iniezione stereotassica di un vettore virale per la manipolazione del gene condizionale nel midollo spinale del mouse

Trapianto chirurgico di cellule tumorali nel midollo spinale di topi

Trapianto chirurgico di cellule tumorali nel midollo spinale di topi

Trapianto chirurgico di cellule tumorali nel midollo spinale di topi

In Vivo Gene Transfer di cellule di Schwann nel nervo sciatico roditori da elettroporazione

Subito Adeno associato Virus 9 (AAV9) Consegna vettoriale nei topi adulti

Espressione del Transgene di mediata da Virus adeno-associato in neuroni geneticamente definiti del midollo spinale

Diretto iniezione intratecale di ricombinanti Virus Adeno-associato in topi adulti

Iniezione diretta di un vettore lentivirale evidenzia più vie motorie del midollo spinale del ratto