כל נהלי השימוש בבעלי החיים היו בהתאם לקווים מנחים אתיים שנקבעו על ידי גוף שלטוני המקומי (Regierungspräsidium קרלסרוהה, קרלסרוהה, גרמניה). 1. הכנת מורכבת siRNA / PEI הפתרון המורכב siRNA / PEI מוכן באמצעות הוראות יצרן כדלקמן: <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> פתרון: לדלל את הכמות הרצויה של siRNA עם מים סטריליים (במידת צורך) עד רבע לסוף הנפח ולדלל עוד יותר את זה עם 10% פתרון גלוקוז עד מחצית מסוף הנפח. מערבולת בעדינות או מערבב על ידי pipetting למעלה ולמטה. הכמות האופטימלית של siRNA צריכה להיקבע באופן אמפירי אבל 1 מיקרוגרם siRNA ב10 פתרון μl מורכב לכל בעל חיים הוא נקודת התחלה טובה לאופטימיזציה. </li><li style=";text-align:right;direction:rtl"> פתרון ב &#39;: לדלל את הנפח הדרוש של מגיב PEI עם מים עד סטרילי כדי רבע מסוף הנפח ולדלל את זה עוד יותר עם 10% פתרון את הגלוקוז למחצית מסוף הנפח. ורטקס gently או מערבב על ידי pipetting למעלה ולמטה. הערה: הכמות של מגיב PEI קובעת את האיזון היוני במתחם, המשפיע על היעילות של transfection. כמו כן את הכמות האופטימלית של פתרון PEI צריכה להיקבע באופן אמפירי. בידיים שלנו, את הכמות האופטימלית היא 0.12 μl של פתרון PEI לכל מיקרוגרם siRNA 1. </li><li style=";text-align:right;direction:rtl"> מערבבים את הפתרון עם הפתרון B בבת אחת, מערבולת בעדינות. </li><li style=";text-align:right;direction:rtl"> דגירה הפתרון המשולב ל15 דקות ב RT לפני השימוש. קומפלקס זה הוא יציב לשעה 2 ב RT ול24 שעות ב 4 ° C. </li></ol> 2. הזרקת intrathecal <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להרדים את העכבר עם isoflurane 3%, עד שהוא לא מראה סימנים של ליישר רפלקס. בנוסף, בדוק אם זנב ו / או רפלקס קמצוץ כפה על מנת להבטיח המצב של הרדמה נוספת. </li><li style=";text-align:right;direction:rtl"> לגלח סביב 2 סנטימטר 2 של פרווה בקצה האחורי של החיה ליד בסיס הזנב כדי להקל על ויזואליזציה טובה יותר במהלך החדרת מחט. </li><li style=";text-align:right;direction:rtl"> מקם את עכבר בחרטומו לממשל isoflurane המשיך במהלך ההליך, להפחית isoflurane 1.5%, ולכסות את עיניו של העכבר עם חומר סיכה העין. </li><li style=";text-align:right;direction:rtl"> הכן את מוכן לשימוש פתרון מעורב siRNA באמצעות 25 μl המילטון מזרק המצורף ל30 G 0.5 במחט. </li><li style=";text-align:right;direction:rtl"> אתר את תהליך spinous של L6, שאמורה להיות הבולט אחד ולתקן את עמודת חוליות באזור זה על ידי לחיצה עליו בעדינות. </li><li style=";text-align:right;direction:rtl"> בזהירות להכניס את המחט בין החריץ של L5 וL6 חוליות ולבחון לקפיצי זנב כסימן זה מצביע על כניסה מוצלחת של המחט בחלל intradural. טיפ: השימוש בציפורן, אחד צריך להיות מסוגל לאתר את הגרוב גם כן. </li><li style=";text-align:right;direction:rtl"> ברגע שהינף זנב הוא ציין, באופן מיידי, אבל בזהירות, להבטיח את מיקום המחט ביד אחת ולהזריק את הנפח הרצוי של חומר ביד השנייה באיטיות. טיפ: נפח בין 5-10 μl הוא אופטימלי כנפח פחות מ 5 &amp;181 #; l הוא לא אמין ונפח גדול יותר מ10 μl מוביל ליותר מדי לחץ. </li><li style=";text-align:right;direction:rtl"> ברגע שההזרקה מתבצעת, הזז את העכבר חזרה לכלוב להתאושש מהרדמה. </li><li style=";text-align:right;direction:rtl"> חזור על הפעולה הזרקה זה לפחות 2 יותר פעמים בכל שעה 24 להשיג downregulation האופטימלי של הגן הממוקד. </li></ol>

<ol>
	<li>Hylden, J. L., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrathecal+morphine+in+mice:+a+new+technique.">Intrathecal morphine in mice: a new technique.</a> Eur. J. Pharmacol. 67, 313-316 (1980).</li><li>Stokes, J. A., Corr, M., Yaksh, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+tactile+allodynia+following+intrathecal+puncture+in+mouse:+contributions+of+Toll-like+receptor+signaling.">Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling.</a> Neurosci. Lett. 504, 215-218 (2011).</li><li>Goula, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+intravenous+delivery+of+transgenes+to+mouse+lung.">Polyethylenimine-based intravenous delivery of transgenes to mouse lung.</a> Gene Ther. , 1291-1295 (1998).</li><li>Fairbanks, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+delivery+of+analgesics+in+experimental+models+of+pain+and+analgesia.">Spinal delivery of analgesics in experimental models of pain and analgesia.</a> Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).</li><li>Hohmann, A. G., Tsou, K., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cannabinoid+modulation+of+wide+dynamic+range+neurons+in+the+lumbar+dorsal+horn+of+the+rat+by+spinally+administered+WIN55,212-2.">Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2.</a> Neurosci. Lett. 257, 119-122 (1998).</li><li>Song, Z. H., Takemori, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+spinal+kappa+opioid+receptors+in+the+antinociception+produced+by+intrathecally+administered+corticotropin-releasing+factor+in+mice.">Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice.</a> J. Pharmacol. Exp. Ther. 254, 363-368 (1990).</li><li>Trang, T., Sutak, M., Jhamandas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+cannabinoid+(CB1)-receptors+in+the+development+and+maintenance+of+opioid+tolerance.">Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance.</a> Neuroscience. , 1275-1288 (2007).</li><li>Yaksh, T. L., Rudy, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chronic+catheterization+of+the+spinal+subarachnoid+space.">Chronic catheterization of the spinal subarachnoid space.</a> Physiol. Behav. 17, 1031-1036 (1976).</li><li>Tappe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+scaffolding+protein+Homer1a+protects+against+chronic+inflammatory+pain.">Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain.</a> Nat. Med. , 677-681 (2006).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+Cav3.2+T-type+calcium+channel+gene+in+sensory+neurons+demonstrates+its+major+role+in+nociception.">Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.</a> EMBO J. 24, 315-324 (2005).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+to+dorsal+root+ganglia+by+intrathecal+injection:+effects+on+regeneration+of+peripheral+nerves.">Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves.</a> Mol. Ther. 12, 314-320 (2005).</li><li>Wigdor, S., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+and+systemic+morphine-induced+antinociception+in+mice:+contribution+of+descending+serotonergic+and+noradrenergic+pathways.">Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways.</a> J. Pharmacol. Exp. Ther. 242, 90-95 (1987).</li></ol>

המחברים מצהירים שום אינטרסים כלכליים מתחרים.

לכן, השיטה שתואר לעיל של זריקות מחט intrathecal היא יעילה, מהירה, במיוחד-מקומי, ולא הורסות. מבחינה טכנית, ההיבט הקריטי ביותר של הליך זה הוא נקודת החדרת מחט לתוך החריץ. זה חיוני כי הליך זה נעשה עם ידיים וסבלנות מאוד רגועות. כמו רבים הליכים כירורגיים, אימון משפר את קצב הזריקה מו...

חוט השדרה הוא מרכז חשוב מאוד במגוון רחב של תהליכים ביולוגיים מרכזיים ופונקציות פיסיולוגיות, לרבות עיבוד והעברה של תשומות כואבות (nociceptive) 4-7. ניסיוני בטכניקות שונות פותחו כדי להקל על אפנון תרופתי של חוט השדרה, כגון השתלה כרונית של צנתרים intrathecal 8, microinjection חוט השדרה, והזרקת מחט intrathecal 9. לכל אחד יש טכניקת יתרונות משלה וחסרונות, ובהתאם לפרדיגמה ניסוי טכניקה אחת יכולה להיות מתאימה יותר מאשר לאחרים. ואילו השתלה כרונית של צנתרים intrathecal אינה ריאלי בקלות בחולדה, בשיטה זו קשה מאוד בעכבר, בהתחשב במגבלות גודל. שיעור הצלחה הוא נמוך מאוד וליקויים מוטוריים מתרחשים לעתים קרובות בשל נוכחותם מגושמת של קטטר בחלל subdural מוגבל קשות בעכבר. יתר על כן, מסירה ארוכת טווח של תרופות שניתנו עקב קרישה תכופהשל כרוני מושתל צנתרים. לבסוף, תגובות חיסוניים נפוצות. ניתן לעקוף בעיות אלה תוך שימוש בשיטה של הזרקת intrathecal האקוטית באמצעות מחט בהעדר קטטר preimplanted, המאפשר יישום מהיר ואנטומית מוגבל של תרופות וחומרים כימיים למייתרי השדרה בעכברים. שיטה זו שומרת באופן מלא את היתרונות של משלוח intrathecal על פני מסלולים אחרים מערכתיים משלוח (לדוגמא: דרך הפה, דרך הווריד, החדרה לקרום בטן, וכו &#39;) כגון הספציפיות של אפנון בעמוד השדרה, המאפשר מינונים מופחתים ותופעות לוואי גבול, כמו גם יכולת לספק חומרים לא בדרך כלל לא חוצה את מחסום דם במוח מאז במהלך הזרקת intrathecal, המחט מוחדרת בין מאטר הדורה וחוט השדרה. חשוב לציין עם זאת, בהשוואה לשיטות אחרות של משלוח intrathecal, שיטת הזרקת מחט intrathecal היא פחות פולשנית, המאפשר יישומים רביםאותו בעל חיים מבלי לגרום כל נזק לרקמות משמעותיות או לעורר תגובה חיסונית עקב השתלה של חומר זר. עם זאת, זה דורש מיומנות טכנית למיקוד מדויק מאוד של המחט על מנת לאפשר יעילות. הנה, אנחנו מבחינה ויזואלית להדגים את השיטה להשגת שיעור אופטימלי של הצלחה עבור במיוחד מיקוד בעמוד השדרה המותני. אתר הזרקה שנבחרה בניסוי הזה הוא החריץ בין L5 והעמודה L6 חוליות, סמוך למקום שבי חוט השדרה מסתיים, כדי למזער את האפשרות של פגיעה בעמוד השדרה. יתר על כן, אנחנו מדגימים את השימוש בטכניקה זו כדי להפיל גנים בחוט השדרה באמצעות siRNAs.

<table><tbody><tr><td>&lt;em&gt;In Vivo&lt;/em&gt;-jetPEI</td><td>Polyplus</td><td>201-10G</td><td>&amp;nbsp;</td></tr><tr><td>WAVE1 siRNA</td><td>Santa Cruz</td><td>sc-36832</td><td>&amp;nbsp;</td></tr><tr><td>Control siRNA-A</td><td>Santa Cruz</td><td>sc-37007</td><td>&amp;nbsp;</td></tr><tr><td>Anti-&amp;szlig;-Tubulin III antibody</td><td>Sigma</td><td>T2200</td><td>&amp;nbsp;</td></tr><tr><td>Anti-WAVE1 antibody</td><td>R&amp;amp;D Systems</td><td>AF5514</td><td>&amp;nbsp;</td></tr><tr><td>Fast green dye</td><td>Sigma</td><td>F-7252</td><td>&amp;nbsp;</td></tr><tr><td>Isoflurane</td><td>Baxter</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Isoflurane setup</td><td>Dr&amp;auml;ger L&amp;uuml;beck</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Shaver</td><td>Wella</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Hamilton syringe Gastight 1702</td><td>Hamilton</td><td></td><td>&amp;nbsp;</td></tr><tr><td>30 G 1/2 in 13 mm Needle</td><td>BD Microlance</td><td>304000</td><td>&amp;nbsp;</td></tr><tr><td>Microscope Leica MS5</td><td>Leica</td><td></td><td>&amp;nbsp;</td></tr><tr><td>WAVE1 forward primer for qRT-PCR</td><td>Sigma</td><td></td><td>cacagagcctcaggacagg</td></tr><tr><td>WAVE1 reversed primer for qRT-PCR</td><td>Sigma</td><td></td><td>cttttcaccaacggcatctt</td></tr><tr><td>FastStart Essential DNA Green Master</td><td>Roche</td><td>6402712001</td><td>&amp;nbsp;</td></tr></tbody></table>

in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice

דו&quot;ח זה מתאר את מדריך צעד אחר צעד לטכניקה של הזרקות מחט intrathecal חריפות בצורה לא פולשנית, כלומר העצמאית של השתלת קטטר. המגבלה הטכנית של טכניקה ניתוחית זו נעוצה בעידון של הידיים. הזריקה היא מהירה, במיוחד עבור הנסיין מיומן, וכן שיבוש רקמות עם טכניקה זו הוא מינימאלי, זריקות חוזרות ונשנות אפשריות; תגובת יתר על כן חיסון לכלים זרים (. למשל קטטר) אינה מתרחשת, ובכך נותנת ספציפי טוב יותר ויותר לקרוא את של אפנון חוט השדרה. מאז היישום של החומר מוגבל במידה רבה לאזור היעד של חוט השדרה, תרופות לא צריכה להיות מיושמות במינונים גדולים, ואת השפעות חשוב יותר לא רצויות ברקמות אחרות, כפי שנצפתה עם משלוח מערכתי, יכולה לעקוף 1, 2. יתר על כן, אנו משלבים בטכניקה זו עם transfection vivo של חומצות גרעין בעזרת polyethylenimine (PEI) מגיב 3, המספק גמישות עצומה ללימוד פונקציות השדרה באמצעות משלוח של סוכנים תרופתיים כמו גם גנים, RNA, ומאפנני חלבון.

<html> כדי להמחיש זריקה מוצלחת, ביצענו בטכניקה זו משתמשת בצבע מהיר גרין FCF בעכברי C57BL6 מבוגר (8-10 שבועות של גיל). בעלי החיים הורשו להתאושש במשך כמה דקות לאחר ההזרקה על מנת לספק מספיק זמן לצבע להתפשט ולאחר מכן נהרג עם מנת יתר של CO 2. בהמשך לכך, בעמודת החוליות הייתה גזור וא...

Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

דו&quot;ח זה מתאר טכניקה פשוטה ומהירה של נקב מחט intrathecal עבור transfection מקומי של siRNA בחוט השדרה המותני בעכבר תחת הרדמה קצרה אור בר קיימא.

בVivo siRNA Transfection וג&#39;ין מציאה בחוט השדרה באמצעות ראפיד פולשנית מותני intrathecal זריקות בעכברים

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter ...

in-vivo-sirna-transfection-gene-knockdown-spinal-cord-via-rapid

Research

JoVE Journal

Biology

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

46.5K Views.  University of Heidelberg.  דו"ח זה מתאר טכניקה פשוטה ומהירה של נקב מחט intrathecal עבור transfection מקומי של siRNA בחוט השדרה המותני בעכבר תחת הרדמה קצרה אור בר קיימא. 

Video: In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

In vivo Imaging of the Mouse Spinal Cord Using Two-photon Microscopy

In vivo imaging using two-photon microscopy 1 in mice that have been genetically engineered to express fluorescent proteins in specific cell types 2-3 has significantly broadened our knowledge of physiological and pathological processes in numerous tissues in vivo 4-7. In studies of the central nervous system (CNS), there has been a broad application of in vivo imaging in the brain, which has produced a plethora of novel and often unexpected findings about the behavior of cells such as neurons, astrocytes, microglia, under physiological or pathological conditions 8-17. However, mostly technical complications have limited the implementation of in vivo imaging in studies of the living mouse spinal cord. In particular, the anatomical proximity of the spinal cord to the lungs and heart generates significant movement artifact that makes imaging the living spinal cord a challenging task.
We developed a novel method that overcomes the inherent limitations of spinal cord imaging by stabilizing the spinal column, reducing respiratory-induced movements and thereby facilitating the use of two-photon microscopy to image the mouse spinal cord in vivo. This is achieved by combining a customized spinal stabilization device with a method of deep anesthesia, resulting in a significant reduction of respiratory-induced movements. This video protocol shows how to expose a small area of the living spinal cord that can be maintained under stable physiological conditions over extended periods of time by keeping tissue injury and bleeding to a minimum. Representative raw images acquired in vivo detail in high resolution the close relationship between microglia and the vasculature. A timelapse sequence shows the dynamic behavior of microglial processes in the living mouse spinal cord. Moreover, a continuous scan of the same z-frame demonstrates the outstanding stability that this method can achieve to generate stacks of images and/or timelapse movies that do not require image alignment post-acquisition. Finally, we show how this method can be used to revisit and reimage the same area of the spinal cord at later timepoints, allowing for longitudinal studies of ongoing physiological or pathological processes in vivo.

In vivo Imaging of the Mouse Spinal Cord Using Two-photon Microscopy

A minimally invasive protocol to stabilize the mouse spinal column and perform repetitive in vivo spinal cord imaging using two-photon microscopy is described. This method combines a spinal stabilization device and an anesthetic regimen to minimize respiratory-induced movements and produce raw imaging data that require no alignment or other post-processing.

בתחום ההדמיה vivo של חוט השדרה בעזרת עכבר דו פוטון מיקרוסקופית

In vivo imaging using two-photon microscopy 1 in mice that have been genetically engineered to express fluorescent proteins in specific cell types 2-3 has ...

Neuroscience

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central nervous system. We demonstrate a stereotaxic injection technique that allows targeted gene expression or silencing in the dorsal horn of the mouse spinal cord. The surgical procedure is brief. It requires laminectomy of a single vertebra, providing for quick recovery of the animal and unimpaired motility of the spine. Controlled injection of a small vector suspension volume at low speed and use of a microsyringe with beveled glass cannula minimize the tissue lesion. The local immune response to the vector depends on the intrinsic properties of the virus employed; in our experience, it is minor and short-lived when a recombinant adeno-associated virus is used. A reporter gene such as enhanced green fluorescent protein facilitates monitoring spatial distribution of the vector, and the efficacy and cellular specificity of the transfection.

Viral vectors allow for targeted gene manipulation. We demonstrate a method for conditional gene expression or ablation in the mouse spinal cord, using stereotaxic injection of a viral vector into the dorsal horn, a prominent site of synaptic contact between primary somatosensory afferents and neurons of the central nervous system.

הזרקת Stereotaxic של וקטור ויראלי למניפולציה גנטית מותנית בחוט השדרה המאוס

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central ...

<meta charset="utf8"></head><body>פיתוח מודל עכבר יעיל ומדויק לגליומה של חוט השדרה

Surgical Transplantation of Tumor Cells into the Spinal Cord of Mice

Spinal cord gliomas are commonly malignant tumors of the spinal cord, leading to a high rate of disability. However, uniform treatment guidelines and comprehensive data on spinal cord gliomas remain limited due to the lack of suitable preclinical animal models. Developing a simple and reproducible animal model has become essential for advancing basic and translational research. A murine model is ideal, as the murine spinal cord shares structural similarities with the human spinal cord. This protocol describes the generation of a reproducible murine model of spinal cord glioma by directly injecting tumor cells into the intervertebral space using the spinous process of the seventh cervical vertebra as a guide. Compared to other methods, this approach is more effective and convenient, involving a smaller incision, reduced invasiveness and blood loss, faster recovery, and more stable tumor formation. This model is expected to advance the understanding of disease mechanisms, optimize surgical strategies, and support the development of therapeutic drugs for spinal cord gliomas.

<meta charset="utf8"></head><body>השתלה כירורגית של תאי גידול בחוט השדרה של עכברים

The present protocol describes the development of a reproducible murine model of spinal cord glioma by injecting tumor cells into the intervertebral space, offering a more effective and less invasive approach for research and therapeutic development.

השתלה כירורגית של תאי גידול בחוט השדרה של עכברים

Spinal cord gliomas are commonly malignant tumors of the spinal cord, leading to a high rate of disability. However, uniform treatment guidelines and ...

Cancer Research

In Vivo Gene Transfer to Schwann Cells in the Rodent Sciatic Nerve by Electroporation

The formation of the myelin sheath by Schwann cells (SCs) is essential for rapid conduction of nerve impulses along axons in the peripheral nervous system. SC-selective genetic manipulation in living animals is a powerful technique for studying the molecular and cellular mechanisms of SC myelination and demyelination in vivo. While knockout/knockin and transgenic mice are powerful tools for studying SC biology, these methods are costly and time consuming. Viral vector-mediated transgene introduction into the sciatic nerve is a simpler and less laborious method. However, viral methods have limitations, such as toxicity, transgene size constraints, and infectivity restricted to certain developmental stages. Here, we describe a new method that allows selective transfection of myelinating SCs in the rodent sciatic nerve using electroporation. By applying electric pulses to the sciatic nerve at the site of plasmid DNA injection, genes of interest can be easily silenced or overexpressed in SCs in both neonatal and more mature animals. Furthermore, this in vivo electroporation method allows for highly efficient simultaneous expression of multiple transgenes. Our novel technique should enable researchers to efficiently manipulate SC gene expression, and facilitate studies on SC development and function.

In Vivo Gene Transfer to Schwann Cells in the Rodent Sciatic Nerve by Electroporation

Here, we present an in vivo technique for gene transfer to Schwann cells (SCs) in the rodent sciatic nerve. This simple technique is useful for investigating signaling mechanisms involved in the development and maintenance of myelinating SCs.

In vivo ג&#39;ין העברה בתאי שוואן בעצב מכרסמים Sciatic ידי Electroporation

The formation of the myelin sheath by Schwann cells (SCs) is essential for rapid conduction of nerve impulses along axons in the peripheral nervous ...

Adeno-associated Virus-mediated Transgene Expression in Genetically Defined Neurons of the Spinal Cord

Selective manipulation of spinal neuronal subpopulations has mainly been achieved by two different methods: 1) Intersectional genetics, whereby double or triple transgenic mice are generated in order to achieve selective expression of a reporter or effector gene (e.g., from the Rosa26 locus) in the desired spinal population. 2) Intraspinal injection of Cre-dependent recombinant adeno-associated virus (rAAV); here Cre-dependent AAV vectors coding for the reporter or effector gene of choice are injected into the spinal cord of mice expressing Cre recombinase in the desired neuronal subpopulation. This protocol describes how to generate Cre-dependent rAAV vectors and how to transduce neurons in the dorsal horn of the lumbar spinal cord segments L3-L5 with rAAVs. As the lumbar spinal segments L3-L5 are innervated by those peripheral sensory neurons that transmit sensory information from the hindlimbs, spontaneous behavior and responses to sensory tests applied to the hindlimb ipsilateral to the injection side can be analyzed in order to interrogate the function of the manipulated neurons in sensory processing. We provide examples of how this technique can be used to analyze genetically defined subsets of spinal neurons. The main advantages of virus-mediated transgene expression in Cre transgenic mice compared to classical reporter mouse-induced transgene expression are the following: 1) Different Cre-dependent rAAVs encoding various reporter or effector proteins can be injected into a single Cre transgenic line, thus overcoming the need to create several multiple transgenic mouse lines. 2) Intraspinal injection limits manipulation of Cre-expressing cells to the injection site and to the time after injection. The main disadvantages are: 1) Reporter gene expression from rAAVs is more variable. 2) Surgery is required to transduce the spinal neurons of interest. Which of the two methods is more appropriate depends on the neuron population and research question to be addressed.

Intraspinal injection of recombinase dependent recombinant adeno-associated virus (rAAV) can be used to manipulate any genetically labelled cell type in the spinal cord. Here we describe how to transduce neurons in the dorsal horn of the lumbar spinal cord. This technique enables functional interrogation of the manipulated neuron subtype.

הביטוי Adeno-הקשורים Transgene וירוס בתיווך בנוירונים מבחינה גנטית מוגדרים של חוט השדרה

Selective manipulation of spinal neuronal subpopulations has mainly been achieved by two different methods: 1) Intersectional genetics, whereby double or ...

Direct Intrathecal Injection of Recombinant Adeno-associated Viruses in Adult Mice

Intrathecal (IT) injection of adeno-associated virus (AAV) has drawn considerable interest in CNS gene therapy by virtue of its safety, noninvasiveness, and excellent transduction efficacy in the CNS.&#160;Previous studies have demonstrated the therapeutic potency of AAV-delivered gene therapy in neurodegenerative disorders by IT administration. However, high rates of unpredictable failure due to the technical limitation of IT administration in small animals have been reported. Here, we established a scoring system to indicate the success extent of lumbar puncture in small animals by adding 1% lidocaine hydrochloride into the injection solution. We further show that the extent of transient weakness following injection can predict the transduction efficiency of AAV. Thus, this IT injection method can be used to optimize therapeutic trials in mouse models of CNS diseases that afflict wide regions of the CNS.

Here we present a direct intrathecal injection technique using 1% lidocaine hydrochloride in a viral solution to ensure efficient adeno-associated virus delivery to small animals and establish a scoring system to predict transduction efficiency in the central nervous system according to the degree of transient weakness induced by lidocaine.

במחלה ישירה הזרקה של וירוסים Adeno-הקשורים רקומביננטי בעכברים מבוגרים

Intrathecal (IT) injection of adeno-associated virus (AAV) has drawn considerable interest in CNS gene therapy by virtue of its safety, noninvasiveness, ...

Direct Injection of a Lentiviral Vector Highlights Multiple Motor Pathways in the Rat Spinal Cord

Introducing proteins of interest into cells in the nervous system is challenging due to innate biological barriers that limit access to most molecules. Injection directly into spinal cord tissue bypasses these barriers, providing access to cell bodies or synapses where molecules can be incorporated. Combining viral vector technology with this method allows for introduction of target genes into nervous tissue for the purpose of gene therapy or tract tracing. Here a virus engineered for highly efficient retrograde transport (HiRet) is introduced at the synapses of propriospinal interneurons (PNs) to encourage specific transport to neurons in the spinal cord and brainstem nuclei. Targeting PNs takes advantage of the numerous connections they receive from motor pathways such as the rubrospinal and reticulospinal tracts, as well as their interconnection with each other throughout spinal cord segments. Representative tracing using the HiRet vector with constitutively active green fluorescent protein (GFP) shows high fidelity details of cell bodies, axons and dendritic arbors in thoracic PNs and in reticulospinal neurons in the pontine reticular formation. HiRet incorporates well into brainstem pathways and PNs but shows age dependent integration into corticospinal tract neurons. In summary, spinal cord injection using viral vectors is a suitable method for introduction of proteins of interest into neurons of targeted tracts.

This protocol demonstrates injection of a retrogradely transportable viral vector into rat spinal cord tissue. The vector is taken up at the synapse and transported to the cell body of target neurons. This model is suitable for retrograde tracing of important spinal pathways or targeting cells for gene therapy applications.

הזרקה ישירה של וקטור Lentiviral מדגיש מספר מסלולים מוטוריים בחוט השדרה עכברוש

Introducing proteins of interest into cells in the nervous system is challenging due to innate biological barriers that limit access to most molecules. ...

Intrathecal Delivery of Antisense Oligonucleotides in the Rat Central Nervous System

The blood brain barrier (BBB) is an important defense against the entrance of potentially toxic or pathogenic agents from the blood into the central nervous system (CNS). However, its existence also dramatically lowers the accessibility of systemically administered therapeutic agents to the CNS. One method to overcome this, is to inject those agents directly into the cerebrospinal fluid (CSF), thus bypassing the BBB. This can be done via implantation of a catheter for either continuous infusion using an osmotic pump, or for single bolus delivery. In this article, we describe a surgical protocol for delivery of CNS-targeting antisense oligonucleotides (ASOs) via a catheter implanted directly into the cauda equina space of the adult rat spine. As representative results, we show the efficacy of a single bolus ASO intrathecal (IT) injection via this catheterization system in knocking down the target RNA in different regions of the rat CNS. The procedure is safe, effective and does not require expensive equipment or surgical tools. The technique described here can be adapted to deliver drugs in other modalities as well.

Here, we describe a method for delivering drugs to the rat central nervous system by implanting a catheter into the lumbar intrathecal space of the spine. We focus on the delivery of antisense oligonucleotides, though this method is suitable for delivery of other therapeutic modalities as well.

משלוח פנימי של אנטי-סנס וליגונו, במערכת העצבים המרכזית של חולדה

The blood brain barrier (BBB) is an important defense against the entrance of potentially toxic or pathogenic agents from the blood into the central ...

בVivo siRNA Transfection וג'ין מציאה בחוט השדרה באמצעות ראפיד פולשנית מותני intrathecal זריקות בעכברים

Summary

Explore More Videos

בתחום ההדמיה vivo של חוט השדרה בעזרת עכבר דו פוטון מיקרוסקופית

הזרקת Stereotaxic של וקטור ויראלי למניפולציה גנטית מותנית בחוט השדרה המאוס

השתלה כירורגית של תאי גידול בחוט השדרה של עכברים

השתלה כירורגית של תאי גידול בחוט השדרה של עכברים

השתלה כירורגית של תאי גידול בחוט השדרה של עכברים

In vivo ג'ין העברה בתאי שוואן בעצב מכרסמים Sciatic ידי Electroporation

הביטוי Adeno-הקשורים Transgene וירוס בתיווך בנוירונים מבחינה גנטית מוגדרים של חוט השדרה

במחלה ישירה הזרקה של וירוסים Adeno-הקשורים רקומביננטי בעכברים מבוגרים

הזרקה ישירה של וקטור Lentiviral מדגיש מספר מסלולים מוטוריים בחוט השדרה עכברוש

משלוח פנימי של אנטי-סנס וליגונו, במערכת העצבים המרכזית של חולדה