Name: enhanced northern blot detection of small rna species in drosophila melanogaster
Uploaded: 2014-08-21T15:00:00.000+00:00
Duration: 9 min 39 s
Description: Watch this Scientific Journal Video about Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster at JoVE.com

This work was supported by the Institut National de la Sant&#233; et de la Recherche M&#233;dicale, the Centre National de la Recherche Scientifique, the Universit&#233; de Strasbourg, the H&#244;pital de Strasbourg, the Association pour la Recherche sur le Cancer, the Institut National du Cancer, the Agence Nationale de la Recherche and the R&#233;gion Alsace.
Pietro Laneve has been supported by the Fondation pour la Recherche M&#233;dicale. Currently, he is a recipient of a Istituto Italiano Tecnologia (IIT) fellowship. Publication costs are supported by the Neurex network (TriNeuron &#8211; Program Interreg IV Upper Rhine)

1. Sample Collection
<ol>
	<li>Detach semi-adherent Schneider&#8217;s 2 cells, (1-5 x 106 cells on average), by pipetting and harvest them by centrifugation (100 x g&#160;for 1 min). In case of in vitro cultured adherent cells, trypsinize them in standard conditions or directly collect them from plates into a convenient amount of RNA extraction reagent, by help of a cell scraper.</li>
	<li>For embryo collection, grow Drosophila strains in fly cages and let embryos accumulate on egg laying plates. Wipe embryos off by a paintbrush in distilled water (dH2O), discard debris by sieve filtering, rinse and recover embryos in a vial48.</li>
	<li>As an alternate technique, manually dissect tissues/organs. Isolate testes (a preferential system for piRNA analysis) from Drosophila abdomen in phosphate buffered saline (PBS) under a stereomicroscope (20X magnification), by using dissection needles or forceps as visualized in Sullivan et al49.</li>
	<li>Pestle&#160;homogenize samples upon addiction of 0.5 volumes of RNA extraction reagent.</li>
</ol>
2. RNA Extraction/Analysis
<ol>
	<li>Following manufacturers&#8217; instructions perform RNA isolation through commercial reagents. CAUTION! RNA extraction agents are usually toxic and caustic. Alternatively, apply a Proteinase K-based protocol for RNA isolation50, as follows:
	<ol>
		<li>Dilute samples into 400 &#956;l of Stop Mix and incubate at RT&#160;for 15 min.</li>
		<li>Recover hydrosoluble components by standard phenol:chloroform:isoamyl alcohol and chloroform extractions and by ethanol (EtOH) precipitation/washing. Air&#160;dry the samples and resuspend into diethylpyrocarbonate (DEPC)-treated double distilled (dd)H2O.</li>
	</ol>
	</li>
	<li>Assess RNA concentration by UV spectrophotometric measurement. Also ensure the RNA purity is high, close to 2.0, based on A260/A280 reading.</li>
	<li>Check RNA preparation on denaturing agarose gel as follows:
	<ol>
		<li>In a clean beaker, dissolve 1.2 g of Agarose in 82 ml of DEPC-ddH2O, under continuous stirring. Boil until completely dissolved.</li>
		<li>Allow the gel solution to cool down; when temperature reaches 60&#160;&#176;C add 10 ml of 10X 4-morpholinepropanesulfonic acid (MOPS) buffer to 1X final concentration (FC), and 8 ml of 37% formaldehyde to 3% FC. CAUTION!&#160;Formaldehyde is a carcinogen.</li>
		<li>Pour the gel into a horizontal electrophoresis cell. Allow the gel to solidify under a hood for at least 1 hr. Following solidification, submerge the gel into MOPS 1X.</li>
		<li>Aliquot 2 &#956;g of RNA sample and 1 &#956;g of Ladder (use an RNA marker when accurate&#160;evaluation is desired). Add 3 volumes of agarose loading dye (ALD) to RNA and to Ladder. Heat at 70 &#176;C for 5 min and immediately cool on ice.&#160;CAUTION!&#160;Contents of ALD (ethidium bromide and formamide, see Materials) are mutagen and corrosive, respectively.</li>
		<li>Load the samples and run the gel at 50 V for about 1 hr with occasional buffer recycling. Check the RNA fractionation pattern by UV visualization or gel imaging. Recognize discrete bands corresponding to 28S and 18S rRNAs and to tRNAs (see Figure 1).</li>
	</ol>
	</li>
	<li>Proceed to Northern Assay or store RNA at -80 &#176;C.</li>
</ol>
3. Denaturing Acrylamide Gel Preparation
<ol>
	<li>Use a small vertical electrophoretic apparatus for this fractionation step (plate size about 8 cm x 9 cm, comb thickness 0.75 mm).</li>
	<li>Assemble clean glasses together in a casting frame.</li>
	<li>Prepare 10 ml of 10% acrylamide/bis-acrylamide (19:1) solution in MOPS 1X, 7 M urea. Immediately before pouring, add 100 &#956;l of 10% ammonium persulfate and 10 &#956;l of TEMED and rapidly mix the solution. CAUTION! Acrylamide is neurotoxic and carcinogen.</li>
	<li>Pour the gel between glass plates and insert the well comb carefully to avoid bubbles. Let the gel polymerize at RT for at least 45 min before use. Alternatively, store the gel O/N, wrapped in water-soaked filter papers and sealed in saran wrap.</li>
</ol>
4. Sample Preparation
<ol>
	<li>Aliquot 0.5-20 &#956;g of total RNA for each sample. If volume exceeds 3-4 &#956;l, vacuum&#160;dry the sample.</li>
	<li>For size determination, run an aliquot (20-30 cps) of radiolabeled low-range ladder in parallel to samples, as a marker (see section 4.3 and 4.4 for preparation). Treat it in parallel to samples, as described in step 4.5.</li>
	<li>Ladder: set up a phosphate forward reaction using 0.1 &#956;g of a 10 bp-step ladder. Incubate at 37 &#176;C for 30 min and stop the reaction by adding ethylenediaminetetraacetic acid (EDTA) to 20 mM FC.</li>
	<li>Purify by EtOH precipitation/washing, air&#160;dry and resuspend in ddH2O&#160;(about 100 &#956;l). CAUTION! 32P is a radioactive source.</li>
	<li>To each sample add an equal volume of acrylamide blue dye (ABD). Denature by heating at 80 &#176;C for 5 min and cool on ice until loading. CAUTION! Formamide (content in ABD) is corrosive.</li>
</ol>
5. Electrophoretic Fractionation
<ol>
	<li>Remove the glass plates from the casting support and properly assemble them in the electrophoresis cell. Fill both inner and outer chamber with sufficient Running Buffer (RB).</li>
	<li>Gently remove the comb and pre-run the gel at 200 V&#160;for 10 min. &#160;Before loading samples, wash away urea deposits from the wells by squirting some RB through a syringe.</li>
	<li>Use flat tips to carefully stratify samples from step 4.5 at the bottom of each well. Check anode and cathode connections to avoid inverted running. After the samples enter the gel at 100 V&#160;for 5 min, increase the voltage to 200 V.</li>
	<li>For a fractionation length of about 7 cm, a 45 min-long run is sufficient. Avoid Bromophenol blue (a tracking pigment in ABD) to overflow the gel.</li>
	<li>Visualize on-gel the fractionated long RNAs by ethidium bromide (EtBr) staining, as an optional step:
	<ol>
		<li>Cut away 2 cm from the top of the gel and briefly rinse the slice in ddH2O.</li>
		<li>Incubate the gel slice at RT for 15 min with gentle shacking in RB, EtBr 0.5 &#956;g/ml FC.</li>
		<li>Destain the gel for 15 min in RB, visualize long rRNAs by UV irradiation or gel imaging. Check for RNA loading and quality (see Figure&#160;1, Panel 7). CAUTION! Ethidium bromide is a mutagen.</li>
	</ol>
	</li>
	<li>Meanwhile proceed blotting the lower part of the gel containing small RNA species.</li>
</ol>
6. Gel Blotting
<ol>
	<li>Cut 6 pieces of blotting paper to fit the blotting area and an equivalent piece of uncharged nylon membrane. Dampen paper sheets, membrane and 2 blotting pads in RB. Make sure to completely soak the pads by repeatedly squeezing them in RB.</li>
	<li>Remove the gel from the apparatus and open the glasses by mean of a spatula. Use a clean cutter to remove the wells. Place a sheet of wet Whatman paper on the gel and gently lift it up.</li>
	<li>Place the nylon membrane on the free face of the gel. Mark a corner to orient the filter according to sample loading. Complete the &#8220;sandwich&#8221; (3 paper pieces each side). Roll a plastic rod on the blot surface, to remove any possible air bubbles.</li>
	<li>Place the blot between two blotting pads and then in the blotting cassette. Assemble the cassette in the blotting module, fill the chamber with RB and check for the correct orientation (nylon membrane must stay between the gel and the positive terminus).</li>
	<li>Transfer at 20 V for 20 min. Note: to ensure homogeneous conditions, after 10 min open the blotting module and rotate the sandwich by 180&#176;&#160; before completing the transfer.</li>
</ol>
7. Membrane Crosslinking
<ol>
	<li>Prepare 6 ml of fresh Crosslinking Solution (XLS). Saturate a 10 cm&#160;x 10 cm (larger than nylon membrane) piece of blotting paper with XLS. CAUTION! HCl (a component of XLS) is highly corrosive.</li>
	<li>Dismantle the blot and place the membrane on the wet 3MM filter paper. Note: RNA must not be in direct contact with the saturated paper. Place the filter and paper between two glass plates and wrap in saran-wrap.</li>
	<li>Heat the membrane at 60&#160;&#176;C for 2 hr,&#160;followed by a ddH2O washing. Store at -20&#160;&#176;C or proceed to&#160;hybridization.</li>
</ol>
8. Membrane Prehybridization
<ol>
	<li>If RNA loading has been checked (optional step 5.5), directly proceed to hybridization. Or else, cut away 1 cm from to the top of the nylon filter, to avoid probe cross-hybridizations to&#160;fractionated long RNAs.</li>
	<li>Preheat 10 ml of Hybridization Solution (HS) at 37 &#176;C. Denature 1 mg of Salmon Sperm at 95&#160;&#176;C for 5 min, cool on ice and add to HS.</li>
	<li>Incubate the filter in HS at 37&#730;C for at least 1 hr, under rotation in a hybridization oven. Check that the RNA-side of the filter faces HS.</li>
</ol>
9. Probe Synthesis
<ol>
	<li>Set up a phosphate forward reaction on 10 pmol of specific antisense oligonucleotide, as described in 4.3.</li>
	<li>Add 5 volumes of Tris-EDTA-NaCl (TEN) buffer to the reaction and purify the labeled primer from unincorporated nucleotides by gel exclusion chromatography on G-25 Sephadex columns (or also by EtOH precipitation). Probe activity can be assessed by Liquid Scintillation Counter.</li>
</ol>
10. Membrane Hybridization
<ol>
	<li>Replace the exhausted HS with a fresh 10 ml aliquot (prepared and complemented as described above). Heat the probe at 95&#160;&#176;C for 10 min, cool on ice and add to novel HS. Incubate the filter at 37&#160;&#176;C ON.</li>
</ol>
11. Membrane Washing
<ol>
	<li>Recover the hybridization solution and store it at -20 &#176;C in a radioactivity-shielding box.</li>
	<li>Rinse the filter in Washing Buffer (WB) and wash it thoroughly for 10 min at RT.</li>
	<li>Use a Geiger Mueller Detector for checking residual radioactivity at the filter corners. When background emission is around 5 cps, proceed to membrane exposition.</li>
</ol>
12. Signal Detection
<ol>
	<li>Expose the filter on autoradiography films or on a molecular imager screen ON. Reveal signals by photographic processing or digital conversion.</li>
	<li>Analyze the band intensity by dedicated quantification software (ImageJ or Optiquant).</li>
</ol>
13. Membrane Stripping
<ol>
	<li>To remove primary signals, submerge the membrane in 500 ml of boiling Stripping solution, then incubate at RT for 1 min. Proceed to novel (pre)hybridization or store the filter at -20 &#176;C.</li>
</ol>

The authors declare that they have no competing financial interests.

Although our appreciation of the sophisticate intertwining through which RNA regulates neurogenesis is continuously increasing, the mechanistic implications of RNA-based circuitries affecting neural stem cell biology, neuronal differentiation/functional integration, development of neural pathologies and cancers remain unexplored. The maintenance of such networks through kingdoms makes the potential of genetic systems as Drosophila melanogaster instrumental to unravel unexplored cellular pathways, in which short ...

RNA biochemistry has experienced spectacular progresses in the past years1. Our comprehension of RNA potential in the control of gene expression has been burst by the identification of powerful noncoding ribo-regulators2, by the discovery of novel RNA-based regulatory mechanisms3,4 and by a deeper characterization of already known post-transcriptional events5. All together these studies have allowed RNA biology to dramatically make the scene, becoming a major research subject in the current scientific landscape. In particular, over recent years we are getting a sense of the pervasive impact of the &#8220;RNA world&#8221; on molecular neurobiology6, one of the most dynamic research domains in modern life science. In the last decade of the past century, the overall scientific scenario has been revolutionized by the discovery of the RNA interference7,8 and of the small regulatory RNAs9,10 with particular regard to microRNAs11, endogenously expressed small noncoding RNAs implicated in the control of nearly all cellular functions as pleiotropic and combinatorial regulators of gene expression.
Almost 10 years after miRNA initial discovery in Caenorhabditis elegans by Ambros and Ruvkun&#8217;s labs, renewed attention was turned to the field when high numbers of miRNAs were identified in Drosophila and in human cells as well12-15. Since then, thanks to versatile transgenic approaches, Drosophila melanogaster has stood out as a valuable biological context for delving into miRNA biosynthesis and activity. Drosophila miRNAs have revealed distinct functions in insect-specific or evolutionarily conserved processes, spanning from aging to metabolism, signaling pathways, behavior and, of course, neurogenesis. Along this direction, we recently unveiled a novel link16 in the intriguing correlation occurring between the master gene gcm/glide and the RNA pathway. The fly transcription factor Gcm/Glide17-19 constitutes a unique example of cell fate determinant, which dictates the glial vs. neuronal fate choice in multipotent fly neural precursors20. Twenty-year long research on this topic has clearly underlined the occurrence of multiple and overlapping inputs of gene expression regulation converging over gcm/glide21-28 to establish the threshold levels required for balancing the delicate ratio between neuronal and glial counterparts during neural development.
We discovered that regulation via Dmel-miR279 targeting represents a further control level contributing to post-transcriptional fine-tuning of gcm/glide expression16. Globally, these research lines have required specific methodological improvements: along years, several technologies originally developed to analyze traditional RNAs have been converted for quantifying small non coding RNAs, like as RNAse protection assays, cDNA arrays29-31, real-time PCR methods32-35 and sequencing36,37. On the other side, recalibration of technical approaches has fostered continuous progresses in the field.
Northern Blot assay (NB, or RNA gel blot assay) constitutes a representative instance: it is largely employed to profile RNA accumulation, since it ensures both expression level quantitation as well as size determination. However, the intrinsic poor sensitivity of the method is limiting when it is to be applied to low-abundant gene expression fine tuners, like short RNAs. A detrimental consequence is the requirement of large amounts of total RNA, which makes difficult its application to specific biological samples. For such reasons, specific NB variants for small RNAs detection have been developed38-40: we took advantage of an improved NB procedure41 (ENB, Enhanced Northern Blot), while elucidating the abovementioned interplay between Dmel-miR279 and gcm/glide.
This method relies on a chemical crosslinking step based on the activity of a Carbodiimide derivative [1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, EDC] to fix nucleic acid onto solid supports. Carbodiimide is a versatile cross linker known to catalyze the formation of amide bonds between activated carboxyl or phosphate groups and amine groups42. This property can be exploited to covalently couple small RNAs via their mono-phosphorylated 5&#8242;-hydroxyl group to amino groups at the surface of nylon membranes. The resulting attachment configuration increases the accessibility of the immobilized nucleic acid and, in turn, the efficiency of probe-target hybridization, which results in remarkable detection enhancement43.
The technique assumes particular relevance in Drosophila molecular studies, by which the occurrence of novel and distinctive classes of small noncoding RNAs is emerging44. Among these, rasiRNAs45,46 constitute a specific subtype of piwi-interacting RNAs (piRNAs47), involved in sequence-specific gene silencing. Operative details of this method are fully described and visualized hereinafter, relative to the analysis of the microRNAs Dmel-miR279 and Dmel-miR286 and, for the first time, of one rasiRNA, rasi4. We pushed to extremes this method, which allowed us revealing poorly expressed targets from minimal amounts of RNA (less than 1 &#956;g).

<table><tbody><tr><td>FINAL COMPOSITION/NAME</td><td>COMPANY</td><td>CATALOGUE (Stock)</td><td>COMMENTS</td></tr><tr><td colspan="4">GENERAL REQUIREMENT</td></tr><tr><td>Centrifuge, 5418</td><td>Eppendorf</td><td>5418 000.017</td><td></td></tr><tr><td>Decontaminant, RNase Away</td><td>Sigma-Aldrich</td><td>83931</td><td>Apply on glass/plasticware, wipe and rinse</td></tr><tr><td>RNase inhibitor, DEPC</td><td>Sigma-Aldrich</td><td>D5758</td><td>Hazardous //// 1609-47-8</td></tr><tr><td colspan="4">SAMPLE PREPARATION</td></tr><tr><td>Stereo Microscope, M60</td><td>Leica&amp;nbsp;</td><td></td><td></td></tr><tr><td>1X PBS Buffer</td><td></td><td></td><td></td></tr><tr><td>137 mM NaCl</td><td>Sigma-Aldrich</td><td>S3014</td><td>7647-14-5&amp;nbsp;&amp;nbsp;</td></tr><tr><td>2.7 mM KCl</td><td>Sigma-Aldrich</td><td>P9541</td><td>7447-40-7&amp;nbsp;</td></tr><tr><td>10 mM Na&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;</td><td>Sigma-Aldrich</td><td>S3264</td><td>7558-79-4&amp;nbsp;</td></tr><tr><td>1.8 mM KH&lt;sub&gt;2&lt;/sub&gt;PO&lt;sub&gt;4&lt;/sub&gt;</td><td>Sigma-Aldrich</td><td>P9791</td><td>7778-77-0&amp;nbsp;</td></tr><tr><td colspan="4">RNA EXTRACTION/ANALYSIS</td></tr><tr><td>UV-Vis Spectrophotometer</td><td>Thermo Scientific</td><td>Nanodrop 2000</td><td></td></tr><tr><td>Gel Imager, ChemiDoc XRS+</td><td>Biorad</td><td>170-8265</td><td></td></tr><tr><td>Horizontal Electrophoresys, Mini-Sub Cell GT</td><td>BioRad</td><td>170-4487EDU</td><td></td></tr><tr><td>RNA extraction reagent, TRIzol Reagent</td><td>Life Technologies</td><td>15596026</td><td>Hazardous</td></tr><tr><td>PCA (25:24:1), 1:1 for extraction</td><td>Sigma-Aldrich</td><td>77617</td><td>136112-00-0</td></tr><tr><td>Chlorophorm, 1:1 for extraction</td><td>Sigma-Aldrich</td><td>C2432</td><td>67-66-3&amp;nbsp;&amp;nbsp;</td></tr><tr><td>EtOH, 2.5 vol. for precipitation, 70% for washing</td><td>Sigma-Aldrich</td><td>59844</td><td>64-17-5&amp;nbsp;</td></tr><tr><td>Gene Ruler 1Kb DNA Ladder</td><td>Thermo Scientific</td><td>SM0311</td><td></td></tr><tr><td>Stop Mix</td><td></td><td></td><td></td></tr><tr><td>300 mM NaOAc, pH 5.5</td><td>Sigma-Aldrich</td><td>S2889</td><td>127-09-3</td></tr><tr><td>1x RSB Solution</td><td></td><td></td><td></td></tr><tr><td>2% sodium dodecyl sulfate (SDS)</td><td>Sigma-Aldrich</td><td>71736</td><td>Never cool down SDS to avoid&amp;nbsp; precipitation //// 151-21-3</td></tr><tr><td>2 mg/ml Proteinase K</td><td>Roche Applied Science</td><td>0-3115828001</td><td>EC 3.4.21.64 9</td></tr><tr><td>10X Reticulocyte Standard Buffer (RSB)</td><td></td><td></td><td></td></tr><tr><td>100 mM Tris-Cl, pH 7.4</td><td>Sigma-Aldrich</td><td>T5941</td><td>1185-53-1&amp;nbsp;&amp;nbsp;</td></tr><tr><td>100 mM NaCl</td><td>Sigma-Aldrich</td><td>S3014</td><td>7647-14-5&amp;nbsp;&amp;nbsp;</td></tr><tr><td>30 mM MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma-Aldrich</td><td>M8266</td><td>7786-30-3</td></tr><tr><td>Denaturing Agarose Gel</td><td></td><td></td><td></td></tr><tr><td>1.2% Agarose</td><td>Sigma-Aldrich</td><td>A9539</td><td>Let the gel solidify for at least 1 hr //// 9012-36-2</td></tr><tr><td>10X MOPS Buffer</td><td></td><td></td><td></td></tr><tr><td>0.2 M MOPS sodium salt, pH 7</td><td>Sigma-Aldrich</td><td>M9381</td><td>Do not confuse MOPS sodium salt with MOPS //// 71119-22-7</td></tr><tr><td>Agarose Loading Dye</td><td></td><td></td><td></td></tr><tr><td>1x MOPS Buffer</td><td></td><td></td><td></td></tr><tr><td>3% formaldehyde</td><td>Sigma-Aldrich</td><td>F8775</td><td>Hazardous //// 50-00-0</td></tr><tr><td>50% formamide</td><td>Sigma-Aldrich</td><td>47670</td><td>Hazardous //// 75-12-7</td></tr><tr><td>Ethidium bromide (EtBr) 30 &amp;mu;g/ml</td><td>Sigma-Aldrich</td><td>E1510</td><td>Hazardous //// 1239-45-8</td></tr><tr><td>Bromophenol blue&amp;nbsp;</td><td>Sigma-Aldrich</td><td>B0126</td><td>115-39-9&amp;nbsp;</td></tr><tr><td colspan="4">SMALL RNA FRACTIONATION</td></tr><tr><td>Flat gel loading tips</td><td>Life Technologies</td><td>LC1002</td><td></td></tr><tr><td>Savant SpeedVac Concentrator</td><td>Thermo Scientific&amp;nbsp;</td><td>DNA120</td><td></td></tr><tr><td>Vertical Electrophoresis, Mini-PROTEAN Tetra Cell&amp;nbsp;</td><td>Biorad</td><td>165-8000</td><td></td></tr><tr><td>Denaturing Acrylamide Gel</td><td></td><td></td><td></td></tr><tr><td>10% acrylamide/bis-acrylamide (19:1)</td><td>Sigma-Aldrich</td><td>A3449</td><td>Hazardous. Let the gel polymerize for 45 min before use</td></tr><tr><td>1x TBE Buffer (or 1x MOPS Buffer)</td><td></td><td></td><td></td></tr><tr><td>7 M urea</td><td>Sigma-Aldrich</td><td>U6504</td><td>57-13-6</td></tr><tr><td>0.1% ammonium persulfate</td><td>Sigma-Aldrich</td><td>215589</td><td>7727-54-0&amp;nbsp;</td></tr><tr><td>0.1% TEMED</td><td>Sigma-Aldrich</td><td>T9281</td><td>110-18-9</td></tr><tr><td>Gene Ruler Ultra Low Range DNA Ladder (10 bp-step)</td><td>Thermo Scientific</td><td>SM1211</td><td>Label 0.1 &amp;mu;g, as described in the &quot;probe labeling&quot; reaction</td></tr><tr><td>Acrylamide Blue Dye&amp;nbsp;</td><td></td><td></td><td></td></tr><tr><td>50% formamide</td><td>Sigma-Aldrich</td><td>47670</td><td>Hazardous //// 75-12-7</td></tr><tr><td>Bromophenol blue</td><td>Sigma-Aldrich</td><td>B0126</td><td>115-39-9&amp;nbsp;</td></tr><tr><td>Running Buffer (RB)</td><td></td><td></td><td></td></tr><tr><td>1x MOPS Buffer&amp;nbsp;</td><td></td><td></td><td></td></tr><tr><td>Alternative RB: 1x TBE Buffer</td><td></td><td></td><td></td></tr><tr><td>1x TBE Buffer</td><td></td><td></td><td></td></tr><tr><td>5X TBE</td><td></td><td></td><td></td></tr><tr><td>445 mM Tris-base</td><td>Sigma-Aldrich</td><td>T1503</td><td>77-86-1&amp;nbsp;</td></tr><tr><td>445 mM boric acid</td><td>Sigma-Aldrich</td><td>B7901</td><td>10043-35-3</td></tr><tr><td>20 mM EDTA</td><td>Sigma-Aldrich</td><td>EDS</td><td>60-00-4&amp;nbsp;&amp;nbsp;</td></tr><tr><td>Gel Staining Solution</td><td></td><td></td><td></td></tr><tr><td>Ethidium bromide 0.5 &amp;mu;g/ml</td><td>Sigma-Aldrich</td><td>E1510</td><td>Hazardous //// 1239-45-8</td></tr><tr><td>1x RB</td><td></td><td></td><td>Stain for 15 min with EtBr, destain for 15 min w/o EtBr</td></tr><tr><td colspan="4">BLOTTING</td></tr><tr><td>3MM Whatman paper</td><td>Sigma-Aldrich</td><td>Z270849</td><td></td></tr><tr><td>Neutral Nylon Membrane, Hybond NX</td><td>GE Healthcare Life Science</td><td>RPN203T</td><td>Photosensitive</td></tr><tr><td colspan="4">CROSSLINKING</td></tr><tr><td>Crosslinking Solution (XLS)</td><td></td><td></td><td></td></tr><tr><td>1% 1-methylimidazole (v/v)</td><td>Sigma-Aldrich</td><td>336092</td><td>Always prepare a fresh aliquot of XLS //// 616-47-7</td></tr><tr><td>12.5 mM HCl</td><td>Sigma-Aldrich</td><td>H1758</td><td>Hazardous //// 7647-01-0</td></tr><tr><td>3.1% EDC (w/v)</td><td>Sigma-Aldrich</td><td>3450</td><td>25952-53-8&amp;nbsp;&amp;nbsp;</td></tr><tr><td colspan="4">(PRE)-HYBRIDIZATION</td></tr><tr><td>Liquid Scintillation Counter&amp;nbsp;</td><td>Beckmann</td><td>LS 6500</td><td></td></tr><tr><td>Sheared Salmon Sperm, 0.1 mg/ml&amp;nbsp;</td><td>Life Technologies</td><td>AM9680</td><td></td></tr><tr><td>rasi4 anti-sense probe</td><td></td><td></td><td>5&#039; CGGUGUUCGACAGUUCCUCGGG -3&#039;</td></tr><tr><td>5s-rRNA anti-sense probe</td><td></td><td></td><td>5&#039;-CAACACGCGGTGTTCCCAAGCCG-3&#039;</td></tr><tr><td>Dmel-miR279 anti-sense probe</td><td></td><td></td><td>5&#039;-TTAATGAGTGTGGATCTAGTCA-3&#039;</td></tr><tr><td>Dmel-miR286 anti-sense probe</td><td></td><td></td><td>5&#039;-AGCACGAGTGTTCGGTCTAGTCA-3&#039;</td></tr><tr><td>Purification Kit, Illustra MicroSpin G-25 Columns</td><td>GE Healthcare Life Science</td><td>27-5325-01</td><td></td></tr><tr><td>(Pre)-Hybridization Solution (HS)</td><td></td><td></td><td></td></tr><tr><td>0.5% SDS</td><td>Sigma-Aldrich</td><td>71736</td><td>151-21-3&amp;nbsp;</td></tr><tr><td>5x Denhardt&#039;s Solution</td><td></td><td></td><td></td></tr><tr><td>20X SSPE</td><td></td><td></td><td></td></tr><tr><td>3.6 M NaCl</td><td>Sigma-Aldrich</td><td>S3014</td><td>7647-14-5&amp;nbsp;&amp;nbsp;</td></tr><tr><td>0.2 M sodium phosphate</td><td>Sigma-Aldrich</td><td>342483</td><td>7601-54-9&amp;nbsp;&amp;nbsp;</td></tr><tr><td>20 mM EDTA (pH 8.0)</td><td>Sigma-Aldrich</td><td>EDS</td><td>&amp;nbsp;60-00-4&amp;nbsp;&amp;nbsp;</td></tr><tr><td>50x Denhardt&#039;s Solution</td><td></td><td></td><td></td></tr><tr><td>1% Ficoll 400 (w/v)</td><td>Sigma-Aldrich</td><td>F2637</td><td>26873-85-8</td></tr><tr><td>1% Polyvinylpyrrolidone</td><td>Sigma-Aldrich</td><td>PVP40</td><td>9003-39-8</td></tr><tr><td>1% BSA</td><td>Sigma-Aldrich</td><td>A7906</td><td>9048-46-8&amp;nbsp;&amp;nbsp;</td></tr><tr><td>1X TEN Buffer</td><td></td><td></td><td></td></tr><tr><td>10 mM Tris-Cl (pH 8.0)</td><td>Sigma-Aldrich</td><td>T1503</td><td>77-86-1&amp;nbsp;</td></tr><tr><td>100 mM NaCl</td><td>Sigma-Aldrich</td><td>S3014</td><td>7647-14-5&amp;nbsp;&amp;nbsp;</td></tr><tr><td>1 mM EDTA (pH 8.0)</td><td>Sigma-Aldrich</td><td>EDS</td><td>60-00-4&amp;nbsp;&amp;nbsp;</td></tr><tr><td>Probe Labelling</td><td></td><td></td><td></td></tr><tr><td>0.4 &amp;mu;M oligonucleotide</td><td></td><td></td><td></td></tr><tr><td>1.5 &amp;mu;l Ci/&amp;mu;l [&amp;gamma;-32P] ATP</td><td>Perkin Elmer</td><td>NEG002A</td><td>Hazardous //// 51963-61-2</td></tr><tr><td>1x T4 Polynucleotide Kinase Buffer</td><td>Biolabs</td><td>B0201</td><td></td></tr><tr><td>T4 Polynucleotide Kinase 0.5 units/&amp;mu;l</td><td>Biolabs</td><td>M0201</td><td>EC 2.7.1.78</td></tr><tr><td colspan="4">WASHING</td></tr><tr><td>Geiger Mueller Detectors</td><td>Canberra Industries</td><td>MCB2/CPS &amp;ndash; EM77021</td><td></td></tr><tr><td>Washing Buffer (WB), 2x SSPE</td><td></td><td></td><td></td></tr><tr><td>Stringent Washing Buffers</td><td></td><td></td><td></td></tr><tr><td>0.2x SSPE</td><td></td><td></td><td></td></tr><tr><td>2x SSPE, 0.5% SDS</td><td></td><td></td><td></td></tr><tr><td>0.2x SSPE, 0.5% SDS</td><td></td><td></td><td></td></tr><tr><td colspan="4">SIGNAL DETECTION</td></tr><tr><td>PharosFX Plus System</td><td>Biorad</td><td>170-9460</td><td></td></tr><tr><td>Image J</td><td>Freely available</td><td></td><td></td></tr><tr><td>Quantity One</td><td>Biorad</td><td></td><td></td></tr><tr><td>X-ray films , BioMax XAR</td><td>Sigma-Aldrich</td><td>F5888</td><td>Photosensitive</td></tr><tr><td>Developer for X-ray films</td><td>Sigma-Aldrich</td><td>P7042</td><td></td></tr><tr><td>Fixer for X-ray films</td><td>Sigma-Aldrich</td><td>P7167</td><td></td></tr><tr><td colspan="4">STRIPPING</td></tr><tr><td>Stripping Solution</td><td></td><td></td><td></td></tr><tr><td>10 mM Tris-HCl pH 8.8</td><td>Sigma-Aldrich</td><td>T1503</td><td>77-86-1&amp;nbsp;</td></tr><tr><td>5 mM EDTA</td><td>Sigma-Aldrich</td><td>EDS</td><td>60-00-4&amp;nbsp;&amp;nbsp;</td></tr><tr><td>0.1% SDS</td><td>Sigma-Aldrich</td><td>71736</td><td>Add SDS after boiling to avoid foaming //// 151-21-3</td></tr></tbody></table>

enhanced northern blot detection of small rna species in drosophila melanogaster

The last decades have witnessed the explosion of scientific interest around gene expression control mechanisms at the RNA level. This branch of molecular biology has been greatly fueled by the discovery of noncoding RNAs as major players in post-transcriptional regulation. Such a revolutionary perspective has been accompanied and triggered by the development of powerful technologies for profiling short RNAs expression, both at the high-throughput level (genome-wide identification) or as single-candidate analysis (steady state accumulation of specific species). Although several state-of-art strategies are currently available for dosing or visualizing such fleeing molecules, Northern Blot assay remains the eligible approach in molecular biology for immediate and accurate evaluation of RNA expression. It represents a first step toward the application of more sophisticated, costly technologies and, in many cases, remains a preferential method to easily gain insights into RNA biology. Here we overview an efficient protocol (Enhanced Northern Blot) for detecting weakly expressed microRNAs (or other small regulatory RNA species) from Drosophila melanogaster whole embryos, manually dissected larval/adult tissues or in vitro cultured cells. A very limited amount of RNA is required and the use of material from flow cytometry-isolated cells can be also envisaged.

By following the overall procedure described in the text and schematically represented in Figure 1, we assessed small RNAs expression from complex RNA samples of different origins. In the experiment presented in Figure 1, RNA was isolated from Drosophila Schneider&#8217;s 2 cells by Proteinase K extraction, checked for integrity (optional step: denaturing agarose gel fractionation) and loaded in double. One half of gel was blotted on a neutral membrane and chemically cross-linke...

Watch this Scientific Journal Video about Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster at JoVE.com

Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster

The aim of this publication is to visualize and discuss the operative steps of an Enhanced Northern Blot protocol on RNA extracted from Drosophila melanogaster embryos, cells, and tissues. This protocol is particularly useful for the efficient detection of small RNA species.

Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster

The last decades have witnessed the explosion of scientific interest around gene expression control mechanisms at the RNA level. This branch of molecular ...

enhanced-northern-blot-detection-small-rna-species-drosophila

Research

JoVE Journal

Biology

24.0K Views.  Institut de Génétique et de Biologie Moléculaire et Cellulaire. The aim of this publication is to visualize and discuss the operative steps of an Enhanced Northern Blot protocol on RNA extracted from Drosophila melanogaster embryos, cells, and tissues. This protocol is particularly useful for the efficient detection of small RNA species.

Video: Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster

High Resolution Fluorescent In Situ Hybridization in Drosophila Embryos and Tissues Using Tyramide Signal Amplification

In our efforts to determine the patterns of expression and subcellular localization of Drosophila RNAs on a genome-wide basis, and in a variety of tissues, we have developed numerous modifications and improvements to our original fluorescent in situ hybridization (FISH) protocol. To facilitate throughput and cost effectiveness, all steps, from probe generation to signal detection, are performed using exon 96-well microtiter plates. Digoxygenin (DIG)-labelled antisense RNA probes are produced using either cDNA clones or genomic DNA as templates. After tissue fixation and permeabilization, probes are hybridized to transcripts of interest and then detected using a succession of anti-DIG antibody conjugated to biotin, streptavidin conjugated to horseradish peroxidase (HRP) and fluorescently conjugated tyramide, which in the presence of HRP, produces a highly reactive intermediate that binds to electron dense regions of immediately adjacent proteins. These amplification and localization steps produce a robust and highly localized signal that facilitates both cellular and subcellular transcript localization. The protocols provided have been optimized to produce highly specific signals in a variety of tissues and developmental stages. References are also provided for additional variations that allow the simultaneous detection of multiple transcripts, or transcripts and proteins, at the same time.

High Resolution Fluorescent In Situ Hybridization in Drosophila Embryos and Tissues Using Tyramide Signal Amplification

The described RNA in situ hybridization protocol allows the detection of RNA in whole Drosophila embryos or dissected tissues. Using 96-well microtiter plates and tyramide signal amplification, transcripts can be detected at high resolution, sensitivity, and throughput, and at a relatively low cost.

In our efforts to determine the patterns of expression and subcellular localization of Drosophila RNAs on a genome-wide basis, and in a variety of ...

Genetics

RNA Blot Analysis for the Detection and Quantification of Plant MicroRNAs

MicroRNAs (miRNAs) are a class of endogenously expressed non-coding, ~21 nt small RNAs involved in the regulation of gene expression in both plants and animals. Most miRNAs act as negative switches of gene expression targeting key genes. In plants, primary miRNAs (pri-miRNAs) transcripts are generated by RNA polymerase II, and they form varying lengths of stable stem-loop structures called pre-miRNAs. An endonuclease, Dicer-like1, processes the pre-miRNAs into miRNA-miRNA* duplexes. One of the strands from miRNA-miRNA* duplex is selected and loaded onto Argonaute 1 protein or its homologs to mediate the cleavage of target mRNAs. Although miRNAs are key signaling molecules, their detection is often carried out by less than optimal PCR-based methods instead of a sensitive northern blot analysis. We describe a simple, reliable, and extremely sensitive northern method that is ideal for the quantification of miRNA levels with very high sensitivity, literally from any plant tissue. Additionally, this method can be used to confirm the size, stability and the abundance of miRNAs and their precursors.

This method demonstrates use of the northern hybridization technique to detect miRNAs from total RNA extract.

MicroRNAs (miRNAs) are a class of endogenously expressed non-coding, ~21 nt small RNAs involved in the regulation of gene expression in both plants and ...

Biochemistry

Isolation and Purification of Drosophila Peripheral Neurons by Magnetic Bead Sorting

The Drosophila peripheral nervous system (PNS) is a powerful model for investigating the complex processes of neuronal development and dendrite morphogenesis at the functional and molecular levels. To aid in these analyses, we have developed a strategy for the isolation of a subclass of PNS neurons called dendritic arborization (da) neurons that have been widely used for studying dendrite morphogenesis1,2. These neurons are very difficult to isolate as a pure population, due in part to their extremely low occurrence and their difficult-to-reach location below the tough chitinous larval cuticle. Our newly developed method overcomes these challenges, and is based on a fast and specific cell enrichment using antibody-coated magnetic beads. For our magnetic bead sorting studies, we have used age-matched third instar larvae expressing a mouse CD8 tagged GFP fusion protein (UAS-mCD8-GFP)3 under the control of either the class IV dendritic arborization (da) neuron-specific pickpocket (ppk)-GAL4 driver4 or the control of the pan-da neuron-specific GAL421-7 driver5. Although this protocol has been optimized for isolating PNS cells which are attached to the inner wall of the larval cuticle, by varying a few parameters, the same protocol could be used to isolate many different cell types attached to the cuticle at larval or pupal stages of development (e.g. epithelia, muscle, oenocytes etc.), or other cell types from larval organs depending upon the GAL4-specific driver expression pattern. The RNA isolated by this method is of high quality and can be readily used for downstream genomic analyses such as microarray gene expression profiling studies. This approach offers a powerful new tool to perform studies on isolated Drosophila dendritic arborization (da) neurons thereby providing novel insights into the molecular mechanisms underlying dendrite morphogenesis.

Isolation and Purification of Drosophila Peripheral Neurons by Magnetic Bead Sorting

In this video-article we present a method for the isolation and purification of Drosophila peripheral neurons using a fast magnetic bead assisted cell sorting strategy. RNA obtained from the isolated cells can be readily used for downstream applications including microarray analyses.

The Drosophila peripheral nervous system (PNS) is a powerful model for investigating the complex processes of neuronal development and dendrite ...

Single Nucleotide Polymorphism-sensitive FISH Detection of Locus-specific Ribosomal RNA Transcription in Drosophila melanogaster

In order to ensure sufficient ribosomal RNA (rRNA) is transcribed for ribosome function, genomes contain hundreds of tandem duplications of the sequences that encode rRNAs, composing regions called ribosomal DNA (rDNA) loci. Many organisms' genomes contain more than one rDNA locus distributed across different chromosomes, and rRNA may be transcribed from multiple rDNA loci or only a single locus. Changes in rRNA transcription sources often indicate ribosomal distress. However, the homogeneity of rRNA obstructs distinguishing if rRNA is transcribed from multiple or a single rDNA locus. Here, we describe a method that uses single nucleotide polymorphism-sensitive fluorescence in situ hybridization (SNP-FISH) to distinguish rRNA transcription between Drosophila melanogaster rDNA loci on the X and Y chromosomes. This method leverages locus-specific rRNA variants to enable easy detection of the source of rRNA transcription with single-cell resolution. This assay can be applied to any Drosophila cell type and may be adapted for use in other systems.

The protocol describes single nucleotide polymorphisms-sensitive fluorescence in situ hybridization (SNP-FISH) method to distinguish ribosomal RNA transcripts derived from the X or Y chromosome ribosomal DNA locus in Drosophila melanogaster.

In order to ensure sufficient ribosomal RNA (rRNA) is transcribed for ribosome function, genomes contain hundreds of tandem duplications of the sequences ...

RNAi Interference by dsRNA Injection into Drosophila Embryos

Genetic screening is one of the most powerful methods available for gaining insights into complex biological process 1. Over the years many improvements and tools for genetic manipulation have become available in Drosophila 2. Soon after the initial discovery by Frie and Mello 3 that double stranded RNA can be used to knockdown the activity of individual genes in Caenorhabditis elegans, RNA interference (RNAi) was shown to provide a powerful reverse genetic approach to analyze gene functions in Drosophila organ development 4, 5.
Many organs, including lung, kidney, liver, and vascular system, are composed of branched tubular networks that transport vital fluids or gases 6, 7. The analysis of Drosophila tracheal formation provides an excellent model system to study the morphogenesis of other tubular organs 8. The Berkeley Drosophila genome project has revealed hundreds of genes that are expressed in the tracheal system. To study the molecular and cellular mechanism of tube formation, the challenge is to understand the roles of these genes in tracheal development. Here, we described a detailed method of dsRNA injection into Drosophila embryo to knockdown individual gene expression. We successfully knocked down endogenous dysfusion(dys) gene expression by dsRNA injection. Dys is a bHLH-PAS protein expressed in tracheal fusion cells, and it is required for tracheal branch fusion 9, 10. dys-RNAi completely eliminated dys expression and resulted in tracheal fusion defect. This relatively simple method provides a tool to identify genes requried for tissure and organ development in Drosophila.

RNAi Interference by dsRNA Injection into Drosophila Embryos

RNA interference has been proven very effective to analyze gene function in Drosophila tracheal development. A detailed protocol used by Jiang lab to inject dsRNA into fly embryos to knockdown gene expression is illustrated. This technique has the potential for screening genes required for tissue and organ development in Drosophila.

Genetic screening is one of the most powerful methods available for gaining insights into complex biological process 1. Over the years many improvements ...

Detection and Quantification of Single mRNA Molecules in Drosophila

Studying Muscle Transcriptional Dynamics at Single-molecule Scales in Drosophila

Skeletal muscles are large syncytia made up of many bundled myofibers that produce forces and enable body motion. Drosophila is a classical model to study muscle biology. The combination of both Drosophila genetics and advanced omics approaches led to the identification of key conserved molecules that regulate muscle morphogenesis and regeneration. However, the transcriptional dynamics of these molecules and the spatial distribution of their messenger RNA within the syncytia cannot be assessed by conventional methods. Here we optimized an existing single-molecule RNA fluorescence in situ hybridization (smFISH) method to enable the detection and quantification of individual mRNA molecules within adult flight muscles and their muscle stem cells. As a proof of concept, we have analyzed the mRNA expression and distribution of two evolutionary conserved transcription factors, Mef2 and Zfh1/Zeb. We show that this method can efficiently detect and quantify single mRNA molecules for both transcripts in the muscle precursor cells, adult muscles, and muscle stem cells.

Author Spotlight: Investigating mRNA Spatial Distribution in Drosophila Muscle Tissue 

Drosophila is a well-established model for studying key molecules that regulate myogenesis. However, current methods are insufficient to determine mRNA transcriptional dynamics and spatial distribution within syncytia. To address this limitation, we optimized an RNA fluorescence in situ hybridization method allowing the detection and quantification of mRNAs at a single-molecule scale.

Skeletal muscles are large syncytia made up of many bundled myofibers that produce forces and enable body motion. Drosophila is a classical model to study ...

Developmental Biology

Isolation of Drosophila melanogaster Testes

The testes of Drosophila melanogaster provide an important model for the study of stem cell maintenance and differentiation, meiosis, and soma-germline interactions. Testes are typically isolated from adult males 0-3 days after eclosion from the pupal case. The testes of wild-type flies are easily distinguished from other tissues because they are yellow, but the testes of white mutant flies, a common genetic background for laboratory experiments are similar in both shape and color to the fly gut. Performing dissection on a glass microscope slide with a black background makes identifying the testes considerably easier. Testes are removed from the flies using dissecting needles. Compared to protocols that use forceps for testes dissection, our method is far quicker, allowing a well-practiced individual to dissect testes from 200-300 wild-type flies per hour, yielding 400-600 testes. Testes from white flies or from mutants that reduce testes size are harder to dissect and typically yield 200-400 testes per hour.

Isolation of Drosophila melanogaster Testes

Drosophila melanogaster testes can be rapidly and efficiently isolated from adult males using dissecting needles. With practice, one can readily isolate in one or two days an amount of testes sufficient for the analysis of DNA or RNA by high throughput sequencing or more traditional molecular biology methods or of protein for antibody- or enzyme-based assays.

The testes of Drosophila melanogaster provide an important model for the study of stem cell maintenance and differentiation, meiosis, and soma-germline ...

Whole Mount RNA Fluorescent in situ Hybridization of Drosophila Embryos

Assessing the expression pattern of a gene, as well as the subcellular localization properties of its transcribed RNA, are key features for understanding its biological function during development. RNA in situ hybridization (RNA-ISH) is a powerful method used for visualizing RNA distribution properties, be it at the organismal, cellular or subcellular levels 1. RNA-ISH is based on the hybridization of a labeled nucleic acid probe (e.g. antisense RNA, oligonucleotides) complementary to the sequence of an mRNA or a non-coding RNA target of interest 2. As the procedure requires primary sequence information alone to generate sequence-specific probes, it can be universally applied to a broad range of organisms and tissue specimens 3. Indeed, a number of large-scale ISH studies have been implemented to document gene expression and RNA localization dynamics in various model organisms, which has led to the establishment of important community resources 4-11. While a variety of probe labeling and detection strategies have been developed over the years, the combined usage of fluorescently-labeled detection reagents and enzymatic signal amplification steps offer significant enhancements in the sensitivity and resolution of the procedure 12. Here, we describe an optimized fluorescent in situ hybridization method (FISH) employing tyramide signal amplification (TSA) to visualize RNA expression and localization dynamics in staged Drosophila embryos. The procedure is carried out in 96-well PCR plate format, which greatly facilitates the simultaneous processing of large numbers of samples.

Whole Mount RNA Fluorescent in situ Hybridization of Drosophila Embryos

Here we describe a whole-mount fluorescent in situ hybridization (FISH) protocol for determining the expression and localization properties of RNAs expressed during embryogenesis in the fruit fly, Drosophila melanogaster.

Assessing  the expression pattern of a gene, as well as the subcellular localization  properties of its transcribed RNA, are key features for ...

Purification of Transcripts and Metabolites from Drosophila Heads

For the last decade, we have tried to understand the molecular and cellular mechanisms of neuronal degeneration using Drosophila as a model organism. Although fruit flies provide obvious experimental advantages, research on neurodegenerative diseases has mostly relied on traditional techniques, including genetic interaction, histology, immunofluorescence, and protein biochemistry. These techniques are effective for mechanistic, hypothesis-driven studies, which lead to a detailed understanding of the role of single genes in well-defined biological problems. However, neurodegenerative diseases are highly complex and affect multiple cellular organelles and processes over time. The advent of new technologies and the omics age provides a unique opportunity to understand the global cellular perturbations underlying complex diseases. Flexible model organisms such as Drosophila are ideal for adapting these new technologies because of their strong annotation and high tractability. One challenge with these small animals, though, is the purification of enough informational molecules (DNA, mRNA, protein, metabolites) from highly relevant tissues such as fly brains. Other challenges consist of collecting large numbers of flies for experimental replicates (critical for statistical robustness) and developing consistent procedures for the purification of high-quality biological material. Here, we describe the procedures for collecting thousands of fly heads and the extraction of transcripts and metabolites to understand how global changes in gene expression and metabolism contribute to neurodegenerative diseases. These procedures are easily scalable and can be applied to the study of proteomic and epigenomic contributions to disease.

Purification of Transcripts and Metabolites from Drosophila Heads

We describe here the procedures for the extraction and purification of mRNA and metabolites from Drosophila heads. We are applying these techniques to better understand the cellular perturbations underlying neuronal degeneration. These methodologies can be easily scaled and adapted for other "omic" projects.

For the last decade, we have tried to understand the molecular and cellular mechanisms of neuronal degeneration using Drosophila as a model organism. ...

Ubiquitous and Tissue-specific RNA Targeting in Drosophila Melanogaster using CRISPR/CasRx

CasRx, a member of the RNA-targeting Cas13 family, is a promising new addition of the CRISPR/Cas technologies in efficient gene transcript reduction with an attractive off-target profile at both cellular and organismal levels. It is recently reported that the CRISPR/CasRx system can be used to achieve ubiquitous and tissue-specific gene transcript reduction in Drosophila melanogaster. This paper details the methods from the recent work, consisting of three parts: 1) ubiquitous&#160;in vivo endogenous RNA targeting using a two-component CasRx system; 2) ubiquitous in vivo exogenous RNA targeting using a three-component CasRx system; and 3) tissue-specific in vivo RNA targeting using a three-component CasRx system. The effects of RNA targeting observed include targeted gene specific phenotypic changes, targeted RNA transcript reduction, and occasional lethality phenotypes associated with high expression of CasRx protein and collateral activity. Overall, these results showed that the CasRx system is capable of target RNA transcript reduction at the organismal level in a programmable and efficient manner, demonstrating that in vivo transcriptome targeting, and engineering is feasible and lays the foundation for future in vivo CRISPR-based RNA targeting technologies.

Ubiquitous and Tissue-specific RNA Targeting in Drosophila Melanogaster using CRISPR/CasRx

This article outlines a detailed protocol for using the RNA-targeting Cas13D enzyme (RfxCas13D) in flies.

CasRx, a member of the RNA-targeting Cas13 family, is a promising new addition of the CRISPR/Cas technologies in efficient gene transcript reduction with ...

Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

High Resolution Fluorescent In Situ Hybridization in Drosophila Embryos and Tissues Using Tyramide Signal Amplification

RNA Blot Analysis for the Detection and Quantification of Plant MicroRNAs

Isolation and Purification of Drosophila Peripheral Neurons by Magnetic Bead Sorting

Single Nucleotide Polymorphism-sensitive FISH Detection of Locus-specific Ribosomal RNA Transcription in Drosophila melanogaster

RNAi Interference by dsRNA Injection into Drosophila Embryos

Studying Muscle Transcriptional Dynamics at Single-molecule Scales in Drosophila

Isolation of Drosophila melanogaster Testes

Whole Mount RNA Fluorescent in situ Hybridization of Drosophila Embryos

Purification of Transcripts and Metabolites from Drosophila Heads

Ubiquitous and Tissue-specific RNA Targeting in Drosophila Melanogaster using CRISPR/CasRx