모든 동물의 사용 절차는 지역 관​​리기구 (Regierungspräsidium 카를 스루에, 카를 스루에, 독일)가 정한 윤리 지침에 따라했다. 1. 의 siRNA / PEI 단지의 제조 의 siRNA / PEI 복잡한 솔루션은 다음과 같은 제조 업체의 지침을 사용하여 제조된다 : <ol><li> 용액 A : 최종 부피의 분기까지 멸균 수있는 siRNA를 원하는 양 (필요한 경우)을 희석하고 최종 부피의 절반을 10 % 글루코스 용액쪽으로 추가로 이것을 희석. 소용돌이 부드럽게 아래로 pipetting에 의해 혼합. siRNA를 최적의 금액은 경험적으로 결정해야하지만, 동물 당 10 ㎕의 복잡한 솔루션에서 1 μg의 siRNA는 최적화를위한 좋은 출발점이 될 것입니다. </li><li> 용액 B : 최종 부피의 쿼터 멸균 위로 PEI 시약의 필요한 부피를 희석시켜 최종 용적의 절반 10 % 글루코스 용액쪽으로이 더욱 희석. 소용돌이 GEntly 아래로 pipetting에 의해 혼합. 참고 : PEI 시약의 양은 형질의 효율에 영향을 복잡 이온 밸런스를 결정한다. 마찬가지로 PEI 용액의 최적 량은 경험적으로 결정되어야한다. 우리 손에, 최적 량은 1 μg의 siRNA 당 PEI 솔루션의 0.12 μL입니다. </li><li> 솔루션 B와 용액을 혼합 한 번에, 소용돌이 부드럽게. </li><li> 사용하기 전에 실온에서 15 분 동안 혼합 용액을 품어. 이 단지는 4 ℃에서 실온에서 2 시간 동안 24 시간 동안 안정 </li></ol> 2. 척수강 내 주입 <ol><li> 이 반사 보상하기의 흔적을 보여줍니다 때까지, 3 % 이소 플루 란으로 마우스를 마취. 또한, 추가로 마취의 상태를 확인하기 위해 꼬리 및 / 또는 발 핀치 반사를 확인합니다. </li><li> 니들 삽입하는 동안 더 나은 시각화를 용이하게하기 위해 꼬리의 기부 근처 동물의 후방 단부에 퍼 작성된 2cm이 쉐이브. </li><li> 에 마우스를 놓고절차를 수행하는 동안 계속 이소 플루 란 관리를위한 코 콘, 1.5 %로 이소 플루 란을 감소시키고, 눈의 윤활유와 마우스의 눈을 포함한다. </li><li> 바늘에 30 G 0.5에 부착 된 25 μL 해밀턴 주사기를 사용하여 siRNA의 혼합 용액을 사용하도록 준비를 준비합니다. </li><li> 가장 눈에 띄는 하나가 조심스럽게 눌러이 주변 척추 열을 수정해야 L6의 극돌기를 찾습니다. </li><li> 조심스럽게 L5와 L6 척추의 홈 사이에 바늘을 삽입하고이 기​​호가 막내 공간에서 바늘의 성공적인 진입을 표시로 꼬리 영화에 대한 관찰. 팁 : 손톱을 사용하여 한 번뿐만 아니라 그루브를 찾을 수 있어야한다. </li><li> 테일 플릭이 관찰되면, 즉시, 그러나 정중 한 손으로 바늘의 위치를​​ 고정하고 다른 손으로 천천히 물질의 원하는 양을 주입. 팁 : 5-10 사이의 볼륨이 μL 볼륨 5 이하로 최적 &amp;# 181; 난 신뢰할 수 10 μL보다 더 큰 볼륨이 너무 많은 압력에 이르게한다. </li><li> 분사가 수행되면, 마취에서 회복하기 위해 케이지에 다시 마우스를 이동합니다. </li><li> 대상 유전자의 최적의 하향 조절을 달성하기 위해이 주사 최소 2 번 이상 매일 24 시간을 반복합니다. </li></ol>

<ol>
	<li>Hylden, J. L., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrathecal+morphine+in+mice:+a+new+technique.">Intrathecal morphine in mice: a new technique.</a> Eur. J. Pharmacol. 67, 313-316 (1980).</li><li>Stokes, J. A., Corr, M., Yaksh, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+tactile+allodynia+following+intrathecal+puncture+in+mouse:+contributions+of+Toll-like+receptor+signaling.">Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling.</a> Neurosci. Lett. 504, 215-218 (2011).</li><li>Goula, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+intravenous+delivery+of+transgenes+to+mouse+lung.">Polyethylenimine-based intravenous delivery of transgenes to mouse lung.</a> Gene Ther. , 1291-1295 (1998).</li><li>Fairbanks, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+delivery+of+analgesics+in+experimental+models+of+pain+and+analgesia.">Spinal delivery of analgesics in experimental models of pain and analgesia.</a> Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).</li><li>Hohmann, A. G., Tsou, K., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cannabinoid+modulation+of+wide+dynamic+range+neurons+in+the+lumbar+dorsal+horn+of+the+rat+by+spinally+administered+WIN55,212-2.">Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2.</a> Neurosci. Lett. 257, 119-122 (1998).</li><li>Song, Z. H., Takemori, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+spinal+kappa+opioid+receptors+in+the+antinociception+produced+by+intrathecally+administered+corticotropin-releasing+factor+in+mice.">Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice.</a> J. Pharmacol. Exp. Ther. 254, 363-368 (1990).</li><li>Trang, T., Sutak, M., Jhamandas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+cannabinoid+(CB1)-receptors+in+the+development+and+maintenance+of+opioid+tolerance.">Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance.</a> Neuroscience. , 1275-1288 (2007).</li><li>Yaksh, T. L., Rudy, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chronic+catheterization+of+the+spinal+subarachnoid+space.">Chronic catheterization of the spinal subarachnoid space.</a> Physiol. Behav. 17, 1031-1036 (1976).</li><li>Tappe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+scaffolding+protein+Homer1a+protects+against+chronic+inflammatory+pain.">Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain.</a> Nat. Med. , 677-681 (2006).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+Cav3.2+T-type+calcium+channel+gene+in+sensory+neurons+demonstrates+its+major+role+in+nociception.">Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.</a> EMBO J. 24, 315-324 (2005).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+to+dorsal+root+ganglia+by+intrathecal+injection:+effects+on+regeneration+of+peripheral+nerves.">Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves.</a> Mol. Ther. 12, 314-320 (2005).</li><li>Wigdor, S., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+and+systemic+morphine-induced+antinociception+in+mice:+contribution+of+descending+serotonergic+and+noradrenergic+pathways.">Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways.</a> J. Pharmacol. Exp. Ther. 242, 90-95 (1987).</li></ol>

저자는 더 경쟁 재정적 이익을 선언하지 않습니다.

따라서, 경 막내 주사 바늘의 상술 기법은 효과적 빠르고 구체적 지역화 및 비파괴이다. 기술적으로,이 절차의 가장 중요한 측면은 홈에 바늘 삽입의 포인트입니다. 그것은이 절차는 매우 침착 손과 인내심을 가지고 수행하는 것이 중요합니다. 많은 수술과 마찬가지로 훈련은 성공적으로 주입의 속도를 향상시킵니다. 실제의 실험 기간 동안,이 방법은 직접 주입이 성공인지 아닌지 확인하는 명백...

척수 처리 및 통증 (통각) 입력 4-7의 전송 등 주요 생물 학적 과정과 생리 기능의 다양한 매우 중요한 중심지입니다. 다양한 실험 기술들은 척수강 내 카테터 13의 주입 만성 척수 마이크로 인젝션, 및 경 막내 주사 바늘 15 등의 척수의 약리학 적 변조를 용이하게하기 위해 개발되어왔다. 각각의 기술은 자신의 장점과 단점을 가지고 있으며, 실험 패러다임에 따라 하나의 기술은 다른 사람보다 더 적합 할 수 있습니다. 척수강 내 카테터의 만성 주입 쥐에서 쉽게 가능한 반면,이 방법은 크기 제한 주어진 마우스에 매우 어렵습니다. 성공률은 매우 낮은 모터 적자 인해 종종 마우스에서 심각하게 제한 경막 하 공간에 카테터의 부피가 큰 존재로 발생합니다. 또한, 약물의 장기로 인해 납기가 자주 응고에 렌더링만성적으로 카테터를 주입. 마지막으로, 면역 반응이 일반적이다. 이러한 문제는 생쥐의 척수에 약물 및 시약의 빠르고 해부학 제한된 애플리케이션을 가능 preimplanted 카테터의 부재에서 바늘을 통해 급성 경 막내 주입 방법을 사용하여 회피 될 수있다. 이 방법은 완전히 같은 척추 감소 투여 량 및 제한 부작용을 허용 변조뿐만 아니라 물질 그렇지 전달 능력의 특이성 등의 전신 전달 경로 (예 : 경구, 정맥 내, 복강 내 등) 위에 경 막내 전달의 장점을 유지 척수강 내 주입하는 동안 바늘이 경막과 척추 사이에 삽입되어 있기 때문에 일반적으로 혈액 뇌 장벽을 통과하지 않습니다. 중요한 그러나, 경 막내 대금의 다른 방법에 비해, 척수강 내 바늘 주입 방법은 수많은 응용을 허용 최소 침습어떤 상당한 조직 손상을 일으키는 원인이 나 때문에 이물질의 주입에 면역 반응을 불러 일으키는없이 같은 동물. 그러나, 효능을 허용하는 바늘의 매우 정확한 타겟팅에 대한 기술 능력을 필요로한다. 여기, 우리는 시각적으로 구체적으로 요추 척수를 대상에 대한 성공의 최적의 속도를 달성하기위한 방법을 보여줍니다. 이 실험에서 선택 주사 부위는 L5 척추의 손상의 가능성을 최소화하기 척수 끝나는 곳에 가까운 L6 척추 칼럼 사이의 홈이다. 또한, 우리는 siRNA를을 사용하여 척수 유전자를 노크하는이 기술을 사용하는 방법을 보여줍니다.

<table border="0" cellpadding="0" cellspacing="0" width="1012">
	<colgroup>
		<col /> 
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:283px;">in vivo-jetPEI</td>
			<td style="width:255px;">Polyplus</td>
			<td style="width:288px;">201-10G</td>
			<td style="width:188px;"> </td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 siRNA</td>
			<td>Santa Cruz</td>
			<td>sc-36832</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Control siRNA-A</td>
			<td>Santa Cruz</td>
			<td>sc-37007</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-&#223;-Tubulin III antibody</td>
			<td>Sigma</td>
			<td>T2200</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-WAVE1 antibody</td>
			<td>R&#38;D Systems</td>
			<td>AF5514</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fast green dye</td>
			<td>Sigma</td>
			<td>F-7252</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane</td>
			<td>Baxter</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane setup</td>
			<td>Dr&#228;ger L&#252;beck</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Shaver</td>
			<td>Wella</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Hamilton syringe Gastight 1702</td>
			<td>Hamilton</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">30G 1/2, 0,3 * 13mm Needle</td>
			<td>BD Microlance</td>
			<td>304000</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Microscope Leica MS5</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 forward primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cacagagcctcaggacagg</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 reversed primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cttttcaccaacggcatctt</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">FastStart Essential DNA Green Master</td>
			<td>Roche</td>
			<td>6402712001</td>
			<td></td>
		</tr>
	</tbody>
</table>

in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice

이 보고서는 비 침습적 인 방법으로 급성 경막 바늘 주사의 기술, 카테터 주입, 즉 독립적 인 방법을 단계별로 설명합니다. 이 수술 기법의 기술적 한계는 손의 기교에있다. 주입은 특히 숙련 된 실험자에 대한 신속하고,이 기술과 조직의 혼란을 최소화하기 때문에 반복 주사가 가능합니다; 외국 도구 또한 면역 반응 (. 예 카테 테르)는 발생하지 않습니다, 따라서 더 많은 특정를 읽기 제공 척수 변조. 물질의 응용이 크게 척수의 타깃 영역에 한정되기 때문에, 약물은 큰 투여 량에 적용될 필요가 없으며, 다른 조직에 더 중요하게 원치 않는 효과는, 전신 전달 관찰로, 1 피할 수 2. 또한, 우리는 polyethylenim의 도움으로 핵산의 생체 내 형질과이 기술을 결합오프라인 (PEI)되는 약물의 전달뿐만 아니라 유전자, RNA, 단백질 변조기를 통해 척추의 기능을 연구하는 엄청난 다양성을 제공 시약 3.

성공적인 주입을 예시하기 위해, 우리는 성인 C57BL6 마우스 패스트 그린 FCF 염료 (나이 8-10 주)를 이용하여이 기술을 수행. 동물은 염료 확산하고 CO 2의 과다로 사망 할 충분한 시간을 제공하기 위해 주입 후 몇 분 동안 회복시켰다. 이어서, 척추 칼럼을 해부하고, 척수가 노출되었다. 확산 염색에 대응 puncta에 청색이 주사 부위를 표시. 척수 손상의 흔적이 기술 (그림 1A)의 최소 ...

Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

이 보고서는 짧은 지속 가벼운 마취 쥐의 요추 척수의 siRNA의 지역화 된 형질에 대한 막내 바늘 구멍의 간단하고 빠른 방법을 설명합니다.

마우스의 빠른 비 침습 요추 경 막내 주사를 통해 생체 siRNA의 형질과 척수에있는 유전자 넉다운에

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter ...

in-vivo-sirna-transfection-gene-knockdown-spinal-cord-via-rapid

Research

JoVE Journal

Biology

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

46.0K 조회수.  University of Heidelberg.  이 보고서는 짧은 지속 가벼운 마취 쥐의 요추 척수의 siRNA의 지역화 된 형질에 대한 막내 바늘 구멍의 간단하고 빠른 방법을 설명합니다. 