Name: in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice
Uploaded: 2014-03-22T14:00:00.000+00:00
Duration: 5 min 24 s
Description: Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

Todos los procedimientos de uso de animales estaban en conformidad con las normas éticas establecidas por la Junta de Gobierno Local (Regierungspräsidium Karlsruhe, Karlsruhe, Alemania). 1. Preparación del Complejo siRNA / PEI La solución de complejo de ARNsi / PEI se prepara utilizando las instrucciones del fabricante de la siguiente manera: <ol><li> Solución A: Diluir la cantidad deseada de siRNA con agua estéril (si es necesario) hasta una cuarta parte del volumen final y diluir dicha adicionalmente con una solución de glucosa al 10% hasta la mitad del volumen final. Vortex o mezclar suavemente la pipeta hacia arriba y hacia abajo. La cantidad óptima de siRNA se debe determinar empíricamente pero 1 mg siRNA en 10 l solución compleja por animal es un buen punto de partida para la optimización. </li><li> Solución B: Diluir el volumen necesario de reactivo PEI con agua estéril hasta una cuarta parte del volumen final y diluir dicha adicionalmente con una solución de glucosa al 10% hasta la mitad del volumen final. Vortex gently o mezclar pipeteando arriba y abajo. Nota: la cantidad de reactivo de PEI determina el equilibrio iónico en el complejo que influye en la eficiencia de la transfección. Del mismo modo la cantidad óptima de solución de PEI tiene que ser determinada empíricamente. En nuestras manos, la cantidad óptima es de 0,12 l de solución de PEI por 1 g de siRNA. </li><li> Mezclar la solución A con la solución B a la vez, vórtice suavemente. </li><li> Incubar la solución se mezcló durante 15 min a temperatura ambiente antes de su uso. Este complejo es estable durante 2 horas a temperatura ambiente y durante 24 horas a 4 ° C. </li></ol> 2. La inyección intratecal <ol><li> Anestesiar el ratón con el 3% isoflurano, hasta que no muestra signos de reflejo de enderezamiento. Además, compruebe si hay cola y / o la pata pizca reflex para asegurar aún más el estado de anestesia. </li><li> Shave alrededor de 2 cm 2 de piel en el extremo posterior del animal cerca de la base de la cola para facilitar una mejor visualización durante la inserción de la aguja. </li><li> Coloque el ratón enun cono de la nariz para una administración continua isoflurano durante el procedimiento, a reducir el isoflurano al 1,5%, y cubrir los ojos del ratón con lubricante ocular. </li><li> Prepare la lista para su uso siRNA solución mixta utilizando una jeringa Hamilton de 25 l adjunto a un 30 G 0,5 en la aguja. </li><li> Busque la apófisis espinosa de la L6, que debería ser el más destacado y fijar la columna de la vertebrado alrededor de esta área presionando suavemente. </li><li> Inserte cuidadosamente la aguja entre la ranura de L5 y L6 vértebras y observar por un movimiento de la cola ya que este signo indica una entrada exitosa de la aguja en el espacio intradural. Consejo: El uso de la uña, uno debe ser capaz de localizar la ranura también. </li><li> Una vez que se observa movimiento de la cola, de inmediato, pero con cuidado, asegurar la posición de la aguja con una mano e inyectar el volumen deseado de la sustancia con la otra mano lentamente. Consejo: un volumen de entre 5-10 l es óptima ya que el volumen de menos de 5 y# 181; l es poco fiable y un volumen más grande que 10 l conduce a demasiada presión. </li><li> Una vez que se realiza la inyección, mover el ratón de nuevo a la jaula para recuperarse de la anestesia. </li><li> Repita este inyección de al menos 2 veces más cada 24 horas para lograr una óptima regulación a la baja del gen diana. </li></ol>

<ol>
	<li>Hylden, J. L., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrathecal+morphine+in+mice:+a+new+technique.">Intrathecal morphine in mice: a new technique.</a> Eur. J. Pharmacol. 67, 313-316 (1980).</li><li>Stokes, J. A., Corr, M., Yaksh, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+tactile+allodynia+following+intrathecal+puncture+in+mouse:+contributions+of+Toll-like+receptor+signaling.">Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling.</a> Neurosci. Lett. 504, 215-218 (2011).</li><li>Goula, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+intravenous+delivery+of+transgenes+to+mouse+lung.">Polyethylenimine-based intravenous delivery of transgenes to mouse lung.</a> Gene Ther. , 1291-1295 (1998).</li><li>Fairbanks, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+delivery+of+analgesics+in+experimental+models+of+pain+and+analgesia.">Spinal delivery of analgesics in experimental models of pain and analgesia.</a> Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).</li><li>Hohmann, A. G., Tsou, K., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cannabinoid+modulation+of+wide+dynamic+range+neurons+in+the+lumbar+dorsal+horn+of+the+rat+by+spinally+administered+WIN55,212-2.">Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2.</a> Neurosci. Lett. 257, 119-122 (1998).</li><li>Song, Z. H., Takemori, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+spinal+kappa+opioid+receptors+in+the+antinociception+produced+by+intrathecally+administered+corticotropin-releasing+factor+in+mice.">Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice.</a> J. Pharmacol. Exp. Ther. 254, 363-368 (1990).</li><li>Trang, T., Sutak, M., Jhamandas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+cannabinoid+(CB1)-receptors+in+the+development+and+maintenance+of+opioid+tolerance.">Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance.</a> Neuroscience. , 1275-1288 (2007).</li><li>Yaksh, T. L., Rudy, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chronic+catheterization+of+the+spinal+subarachnoid+space.">Chronic catheterization of the spinal subarachnoid space.</a> Physiol. Behav. 17, 1031-1036 (1976).</li><li>Tappe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+scaffolding+protein+Homer1a+protects+against+chronic+inflammatory+pain.">Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain.</a> Nat. Med. , 677-681 (2006).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+Cav3.2+T-type+calcium+channel+gene+in+sensory+neurons+demonstrates+its+major+role+in+nociception.">Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.</a> EMBO J. 24, 315-324 (2005).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+to+dorsal+root+ganglia+by+intrathecal+injection:+effects+on+regeneration+of+peripheral+nerves.">Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves.</a> Mol. Ther. 12, 314-320 (2005).</li><li>Wigdor, S., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+and+systemic+morphine-induced+antinociception+in+mice:+contribution+of+descending+serotonergic+and+noradrenergic+pathways.">Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways.</a> J. Pharmacol. Exp. Ther. 242, 90-95 (1987).</li></ol>

Los autores declaran no tener intereses financieros en competencia.

Por lo tanto, la técnica de inyecciones intratecales de aguja anteriormente descrito es eficaz, rápido, específicamente localizada-, y no destructiva. Técnicamente, el aspecto más crítico de este procedimiento es el punto de inserción de la aguja en el surco. Es crucial que este procedimiento se realiza con las manos muy tranquilas y paciencia. Como muchos procedimientos quirúrgicos, la formación mejora la tasa de éxito de la inyección. Esto también es importante porque durante un experimento real, esta téc...

La médula espinal es un centro muy importante en una variedad de procesos biológicos fundamentales y funciones fisiológicas, incluyendo el procesamiento y la transmisión de entradas dolorosas (nociceptivo) 4-7. Diversas técnicas experimentales se han desarrollado para facilitar la modulación farmacológica de la médula espinal, tales como la implantación crónica de catéteres intratecales 8, la microinyección de la médula espinal, intratecal y la aguja de inyección 9. Cada técnica tiene sus propias ventajas y desventajas, y dependiendo del paradigma experimento Una técnica podría ser más adecuado que los otros. Considerando que la implantación crónica de los catéteres intratecales es fácilmente factible en la rata, este método es muy difícil en el ratón, dadas las restricciones de tamaño. El índice de éxito es muy baja y el déficit motor a menudo se producen debido a la presencia voluminosa de un catéter en el espacio subdural severamente limitado en el ratón. Además, la administración a largo plazo de medicamentos se hace debido a la coagulación frecuentesde implantado crónicamente catéteres. Finalmente, las reacciones inmunes son comunes. Estos problemas pueden ser evitados utilizando el método de la inyección intratecal aguda a través de una aguja en la ausencia de un catéter preimplanted, que permite una aplicación rápida y anatómicamente limitado de medicamentos y reactivos a la médula espinal en ratones. Este método mantiene plenamente los beneficios de la entrega intratecal sobre otras rutas de administración sistémica (por ejemplo, oral, intravenosa, intraperitoneal, etc) tales como especificidad de la modulación espinal, que permite la reducción de las dosis y los efectos secundarios límite, así como la capacidad para entregar sustancias no hacen normalmente no atraviesan la barrera hematoencefálica ya que durante la inyección intratecal, se inserta la aguja entre la duramadre y la médula espinal. Es importante destacar sin embargo, en comparación con otros métodos de entrega intratecal, el método de inyección de aguja intratecal es el menos invasivo, lo que permite numerosas aplicaciones en lamismo animal sin causar ningún daño tisular considerable o evocando reacción inmune debido a la implantación de material extraño. Sin embargo, requiere habilidades técnicas para una orientación muy precisa de la aguja para permitir la eficacia. Este sentido, demostrar visualmente el método para alcanzar una tasa óptima de éxito para la orientación específica de la médula espinal lumbar. El sitio de la inyección que se elige en este experimento es el surco entre L5 y L6 columna de vertebrados, cerca de donde termina la médula espinal, para reducir al mínimo la posibilidad de dañar la columna vertebral. Por otra parte, se demuestra el uso de esta técnica para derribar los genes en la médula espinal utilizando siRNAs.

<table><tbody><tr><td>&lt;em&gt;In Vivo&lt;/em&gt;-jetPEI</td><td>Polyplus</td><td>201-10G</td><td>&amp;nbsp;</td></tr><tr><td>WAVE1 siRNA</td><td>Santa Cruz</td><td>sc-36832</td><td>&amp;nbsp;</td></tr><tr><td>Control siRNA-A</td><td>Santa Cruz</td><td>sc-37007</td><td>&amp;nbsp;</td></tr><tr><td>Anti-&amp;szlig;-Tubulin III antibody</td><td>Sigma</td><td>T2200</td><td>&amp;nbsp;</td></tr><tr><td>Anti-WAVE1 antibody</td><td>R&amp;amp;D Systems</td><td>AF5514</td><td>&amp;nbsp;</td></tr><tr><td>Fast green dye</td><td>Sigma</td><td>F-7252</td><td>&amp;nbsp;</td></tr><tr><td>Isoflurane</td><td>Baxter</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Isoflurane setup</td><td>Dr&amp;auml;ger L&amp;uuml;beck</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Shaver</td><td>Wella</td><td></td><td>&amp;nbsp;</td></tr><tr><td>Hamilton syringe Gastight 1702</td><td>Hamilton</td><td></td><td>&amp;nbsp;</td></tr><tr><td>30 G 1/2 in 13 mm Needle</td><td>BD Microlance</td><td>304000</td><td>&amp;nbsp;</td></tr><tr><td>Microscope Leica MS5</td><td>Leica</td><td></td><td>&amp;nbsp;</td></tr><tr><td>WAVE1 forward primer for qRT-PCR</td><td>Sigma</td><td></td><td>cacagagcctcaggacagg</td></tr><tr><td>WAVE1 reversed primer for qRT-PCR</td><td>Sigma</td><td></td><td>cttttcaccaacggcatctt</td></tr><tr><td>FastStart Essential DNA Green Master</td><td>Roche</td><td>6402712001</td><td>&amp;nbsp;</td></tr></tbody></table>

in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice

En este informe se describe una guía paso a paso a la técnica de inyecciones intratecales agujas agudas de una manera no invasiva, es decir, independiente de la implantación del catéter. La limitación técnica de esta técnica quirúrgica se encuentra en la finura de las manos. La inyección es rápida, sobre todo para un investigador entrenado, y dado que la interrupción del tejido con esta técnica es mínima, las inyecciones repetidas son posibles; reacción además inmune a las herramientas de extranjeros (por ej. Catéter) no ocurre, dando así una mejor y más específica leer en voz de la modulación de la médula espinal. Dado que la aplicación de la sustancia se limita en gran parte a la región diana de la médula espinal, los fármacos no necesitan ser aplicado en grandes dosis, y efectos más importante no deseados en otro tejido, como se observa con un suministro sistémico, pueden ser eludidas 1, 2. Además, combinamos esta técnica con la transfección in vivo de ácido nucleico con la ayuda de polyethylenimINE (PEI) de reactivo 3, que proporciona una gran versatilidad para el estudio de funciones de la médula a través de la administración de agentes farmacológicos, así como de genes, ARN, y moduladores de proteínas.

Con el fin de ilustrar una inyección de éxito, se realizó esta técnica usando Fast tinte verde FCF en ratones adultos C57Bl6 (8-10 semanas de edad). El animal se le permitió recuperarse durante unos minutos después de la inyección para dar tiempo suficiente para que el tinte se extendió y luego mató con una sobredosis de CO 2. Posteriormente, la columna de la vertebrado fue disecada y la médula espinal se expuso. El puntos lagrimales azul correspondiente al colorante difusa, marcó el sitio de la in...

Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Este informe describe una técnica sencilla y rápida de la aguja de punción intratecal para una transfección localizada de siRNA en la médula espinal lumbar de ratón bajo anestesia de corta luz duradera.

En Vivo transfección siRNA y Gene Derribo en la médula espinal a través de Rapid no invasiva lumbar intratecal inyecciones en ratones

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter ...

in-vivo-sirna-transfection-gene-knockdown-spinal-cord-via-rapid

Research

JoVE Journal

Biology

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

46.5K vistas.  University of Heidelberg.  Este informe describe una técnica sencilla y rápida de la aguja de punción intratecal para una transfección localizada de siRNA en la médula espinal lumbar de ratón bajo anestesia de corta luz duradera. 

Video: In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

In vivo Imaging of the Mouse Spinal Cord Using Two-photon Microscopy

In vivo imaging using two-photon microscopy 1 in mice that have been genetically engineered to express fluorescent proteins in specific cell types 2-3 has significantly broadened our knowledge of physiological and pathological processes in numerous tissues in vivo 4-7. In studies of the central nervous system (CNS), there has been a broad application of in vivo imaging in the brain, which has produced a plethora of novel and often unexpected findings about the behavior of cells such as neurons, astrocytes, microglia, under physiological or pathological conditions 8-17. However, mostly technical complications have limited the implementation of in vivo imaging in studies of the living mouse spinal cord. In particular, the anatomical proximity of the spinal cord to the lungs and heart generates significant movement artifact that makes imaging the living spinal cord a challenging task.
We developed a novel method that overcomes the inherent limitations of spinal cord imaging by stabilizing the spinal column, reducing respiratory-induced movements and thereby facilitating the use of two-photon microscopy to image the mouse spinal cord in vivo. This is achieved by combining a customized spinal stabilization device with a method of deep anesthesia, resulting in a significant reduction of respiratory-induced movements. This video protocol shows how to expose a small area of the living spinal cord that can be maintained under stable physiological conditions over extended periods of time by keeping tissue injury and bleeding to a minimum. Representative raw images acquired in vivo detail in high resolution the close relationship between microglia and the vasculature. A timelapse sequence shows the dynamic behavior of microglial processes in the living mouse spinal cord. Moreover, a continuous scan of the same z-frame demonstrates the outstanding stability that this method can achieve to generate stacks of images and/or timelapse movies that do not require image alignment post-acquisition. Finally, we show how this method can be used to revisit and reimage the same area of the spinal cord at later timepoints, allowing for longitudinal studies of ongoing physiological or pathological processes in vivo.

In vivo Imaging of the Mouse Spinal Cord Using Two-photon Microscopy

A minimally invasive protocol to stabilize the mouse spinal column and perform repetitive in vivo spinal cord imaging using two-photon microscopy is described. This method combines a spinal stabilization device and an anesthetic regimen to minimize respiratory-induced movements and produce raw imaging data that require no alignment or other post-processing.

Imágenes in vivo de la médula espinal de ratón Utilizando microscopía de dos fotones

In vivo imaging using two-photon microscopy 1 in mice that have been genetically engineered to express fluorescent proteins in specific cell types 2-3 has ...

Investigación

Neurociencias

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central nervous system. We demonstrate a stereotaxic injection technique that allows targeted gene expression or silencing in the dorsal horn of the mouse spinal cord. The surgical procedure is brief. It requires laminectomy of a single vertebra, providing for quick recovery of the animal and unimpaired motility of the spine. Controlled injection of a small vector suspension volume at low speed and use of a microsyringe with beveled glass cannula minimize the tissue lesion. The local immune response to the vector depends on the intrinsic properties of the virus employed; in our experience, it is minor and short-lived when a recombinant adeno-associated virus is used. A reporter gene such as enhanced green fluorescent protein facilitates monitoring spatial distribution of the vector, and the efficacy and cellular specificity of the transfection.

Viral vectors allow for targeted gene manipulation. We demonstrate a method for conditional gene expression or ablation in the mouse spinal cord, using stereotaxic injection of a viral vector into the dorsal horn, a prominent site of synaptic contact between primary somatosensory afferents and neurons of the central nervous system.

Inyección estereotáxica de un vector viral para la manipulación genética condicional en la médula espinal de ratón

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central ...

<meta charset="utf8"></head><body>Desarrollo de un modelo de ratón eficiente y preciso para el glioma de la médula espinal

Surgical Transplantation of Tumor Cells into the Spinal Cord of Mice

Spinal cord gliomas are commonly malignant tumors of the spinal cord, leading to a high rate of disability. However, uniform treatment guidelines and comprehensive data on spinal cord gliomas remain limited due to the lack of suitable preclinical animal models. Developing a simple and reproducible animal model has become essential for advancing basic and translational research. A murine model is ideal, as the murine spinal cord shares structural similarities with the human spinal cord. This protocol describes the generation of a reproducible murine model of spinal cord glioma by directly injecting tumor cells into the intervertebral space using the spinous process of the seventh cervical vertebra as a guide. Compared to other methods, this approach is more effective and convenient, involving a smaller incision, reduced invasiveness and blood loss, faster recovery, and more stable tumor formation. This model is expected to advance the understanding of disease mechanisms, optimize surgical strategies, and support the development of therapeutic drugs for spinal cord gliomas.

<meta charset="utf8"></head><body>Trasplante quirúrgico de células tumorales en la médula espinal de ratones

The present protocol describes the development of a reproducible murine model of spinal cord glioma by injecting tumor cells into the intervertebral space, offering a more effective and less invasive approach for research and therapeutic development.

Trasplante quirúrgico de células tumorales en la médula espinal de ratones

Spinal cord gliomas are commonly malignant tumors of the spinal cord, leading to a high rate of disability. However, uniform treatment guidelines and ...

Investigación sobre el cáncer

In Vivo Gene Transfer to Schwann Cells in the Rodent Sciatic Nerve by Electroporation

The formation of the myelin sheath by Schwann cells (SCs) is essential for rapid conduction of nerve impulses along axons in the peripheral nervous system. SC-selective genetic manipulation in living animals is a powerful technique for studying the molecular and cellular mechanisms of SC myelination and demyelination in vivo. While knockout/knockin and transgenic mice are powerful tools for studying SC biology, these methods are costly and time consuming. Viral vector-mediated transgene introduction into the sciatic nerve is a simpler and less laborious method. However, viral methods have limitations, such as toxicity, transgene size constraints, and infectivity restricted to certain developmental stages. Here, we describe a new method that allows selective transfection of myelinating SCs in the rodent sciatic nerve using electroporation. By applying electric pulses to the sciatic nerve at the site of plasmid DNA injection, genes of interest can be easily silenced or overexpressed in SCs in both neonatal and more mature animals. Furthermore, this in vivo electroporation method allows for highly efficient simultaneous expression of multiple transgenes. Our novel technique should enable researchers to efficiently manipulate SC gene expression, and facilitate studies on SC development and function.

In Vivo Gene Transfer to Schwann Cells in the Rodent Sciatic Nerve by Electroporation

Here, we present an in vivo technique for gene transfer to Schwann cells (SCs) in the rodent sciatic nerve. This simple technique is useful for investigating signaling mechanisms involved in the development and maintenance of myelinating SCs.

En Vivo Transferencia de genes a células de Schwann en el nervio ciático de roedores mediante electroporación

The formation of the myelin sheath by Schwann cells (SCs) is essential for rapid conduction of nerve impulses along axons in the peripheral nervous ...

Adeno-associated Virus-mediated Transgene Expression in Genetically Defined Neurons of the Spinal Cord

Selective manipulation of spinal neuronal subpopulations has mainly been achieved by two different methods: 1) Intersectional genetics, whereby double or triple transgenic mice are generated in order to achieve selective expression of a reporter or effector gene (e.g., from the Rosa26 locus) in the desired spinal population. 2) Intraspinal injection of Cre-dependent recombinant adeno-associated virus (rAAV); here Cre-dependent AAV vectors coding for the reporter or effector gene of choice are injected into the spinal cord of mice expressing Cre recombinase in the desired neuronal subpopulation. This protocol describes how to generate Cre-dependent rAAV vectors and how to transduce neurons in the dorsal horn of the lumbar spinal cord segments L3-L5 with rAAVs. As the lumbar spinal segments L3-L5 are innervated by those peripheral sensory neurons that transmit sensory information from the hindlimbs, spontaneous behavior and responses to sensory tests applied to the hindlimb ipsilateral to the injection side can be analyzed in order to interrogate the function of the manipulated neurons in sensory processing. We provide examples of how this technique can be used to analyze genetically defined subsets of spinal neurons. The main advantages of virus-mediated transgene expression in Cre transgenic mice compared to classical reporter mouse-induced transgene expression are the following: 1) Different Cre-dependent rAAVs encoding various reporter or effector proteins can be injected into a single Cre transgenic line, thus overcoming the need to create several multiple transgenic mouse lines. 2) Intraspinal injection limits manipulation of Cre-expressing cells to the injection site and to the time after injection. The main disadvantages are: 1) Reporter gene expression from rAAVs is more variable. 2) Surgery is required to transduce the spinal neurons of interest. Which of the two methods is more appropriate depends on the neuron population and research question to be addressed.

Intraspinal injection of recombinase dependent recombinant adeno-associated virus (rAAV) can be used to manipulate any genetically labelled cell type in the spinal cord. Here we describe how to transduce neurons in the dorsal horn of the lumbar spinal cord. This technique enables functional interrogation of the manipulated neuron subtype.

Expresión de transgenes de mediada por Virus adeno-asociado en neuronas genéticamente definidas de la médula espinal

Selective manipulation of spinal neuronal subpopulations has mainly been achieved by two different methods: 1) Intersectional genetics, whereby double or ...

Direct Intrathecal Injection of Recombinant Adeno-associated Viruses in Adult Mice

Intrathecal (IT) injection of adeno-associated virus (AAV) has drawn considerable interest in CNS gene therapy by virtue of its safety, noninvasiveness, and excellent transduction efficacy in the CNS.&#160;Previous studies have demonstrated the therapeutic potency of AAV-delivered gene therapy in neurodegenerative disorders by IT administration. However, high rates of unpredictable failure due to the technical limitation of IT administration in small animals have been reported. Here, we established a scoring system to indicate the success extent of lumbar puncture in small animals by adding 1% lidocaine hydrochloride into the injection solution. We further show that the extent of transient weakness following injection can predict the transduction efficiency of AAV. Thus, this IT injection method can be used to optimize therapeutic trials in mouse models of CNS diseases that afflict wide regions of the CNS.

Here we present a direct intrathecal injection technique using 1% lidocaine hydrochloride in a viral solution to ensure efficient adeno-associated virus delivery to small animals and establish a scoring system to predict transduction efficiency in the central nervous system according to the degree of transient weakness induced by lidocaine.

Directa de la inyección intratecal de virus Adeno-asociado recombinantes en ratones adultos

Intrathecal (IT) injection of adeno-associated virus (AAV) has drawn considerable interest in CNS gene therapy by virtue of its safety, noninvasiveness, ...

Direct Injection of a Lentiviral Vector Highlights Multiple Motor Pathways in the Rat Spinal Cord

Introducing proteins of interest into cells in the nervous system is challenging due to innate biological barriers that limit access to most molecules. Injection directly into spinal cord tissue bypasses these barriers, providing access to cell bodies or synapses where molecules can be incorporated. Combining viral vector technology with this method allows for introduction of target genes into nervous tissue for the purpose of gene therapy or tract tracing. Here a virus engineered for highly efficient retrograde transport (HiRet) is introduced at the synapses of propriospinal interneurons (PNs) to encourage specific transport to neurons in the spinal cord and brainstem nuclei. Targeting PNs takes advantage of the numerous connections they receive from motor pathways such as the rubrospinal and reticulospinal tracts, as well as their interconnection with each other throughout spinal cord segments. Representative tracing using the HiRet vector with constitutively active green fluorescent protein (GFP) shows high fidelity details of cell bodies, axons and dendritic arbors in thoracic PNs and in reticulospinal neurons in the pontine reticular formation. HiRet incorporates well into brainstem pathways and PNs but shows age dependent integration into corticospinal tract neurons. In summary, spinal cord injection using viral vectors is a suitable method for introduction of proteins of interest into neurons of targeted tracts.

This protocol demonstrates injection of a retrogradely transportable viral vector into rat spinal cord tissue. The vector is taken up at the synapse and transported to the cell body of target neurons. This model is suitable for retrograde tracing of important spinal pathways or targeting cells for gene therapy applications.

Inyección directa de un Vector lentivirales destaca múltiples caminos del Motor en la médula espinal de rata

Introducing proteins of interest into cells in the nervous system is challenging due to innate biological barriers that limit access to most molecules. ...

Intrathecal Delivery of Antisense Oligonucleotides in the Rat Central Nervous System

The blood brain barrier (BBB) is an important defense against the entrance of potentially toxic or pathogenic agents from the blood into the central nervous system (CNS). However, its existence also dramatically lowers the accessibility of systemically administered therapeutic agents to the CNS. One method to overcome this, is to inject those agents directly into the cerebrospinal fluid (CSF), thus bypassing the BBB. This can be done via implantation of a catheter for either continuous infusion using an osmotic pump, or for single bolus delivery. In this article, we describe a surgical protocol for delivery of CNS-targeting antisense oligonucleotides (ASOs) via a catheter implanted directly into the cauda equina space of the adult rat spine. As representative results, we show the efficacy of a single bolus ASO intrathecal (IT) injection via this catheterization system in knocking down the target RNA in different regions of the rat CNS. The procedure is safe, effective and does not require expensive equipment or surgical tools. The technique described here can be adapted to deliver drugs in other modalities as well.

Here, we describe a method for delivering drugs to the rat central nervous system by implanting a catheter into the lumbar intrathecal space of the spine. We focus on the delivery of antisense oligonucleotides, though this method is suitable for delivery of other therapeutic modalities as well.

Entrega intratecal de oligonucleótidos antisentido en el sistema nervioso central de Rata

The blood brain barrier (BBB) is an important defense against the entrance of potentially toxic or pathogenic agents from the blood into the central ...

En Vivo transfección siRNA y Gene Derribo en la médula espinal a través de Rapid no invasiva lumbar intratecal inyecciones en ratones

Resumen

Explorar más videos

Capítulos en este video

Imágenes in vivo de la médula espinal de ratón Utilizando microscopía de dos fotones

Inyección estereotáxica de un vector viral para la manipulación genética condicional en la médula espinal de ratón

Trasplante quirúrgico de células tumorales en la médula espinal de ratones

Trasplante quirúrgico de células tumorales en la médula espinal de ratones

Trasplante quirúrgico de células tumorales en la médula espinal de ratones

En Vivo Transferencia de genes a células de Schwann en el nervio ciático de roedores mediante electroporación

Expresión de transgenes de mediada por Virus adeno-asociado en neuronas genéticamente definidas de la médula espinal

Directa de la inyección intratecal de virus Adeno-asociado recombinantes en ratones adultos

Inyección directa de un Vector lentivirales destaca múltiples caminos del Motor en la médula espinal de rata

Entrega intratecal de oligonucleótidos antisentido en el sistema nervioso central de Rata