Name: enhanced northern blot detection of small rna species in drosophila melanogaster
Uploaded: 2014-08-21T15:00:00.000+00:00
Duration: 9 min 39 s
Description: Watch this Scientific Journal Video about Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster at JoVE.com

이 작품은 연구소 국립 드 라 상테 동부 표준시 드 라 공들인 Médicale에 의해 지원되었다, 센터 국립 드 라 공들인 과학원, 4 대학 드 스트라스부르, HOPITAL 드 스트라스부르, 협회 부어 라 공들인 쉬르 르 암, 연구소 국립 뒤 암, 직원은 국립 드 라 공들인 및 지역 알자스. 피에트로 Laneve는 라 공들인 Médicale는 Fondation에 의해 부어지지를 받고 있습니다. 현재는있는 Istituto 이탈리아 Tecnologia (IIT) 교제의받는 사람입니다. 출판 비용을 Neurex 네트워크에 의해 지원됩니다 (TriNeuron - 프로그램 Interreg IV 상단 라인)

1 샘플 컬렉션 <ol><li> 피펫에 의해 반 부착 슈나이더의 두 세포 (평균 1-5 × 10 6 세포), 분리 및 원심 분리 (1 분 100 XG)에 의해 그들을 수확. 체외 부착 세포 배양의 경우는, 표준 조건에서 그들을를 Trypsinize 직접 셀 스크레이퍼의 도움으로, RNA 추출 시약의 양에 편리한 플레이트에서 그들을 수집. </li><li> 배아 수집, 플라이 케이지에서 초파리 균주를 성장하게 배아는 계란 누워 판에 누적됩니다. 증류수에 붓 DH (2 O)에 의해 배아를 닦아, 자체 필터링 파편을 버리고 씻어 유리 병 (48)에 배아를 복구 할 수 있습니다. </li><li> 다른 방법으로 수동으로 조직 / 장기를 해부하다. 힘으로 박리 바늘 또는 집게를 사용하여, 실체 현미경 (배율 20 배)에서는 인산염 완충 식염수 (PBS)에 초파리 복부에서 고환 (피르 분석을위한 우선적 인 시스템)을 격리설리반 등 49 ualized. </li><li> 유 봉은 RNA 추출 시약 0.5 볼륨의 중독에 샘플을 균질화. </li></ol> 2 RNA 추출 / 분석 <ol><li> 다음은 제조업체의 지침에 상용 시약을 통해 RNA 분리를 수행합니다.주의! RNA 추출 에이전트는 일반적으로 독성 및 부식성이다. 또는 다음과 같이, RNA 분리 (50)에 대한 테 K-기반의 프로토콜을 적용 <ol><li> 정지 믹스 400 μL로 샘플을 희석하고 실온에서 15 분 동안 배양한다. </li><li> 클로로포름 : 이소 아밀 알코올과 클로로포름 추출 및 에탄올 (EtOH를) 침전 / 세탁에 의한 표준 페놀에 의해 hydrosoluble 구성 요소를 복구 할 수 있습니다. 공기 샘플을 건조 diethylpyrocarbonate (DEPC)로 재현 탁 더블 (일) H 2 O 증류 - 처리 </li></ol></li><li> UV 분광 측정하여 RNA 농도를 평가합니다. 또한, RNA의 순도는 2.0에 가까운 높은 BAS 보장260에 ED / 280 읽기. </li><li> 다음과 같이 아가 로스 젤을 변성에 RNA 준비 확인 <ol><li> 깨끗한 비커에서 연속 교반, DEPC-DDH 2 O의 82 ㎖에 아가로 오스의 1.2 g을 녹인다. 완전히 용해 될 때까지 끓인다. </li><li> 겔 용액을 냉각시킵니다; 온도가 60 °가 10 배 4 morpholinepropanesulfonic 산 10 ㎖를 추가 C에 도달 할 때 (MOPS)는 1X 최종 농도 (FC)에 버퍼, 8 ml의 3 포름 알데히드 % 37 %의 FC.주의! 포름 알데히드는 발암 물질이다. </li><li> 수평 전기 영동 셀에 겔을 붓고. 젤은 적어도 1 시간 동안 후드 강화하도록 허용합니다. 응고 후, MOPS 1X에 젤 잠수함. </li><li> 분취 RNA 시료 2 μg 및 1 μg의 래더 (정확한 평가가 요구 될 때 RNA 마커를 사용). RNA에 아가로 오스 로딩 염료 (ALD)의 3 볼륨을 추가하고 사다리. 열 70 ° C 5 분 동안 얼음에 즉시 차가운에서. CA의 ution! ALD의 내용 (에티 디움 브로마이드 및 포름 아미드, 자료 참조)는 각각, 돌연변이 및 부식성이다. </li><li> 샘플을로드하고 가끔 버퍼 재활용 약 1 시간 동안 50 V에서 젤을 실행합니다. UV 시각화 또는 젤 이미징에 의해 RNA의 분류 패턴을 확인합니다. 28S와 18S rRNAs과 된 tRNA에 해당하는 개별 밴드를 인식 (그림 1 참조). </li></ol></li><li> -80 ° C에서 북부 분석 또는 저장 RNA 진행합니다. </li></ol> 3 변성 아크릴 아마이드 젤 준비 <ol><li> 이 분류 단계에 대한 작은 수직 전기 영동 장치 (플레이트의 크기 8cm X 9cm, 빗 두께 0.75 mm)를 사용합니다. </li><li> 주조 프레임에서 함께 깨끗한 안경을 조립합니다. </li><li> (1 19) MOPS 1X 용액, 7 M 우레아 10 % 아크릴 아미드 / 비스 - 아크릴 아미드 10 ㎖를 준비합니다. 바로 주입하기 전에, 10 %의과 황산 암모늄 100 ㎕ TEMED 및 10 μL를 추가하고 신속 용액을 혼합한다.주의! 아크릴 아마이드는 신경 독성 및 발암 물질이다. </li><li> 유리판 사이에 젤을 부어 거품을 피하기 위해 신중하게 잘 빗를 삽입합니다. 젤은 사용하기 전에 적어도 45 분 동안 실온에서 중합 보자. 또한, 겔 O / N, 물에 젖은 여과지에 싸여 사란 랩에 밀봉 저장합니다. </li></ol> 4 샘플 준비 <ol><li> 나누어지는 0.5-20 각 샘플에 대한 총 RNA ㎍의. 볼륨 3-4 μl를 초과하면, 진공은 샘플을 건조. </li><li> 크기 결정 용 마커로서 (제조 섹션 4.3 및 4.4 참조), 샘플에 평행 방사성 표지 저역 사다리의 분취 량 (20-30 CPS)를 실행. 단계 4.5에 기재된 바와 같이, 샘플들에 병렬로 취급. </li><li> 사다리 : 10 bp의 단계 사다리의 0.1 μg을 사용하여 인산 앞으로 반응을 설정합니다. 30 분 동안 37 ° C에서 품어 20 mM의 FC에 에틸렌 디아민 테트라 아세트산 (EDTA)를 추가하여 반응을 중지합니다. </li><li> EtOH로 침전 / 세척, 건조 공기에 의해 정화DDH 2 O (약 100 μL).에 재현 탁주의! 32 P 방사성 소스입니다. </li><li> 각 샘플에 아크릴 아미드 파란색 염료 (ABD)의 동일한 볼륨을 추가합니다. 5 분 동안 80 ° C에서 가열에 의해 변성 및로드.주의까지 얼음에 멋지다! 포름 아미드 (ABD의 내용이) 부식성이다. </li></ol> (5) 전기 영동 분획 <ol><li> 캐스팅 지원을 유리판을 제거하고 적절하게 전기 영동 셀을 조립한다. 충분한 실행 버퍼 (RB)와 모두 내부 및 외부 챔버를 입력합니다. </li><li> 부드럽게 빗를 제거하고 10 분 동안 200 V에서 젤을 미리 실행합니다. 로드 샘플 전에 주사기를 통해 일부 RB를 분출하여 우물에서 요소 예금을 씻어. </li><li> 플랫 팁을 사용하여 각 우물의 바닥에서 4.5 단계에서 신중 충 샘플. 거꾸로 실행을 방지하기 위해 양극과 음극 연결을 확인합니다. 샘플이 5 분 동안 100 V에서 젤을 입력 한 후, 난V. 200에 전압을 ncrease </li><li> 약 7cm의 분별 길이를 들어, 45 분 - 장기적으로는 충분하다. 젤을 오버플로 브로 모 페놀 블루 (ABD에서 추적 안료를)하지 마십시오. </li><li> 선택적인 단계로 에티 디움 브로마이드 (EtBr이) 염색에 의해 분류 된 긴 RNA를 겔에 - 시각화 : <ol><li> 겔의 정상에서 멀리 2cm를 잘라 짧게 DDH 2 O.에서 슬라이스를 씻어 </li><li> RB, EtBr이 0.5 μg / ml의 FC 부드러운 동거와 15 분 동안 실온에서 겔 슬라이스를 품어. </li><li> RB에서 1​​5 분 동안 젤 Destain, UV 조사 또는 겔 촬상 장거리 rRNAs 시각화. RNA 로딩과 품질 (그림 1, 패널 7).주의를 확인! 에티 디움 브로마이드가 돌연변이이다. </li></ol></li><li> 한편 작은 RNA 종을 포함하는 겔의 하부 블로 팅을 진행. </li></ol> 6 젤 블로 팅 <ol><li> 6 블롯 영역에 맞추기 위해 압지 조각과 uncharge의 상당 부분을 잘라D 나일론 막을. 용지, 막과 RB의 두 블로 팅 패드를 적 십니다. 완전히 반복 RB에서 그들을 압박하여 패드를 흡수해야합니다. </li><li> 장치에서 젤을 제거하고 주걱의 평균에 의해 안경을 엽니 다. 우물을 제거하기 위해 깨끗한 커터를 사용합니다. 젤에 젖은 와트 종이를 놓고 조심스럽게 들어 올립니다. </li><li> 겔의 자유면에 나일론 막을 놓습니다. 샘플 상태에 따라 필터의 방향을 모서리를 표시. &quot;샌드위치&quot;(3 종이 조각 각면)을 완료합니다. 가능한 모든 공기 방울을 제거하고, 표면에 오점 플라스틱 막대 롤. </li><li> 모래 바닥 카세트에이 모래 바닥 패드와 다음 사이의 오점을 놓습니다. , 모래 바닥 모듈에 카세트를 조립 RB와 챔버를 작성하고 (겔과 긍정적 인 말단 사이에 유지해야 나일론 막) 올바른 방향을 확인합니다. </li><li> 20 분 동안 20 V에서 전송합니다. 참고 : 10 분 블로 팅 모듈과 연구를 연 후, 균일 한 조건을 보장하기 위해전송을 완료하기 전에 180도 샌드위치 otate. </li></ol> 7 막 가교 <ol><li> 신선한 가교 솔루션 (XLS)의 6 ML을 준비합니다. 포화 10cm는 (나일론 막보다 더 큰) 10cm XLS.주의와 압지의 조각을 X!에 HCl (XLS의 구성 요소)이 높은 부식성이다. </li><li> 오점을 해체 젖은 3MM 필터 종이에 막 배치합니다. 참고 : RNA는 포화 종이와 직접 접촉하지 않아야합니다. 두 개의 유리판 사이의 필터 종이를 놓고 사란 랩에 포장. </li><li> DDH 2 O 세척 한 다음 2 시간 동안 60 ° C에서 막을 열. -20 ° C에서 저장 또는 하이브리드를 진행합니다. </li></ol> 8 멤브레인의 프레 하이브 리다이 제이션 <ol><li> RNA로드 (옵션 단계 5.5)을 선택되어 있으면 직접 하이브리드를 진행합니다. 아니면, 나일론 필터의 꼭대기로부터 거리 1cm 잘라 프로브 간 hybridizatio 않도록분별 긴 RNA를 ns의. </li><li> 37 ° C에서 하이브리드 솔루션 (HS) 10 ㎖를 예열. 5 분 동안 95 ° C에서 연어 정자의 1 mg의 변성 얼음에 시원하고 HS 추가 할 수 있습니다. </li><li> 혼성화 오븐에서 회전에 따라, 적어도 1 시간 동안 37 ℃에서 HS에서 필터를 배양한다. 필터의 RNA 측이 HS에 직면 해 있는지 확인합니다. </li></ol> 9 프로브 합성 <ol><li> 4.3에 설명 된대로 특정 안티센스 올리고 뉴클레오티드의 10 pmol의에 인산 앞으로 반응을 설정합니다. </li><li> (EtOH로 침전도 이상) 트리스-EDTA-염화나트륨 (TEN)의 5 볼륨이 반응 버퍼 및 G-25 세파 덱스 컬럼에 젤 배제 크로마토 그래피에 의한 합병되지 않는 뉴클레오티드의 표지 프라이머를 정화 추가합니다. 프로브 활성을 액체 섬광 계수기에 의해 평가 될 수있다. </li></ol> (10) 멤브레인 하이브리드 <ol><li> 신선한 10 ㎖의 분취 (전술 한 바와 같이 제조 및 보완)로 배출 HS를 교체합니다. 에 프로브를 가열얼음에 시원하고 새로운 HS에 추가 10 분 동안 95 ° C에서. 37 ° C ON에서 필터를 품어. </li></ol> (11) 멤브레인 세척 <ol><li> 하이브리드 솔루션을 복구 및 방사능 차폐 상자에 -20 ° C에서 보관하십시오. </li><li> 세척 버퍼 (WB)의 필터를 세척하여 실온에서 10 분 동안 철저하게 씻는다. </li><li> 필터 코너에서 잔류 방사능을 점검하기위한 가이거 뮬러 감지기를 사용합니다. 배경 배출량은 약 5 CPS 때, 박람회를 막에 진행합니다. </li></ol> (12) 신호 감지 <ol><li> 오토 라디오 그래피 필름 또는 분자 영상 화면 ON에 필터를 노출. 사진 처리 또는 디지털 변환하여 신호를 알 수있다. </li><li> 전용 정량화 소프트웨어 (ImageJ에 또는 Optiquant)에 의해 밴드의 강도를 분석 할 수 있습니다. </li></ol> (13) 멤브레인 스트립 <ol><li> 스트리핑 끓는 용액의 500 ㎖에 잠수함, 막 1 차 신호를 제거하려면다음 1 분 동안 실온에서 배양한다. 소설 (전) 하이브리드를 진행 또는 -20 ° C에서 필터를 저장합니다. </li></ol>

The authors declare that they have no competing financial interests.

RNA가 신경을 조절 통해 얽혀 닳고 닳은 우리의 감사가 지속적으로 증가하고 있지만, 신경 줄기 세포 생물학, 신경 세포의 분화 / 기능 통합, 신경 병변 및 암의 개발에 영향을 미치는 RNA 기반 circuitries의 기계적인 의미는 미개척 남아있다. 초파리는 짧은 RNA를 비 암호화 및 전사 인자가 큰 분자 플레이어로 간주되는 비경 셀룰러 경로를 해명하는 수단으로서 melanogaster 왕국 통해 이러한...

RNA 생화학는 지난 몇 년 동안 일에 극적으로 진행되는 발생했습니다. 유전자 발현의 조절에서 RNA 전위의 우리의 이해는 신규 한 RNA 기반 규제 메커니즘 3,4의 발견에 의해 이미 공지 된 전사 후 이벤트 깊은 특성화에 의해, 강력한 비 암호화 리보 - 레귤레이터 (2)의 식별 정보를 이용하여 버스트되었습니다 5. 모두 함께 이러한 연구가 허용 한 RNA 생물학 극적으로 현재 과학 풍경에 주요 연구 대상이되고, 현장을 확인합니다. 특히, 최근 몇 년 동안 우리는 분자 신경 생물학 (6), 현대 생명 과학에서 가장 역동적 인 연구 영역 중 하나에서 &quot;RNA 세계&quot;의 보급에 미치는 영향의 감각을 얻고있다. 지난 세기 지난 10 년 동안 과학 전반적인 시나리오는 RNA 간섭 7,8 발견 의해 소형 RNA를 규제 9,10의 혁명되었습니다마이크로 RNA (11)에 특정과 관련하여, 내생 적 유전자 발현의다면 발현과 조합 규제 등 거의 모든 세포 기능의 조절에 관여 작은 비 암호화 RNA를 표현. miRNA가 높은 번호가 초파리뿐만 아니라 12 ~ 15 인간의 세포에서 발견했을 때 거의 십년 AMBROS 및 Ruvkun의 연구소에 의해 예쁜 꼬마 선충에서 miRNA의 초기 발견 후, 새롭게 관심 분야에가되었습니다. 그 이후로, 다양한 형질 전환 방법 덕분에, 초파리는 miRNA의 생합성 및 활동에 대해 깊이 탐구 귀중한 생물 컨텍스트로서 서 있었다. 초파리의 miRNA가 경로를, 신진 대사 노화 신호에서 이르기-곤충 특정 또는 진화 적으로 보존 된 프로세스에 고유 한 기능을 계시했다 행동하고, 물론, 신경. 이 방향을 따라, 우리는 최근 흥미로운 공동의 소설 링크 16을 발표했다마스터 유전자 GCM / RNA 활공 경로 사이에서 발생 rrelation. 플라이 전사 인자 GCM / 글라이드 17-19 능성에 아교 대 신경 운명의 선택이 신경 전구체 20 비행 지시 세포 운명 결정의 독특한 예를 구성한다. 스물 년이 주제에 대한 오랜 연구는 GCM /를 통해 수렴 유전자 발현 조절의 다양하고 중복 입력의 발생 신경 개발 과정에서 신경 세포와 신경 교세포의 대응 사이의 섬세한 비율을 균형에 필요한 임계 값 레벨을 설정하는 21 ~ 28 활공을 강조 분명히하고있다. 우리는 DMEL-miR279 타겟팅을 통해 그 규정은 GCM의 전사 후 미세 조정 / 16 식 활공에 기여하는 또 다른 제어 수준을 나타냅니다 발견했다. 전 세계적으로 이러한 연구 선이 필요 한 특정 방법론 개선 : 년 함께 몇 가지 기술은 원래 트라를 분석하기 위해 개발itional RNA들처럼, 작은 비 코딩의 RNA를 정량화 변환 된의 RNase 보호 분석법, cDNA를 배열 29-31, 실시간 PCR 방법 32-35 및 36,37 시퀀싱 등. 다른 측면에서, 기술적 접근 방법의 재 교정이 분야에서 지속적으로 진행되는 육성하고있다. 북부 얼룩 분석 (NB, 또는 RNA 겔 블롯 분석은) 대표 인스턴스를 구성 : 그것은 크기가 결정뿐만 아니라 모두 발현 수준의 정량을 보장 이후 크게, RNA 축적을 프로파일 사용된다. 그러나, 본 방법의 본질적인 나쁨 감도는 짧은 RNA를 원한다면, 낮은 풍부한 유전자 발현 미세 튜너에인가 될 때 제한된다. 해로운 결과는 특정 생체 시료 어려운 그 응용 프로그램을 만드는 총 RNA, 많은 양의 요구 사항입니다. 이러한 이유로, 작은 RNA를 검출을위한 특정 NB 변종의 경우 38 ~ 40를 개발되어 있습니다 : 우리는 개선 된 NB 발동을 이용했다edure 41 (ENB, 향상된 북부 오), DMEL-miR279와 GCM / 활공의 전술 상호 작용을 해명하면서. 이 방법은, 카르 보디이 미드 유도체의 활동을 기반으로 화학적 가교 결합 단계에 의존 [1 - 에​​틸 3 - (3 - 디메틸 아미노 프로필) 카 보디이 미드, EDC] 고체 지지체에 핵산을 고정한다. 카르 보디이 미드 활성화 카복실 또는 포스페이트 그룹 및 아민 기 (42) 사이에 아미드 결합의 형성을 촉진하는 것으로 알려진 다기능 가교제이다. 이 속성은 나일론 막의 표면에서 그룹을 아미노하기 위해 모노 인산화 된 5&#39;-하이드 록실 그룹을 통해 공유 커플 작은 RNA들에 악용 될 수 있습니다. 얻어진 부착 구성은 다시 검출 현저한 향상 43 결과 프로브의 타겟의 혼성화의 효율을 고정화 핵산의 접근성을 높이고. 이 기술은 특정 relevanc 가정초파리 분자 연구에서 전자가있는 작은 비 암호화 RNA를 소설과 독특한 클래스의 발생이 44 떠오르고있다. 이 중, 45, 46가 순서 특정 유전자 침묵 (gene silencing)에 참여 piwi 상호 작용하는 RNA를 (piRNAs 47)의 특정 하위 유형을 구성 rasiRNAs. 이 방법의 동작 상세하게 설명 하나 rasiRNA, rasi4 중, 최초로, 마이크로 RNA-DMEL miR279 및 DMEL-miR286의 분석을 기준으로하고, 이하에서 가시화된다. 우리는 RNA (이하 1 μg)의 최소 금액에서 제대로 표현 대상도 공개 허용이 방법을, 극단으로 밀었다.

<table><tbody><tr><td>FINAL COMPOSITION/NAME</td><td>COMPANY</td><td>CATALOGUE (Stock)</td><td>COMMENTS</td></tr><tr><td colspan="4">GENERAL REQUIREMENT</td></tr><tr><td>Centrifuge, 5418</td><td>Eppendorf</td><td>5418 000.017</td><td></td></tr><tr><td>Decontaminant, RNase Away</td><td>Sigma-Aldrich</td><td>83931</td><td>Apply on glass/plasticware, wipe and rinse</td></tr><tr><td>RNase inhibitor, DEPC</td><td>Sigma-Aldrich</td><td>D5758</td><td>Hazardous //// 1609-47-8</td></tr><tr><td colspan="4">SAMPLE PREPARATION</td></tr><tr><td>Stereo Microscope, M60</td><td>Leica&amp;nbsp;</td><td></td><td></td></tr><tr><td>1X PBS Buffer</td><td></td><td></td><td></td></tr><tr><td>137 mM NaCl</td><td>Sigma-Aldrich</td><td>S3014</td><td>7647-14-5&amp;nbsp;&amp;nbsp;</td></tr><tr><td>2.7 mM KCl</td><td>Sigma-Aldrich</td><td>P9541</td><td>7447-40-7&amp;nbsp;</td></tr><tr><td>10 mM Na&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;</td><td>Sigma-Aldrich</td><td>S3264</td><td>7558-79-4&amp;nbsp;</td></tr><tr><td>1.8 mM KH&lt;sub&gt;2&lt;/sub&gt;PO&lt;sub&gt;4&lt;/sub&gt;</td><td>Sigma-Aldrich</td><td>P9791</td><td>7778-77-0&amp;nbsp;</td></tr><tr><td colspan="4">RNA EXTRACTION/ANALYSIS</td></tr><tr><td>UV-Vis Spectrophotometer</td><td>Thermo Scientific</td><td>Nanodrop 2000</td><td></td></tr><tr><td>Gel Imager, ChemiDoc XRS+</td><td>Biorad</td><td>170-8265</td><td></td></tr><tr><td>Horizontal Electrophoresys, Mini-Sub Cell GT</td><td>BioRad</td><td>170-4487EDU</td><td></td></tr><tr><td>RNA extraction reagent, TRIzol Reagent</td><td>Life Technologies</td><td>15596026</td><td>Hazardous</td></tr><tr><td>PCA (25:24:1), 1:1 for extraction</td><td>Sigma-Aldrich</td><td>77617</td><td>136112-00-0</td></tr><tr><td>Chlorophorm, 1:1 for extraction</td><td>Sigma-Aldrich</td><td>C2432</td><td>67-66-3&amp;nbsp;&amp;nbsp;</td></tr><tr><td>EtOH, 2.5 vol. for precipitation, 70% for washing</td><td>Sigma-Aldrich</td><td>59844</td><td>64-17-5&amp;nbsp;</td></tr><tr><td>Gene Ruler 1Kb DNA Ladder</td><td>Thermo Scientific</td><td>SM0311</td><td></td></tr><tr><td>Stop Mix</td><td></td><td></td><td></td></tr><tr><td>300 mM NaOAc, pH 5.5</td><td>Sigma-Aldrich</td><td>S2889</td><td>127-09-3</td></tr><tr><td>1x RSB Solution</td><td></td><td></td><td></td></tr><tr><td>2% sodium dodecyl sulfate (SDS)</td><td>Sigma-Aldrich</td><td>71736</td><td>Never cool down SDS to avoid&amp;nbsp; precipitation //// 151-21-3</td></tr><tr><td>2 mg/ml Proteinase K</td><td>Roche Applied Science</td><td>0-3115828001</td><td>EC 3.4.21.64 9</td></tr><tr><td>10X Reticulocyte Standard Buffer (RSB)</td><td></td><td></td><td></td></tr><tr><td>100 mM Tris-Cl, pH 7.4</td><td>Sigma-Aldrich</td><td>T5941</td><td>1185-53-1&amp;nbsp;&amp;nbsp;</td></tr><tr><td>100 mM NaCl</td><td>Sigma-Aldrich</td><td>S3014</td><td>7647-14-5&amp;nbsp;&amp;nbsp;</td></tr><tr><td>30 mM MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma-Aldrich</td><td>M8266</td><td>7786-30-3</td></tr><tr><td>Denaturing Agarose Gel</td><td></td><td></td><td></td></tr><tr><td>1.2% Agarose</td><td>Sigma-Aldrich</td><td>A9539</td><td>Let the gel solidify for at least 1 hr //// 9012-36-2</td></tr><tr><td>10X MOPS Buffer</td><td></td><td></td><td></td></tr><tr><td>0.2 M MOPS sodium salt, pH 7</td><td>Sigma-Aldrich</td><td>M9381</td><td>Do not confuse MOPS sodium salt with MOPS //// 71119-22-7</td></tr><tr><td>Agarose Loading Dye</td><td></td><td></td><td></td></tr><tr><td>1x MOPS Buffer</td><td></td><td></td><td></td></tr><tr><td>3% formaldehyde</td><td>Sigma-Aldrich</td><td>F8775</td><td>Hazardous //// 50-00-0</td></tr><tr><td>50% formamide</td><td>Sigma-Aldrich</td><td>47670</td><td>Hazardous //// 75-12-7</td></tr><tr><td>Ethidium bromide (EtBr) 30 &amp;mu;g/ml</td><td>Sigma-Aldrich</td><td>E1510</td><td>Hazardous //// 1239-45-8</td></tr><tr><td>Bromophenol blue&amp;nbsp;</td><td>Sigma-Aldrich</td><td>B0126</td><td>115-39-9&amp;nbsp;</td></tr><tr><td colspan="4">SMALL RNA FRACTIONATION</td></tr><tr><td>Flat gel loading tips</td><td>Life Technologies</td><td>LC1002</td><td></td></tr><tr><td>Savant SpeedVac Concentrator</td><td>Thermo Scientific&amp;nbsp;</td><td>DNA120</td><td></td></tr><tr><td>Vertical Electrophoresis, Mini-PROTEAN Tetra Cell&amp;nbsp;</td><td>Biorad</td><td>165-8000</td><td></td></tr><tr><td>Denaturing Acrylamide Gel</td><td></td><td></td><td></td></tr><tr><td>10% acrylamide/bis-acrylamide (19:1)</td><td>Sigma-Aldrich</td><td>A3449</td><td>Hazardous. Let the gel polymerize for 45 min before use</td></tr><tr><td>1x TBE Buffer (or 1x MOPS Buffer)</td><td></td><td></td><td></td></tr><tr><td>7 M urea</td><td>Sigma-Aldrich</td><td>U6504</td><td>57-13-6</td></tr><tr><td>0.1% ammonium persulfate</td><td>Sigma-Aldrich</td><td>215589</td><td>7727-54-0&amp;nbsp;</td></tr><tr><td>0.1% TEMED</td><td>Sigma-Aldrich</td><td>T9281</td><td>110-18-9</td></tr><tr><td>Gene Ruler Ultra Low Range DNA Ladder (10 bp-step)</td><td>Thermo Scientific</td><td>SM1211</td><td>Label 0.1 &amp;mu;g, as described in the &quot;probe labeling&quot; reaction</td></tr><tr><td>Acrylamide Blue Dye&amp;nbsp;</td><td></td><td></td><td></td></tr><tr><td>50% formamide</td><td>Sigma-Aldrich</td><td>47670</td><td>Hazardous //// 75-12-7</td></tr><tr><td>Bromophenol blue</td><td>Sigma-Aldrich</td><td>B0126</td><td>115-39-9&amp;nbsp;</td></tr><tr><td>Running Buffer (RB)</td><td></td><td></td><td></td></tr><tr><td>1x MOPS Buffer&amp;nbsp;</td><td></td><td></td><td></td></tr><tr><td>Alternative RB: 1x TBE Buffer</td><td></td><td></td><td></td></tr><tr><td>1x TBE Buffer</td><td></td><td></td><td></td></tr><tr><td>5X TBE</td><td></td><td></td><td></td></tr><tr><td>445 mM Tris-base</td><td>Sigma-Aldrich</td><td>T1503</td><td>77-86-1&amp;nbsp;</td></tr><tr><td>445 mM boric acid</td><td>Sigma-Aldrich</td><td>B7901</td><td>10043-35-3</td></tr><tr><td>20 mM EDTA</td><td>Sigma-Aldrich</td><td>EDS</td><td>60-00-4&amp;nbsp;&amp;nbsp;</td></tr><tr><td>Gel Staining Solution</td><td></td><td></td><td></td></tr><tr><td>Ethidium bromide 0.5 &amp;mu;g/ml</td><td>Sigma-Aldrich</td><td>E1510</td><td>Hazardous //// 1239-45-8</td></tr><tr><td>1x RB</td><td></td><td></td><td>Stain for 15 min with EtBr, destain for 15 min w/o EtBr</td></tr><tr><td colspan="4">BLOTTING</td></tr><tr><td>3MM Whatman paper</td><td>Sigma-Aldrich</td><td>Z270849</td><td></td></tr><tr><td>Neutral Nylon Membrane, Hybond NX</td><td>GE Healthcare Life Science</td><td>RPN203T</td><td>Photosensitive</td></tr><tr><td colspan="4">CROSSLINKING</td></tr><tr><td>Crosslinking Solution (XLS)</td><td></td><td></td><td></td></tr><tr><td>1% 1-methylimidazole (v/v)</td><td>Sigma-Aldrich</td><td>336092</td><td>Always prepare a fresh aliquot of XLS //// 616-47-7</td></tr><tr><td>12.5 mM HCl</td><td>Sigma-Aldrich</td><td>H1758</td><td>Hazardous //// 7647-01-0</td></tr><tr><td>3.1% EDC (w/v)</td><td>Sigma-Aldrich</td><td>3450</td><td>25952-53-8&amp;nbsp;&amp;nbsp;</td></tr><tr><td colspan="4">(PRE)-HYBRIDIZATION</td></tr><tr><td>Liquid Scintillation Counter&amp;nbsp;</td><td>Beckmann</td><td>LS 6500</td><td></td></tr><tr><td>Sheared Salmon Sperm, 0.1 mg/ml&amp;nbsp;</td><td>Life Technologies</td><td>AM9680</td><td></td></tr><tr><td>rasi4 anti-sense probe</td><td></td><td></td><td>5&#039; CGGUGUUCGACAGUUCCUCGGG -3&#039;</td></tr><tr><td>5s-rRNA anti-sense probe</td><td></td><td></td><td>5&#039;-CAACACGCGGTGTTCCCAAGCCG-3&#039;</td></tr><tr><td>Dmel-miR279 anti-sense probe</td><td></td><td></td><td>5&#039;-TTAATGAGTGTGGATCTAGTCA-3&#039;</td></tr><tr><td>Dmel-miR286 anti-sense probe</td><td></td><td></td><td>5&#039;-AGCACGAGTGTTCGGTCTAGTCA-3&#039;</td></tr><tr><td>Purification Kit, Illustra MicroSpin G-25 Columns</td><td>GE Healthcare Life Science</td><td>27-5325-01</td><td></td></tr><tr><td>(Pre)-Hybridization Solution (HS)</td><td></td><td></td><td></td></tr><tr><td>0.5% SDS</td><td>Sigma-Aldrich</td><td>71736</td><td>151-21-3&amp;nbsp;</td></tr><tr><td>5x Denhardt&#039;s Solution</td><td></td><td></td><td></td></tr><tr><td>20X SSPE</td><td></td><td></td><td></td></tr><tr><td>3.6 M NaCl</td><td>Sigma-Aldrich</td><td>S3014</td><td>7647-14-5&amp;nbsp;&amp;nbsp;</td></tr><tr><td>0.2 M sodium phosphate</td><td>Sigma-Aldrich</td><td>342483</td><td>7601-54-9&amp;nbsp;&amp;nbsp;</td></tr><tr><td>20 mM EDTA (pH 8.0)</td><td>Sigma-Aldrich</td><td>EDS</td><td>&amp;nbsp;60-00-4&amp;nbsp;&amp;nbsp;</td></tr><tr><td>50x Denhardt&#039;s Solution</td><td></td><td></td><td></td></tr><tr><td>1% Ficoll 400 (w/v)</td><td>Sigma-Aldrich</td><td>F2637</td><td>26873-85-8</td></tr><tr><td>1% Polyvinylpyrrolidone</td><td>Sigma-Aldrich</td><td>PVP40</td><td>9003-39-8</td></tr><tr><td>1% BSA</td><td>Sigma-Aldrich</td><td>A7906</td><td>9048-46-8&amp;nbsp;&amp;nbsp;</td></tr><tr><td>1X TEN Buffer</td><td></td><td></td><td></td></tr><tr><td>10 mM Tris-Cl (pH 8.0)</td><td>Sigma-Aldrich</td><td>T1503</td><td>77-86-1&amp;nbsp;</td></tr><tr><td>100 mM NaCl</td><td>Sigma-Aldrich</td><td>S3014</td><td>7647-14-5&amp;nbsp;&amp;nbsp;</td></tr><tr><td>1 mM EDTA (pH 8.0)</td><td>Sigma-Aldrich</td><td>EDS</td><td>60-00-4&amp;nbsp;&amp;nbsp;</td></tr><tr><td>Probe Labelling</td><td></td><td></td><td></td></tr><tr><td>0.4 &amp;mu;M oligonucleotide</td><td></td><td></td><td></td></tr><tr><td>1.5 &amp;mu;l Ci/&amp;mu;l [&amp;gamma;-32P] ATP</td><td>Perkin Elmer</td><td>NEG002A</td><td>Hazardous //// 51963-61-2</td></tr><tr><td>1x T4 Polynucleotide Kinase Buffer</td><td>Biolabs</td><td>B0201</td><td></td></tr><tr><td>T4 Polynucleotide Kinase 0.5 units/&amp;mu;l</td><td>Biolabs</td><td>M0201</td><td>EC 2.7.1.78</td></tr><tr><td colspan="4">WASHING</td></tr><tr><td>Geiger Mueller Detectors</td><td>Canberra Industries</td><td>MCB2/CPS &amp;ndash; EM77021</td><td></td></tr><tr><td>Washing Buffer (WB), 2x SSPE</td><td></td><td></td><td></td></tr><tr><td>Stringent Washing Buffers</td><td></td><td></td><td></td></tr><tr><td>0.2x SSPE</td><td></td><td></td><td></td></tr><tr><td>2x SSPE, 0.5% SDS</td><td></td><td></td><td></td></tr><tr><td>0.2x SSPE, 0.5% SDS</td><td></td><td></td><td></td></tr><tr><td colspan="4">SIGNAL DETECTION</td></tr><tr><td>PharosFX Plus System</td><td>Biorad</td><td>170-9460</td><td></td></tr><tr><td>Image J</td><td>Freely available</td><td></td><td></td></tr><tr><td>Quantity One</td><td>Biorad</td><td></td><td></td></tr><tr><td>X-ray films , BioMax XAR</td><td>Sigma-Aldrich</td><td>F5888</td><td>Photosensitive</td></tr><tr><td>Developer for X-ray films</td><td>Sigma-Aldrich</td><td>P7042</td><td></td></tr><tr><td>Fixer for X-ray films</td><td>Sigma-Aldrich</td><td>P7167</td><td></td></tr><tr><td colspan="4">STRIPPING</td></tr><tr><td>Stripping Solution</td><td></td><td></td><td></td></tr><tr><td>10 mM Tris-HCl pH 8.8</td><td>Sigma-Aldrich</td><td>T1503</td><td>77-86-1&amp;nbsp;</td></tr><tr><td>5 mM EDTA</td><td>Sigma-Aldrich</td><td>EDS</td><td>60-00-4&amp;nbsp;&amp;nbsp;</td></tr><tr><td>0.1% SDS</td><td>Sigma-Aldrich</td><td>71736</td><td>Add SDS after boiling to avoid foaming //// 151-21-3</td></tr></tbody></table>

enhanced northern blot detection of small rna species in drosophila melanogaster

지난 수십 RNA 수준에서 유전자 발현을 제어 메커니즘 주위 과학적 관심 폭발을 보아왔다. 분자 생물학의이 지점은 크게 전사 후 조절에 중요​​한 선수로의 RNA를 비 암호화의 발견에 의해 연료를 공급하고있다. 이러한 혁신적인 관점은 높은 처리량 레벨 (게놈 전체의 식별) 또는 단일 후보 분석 (특정 종의 정상 상태 축적)으로 모두 함께 짧은 RNA를 발현 프로파일 링에 대한 강력한 기술의 개발에 의해 촉발되었다. 여러 첨단 전략 투여 또는 도피 분자를 시각화 현재 사용할 수 있지만, 북부 오 점 분석은 RNA 발현의 즉각적이고 정확한 평가를위한 분자 생물학 자격이 접근 남아있다. 이는 많은 경우에 더 정교하고 고가의 기술의 응용을 향해 첫 단계는 쉽게 통찰력을 얻기 위해 우선적 인 방법 남아 나타내고RNA 생물학에. 여기에서 우리는 수동으로 애벌레 / 성인 조직을 해부 또는 체외 배양 된 세포에서, 전체 배아를 melanogaster 초파리에서 약하게 발현 마이크로 RNA (또는 다른 작은 규제 RNA 종)을 검출 (북 오 강화) 효율적인 프로토콜 개요. RNA의 매우 제한된 양이 필요하고 계측법 절연 세포가 될 수있는 흐름 물질의 사용은 또한 예상된다.

도 1에서 설명 텍스트 및 개략적 전반적인 절차에 따라, 우리는 상이한 기원의 복잡한 RNA 샘플로부터 RNA를 작은 식을 평가 하였다. (: 아가 로스 젤 분류 변성 선택적 단계) 두 번에로드 그림 1에서 제시 한 실험에서, RNA는 무결성 검사 테 K 추출하여 초파리 슈나이더의이 세포로부터 분리되었다. 겔의 절반은 중립 멤브레인에 블 롯팅시키고, 화학적 가교 결합에 의해...

Watch this Scientific Journal Video about Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster at JoVE.com

Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster

이 책의 목적은 시각화 및 초파리에서 추출한 RNA에 향상된 북부 얼룩 프로토콜의 동작 단계를 논의 배아, 세포 및 조직을 melanogaster하는 것입니다. 이 프로토콜은 작은 RNA 종의 효율적인 검출에 특히 유용하다.

작은 RNA 종의 북부 오 탐지의 향상된<em&gt; 초파리 Melanogaster</em

The last decades have witnessed the explosion of scientific interest around gene expression control mechanisms at the RNA level. This branch of molecular ...

enhanced-northern-blot-detection-small-rna-species-drosophila

Research

JoVE Journal

Biology

Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster

24.0K 조회수.  Institut de Génétique et de Biologie Moléculaire et Cellulaire.  이 책의 목적은 시각화 및 초파리에서 추출한 RNA에 향상된 북부 얼룩 프로토콜의 동작 단계를 논의 배아, 세포 및 조직을 melanogaster하는 것입니다. 이 프로토콜은 작은 RNA 종의 효율적인 검출에 특히 유용하다. 

비디오: Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster

High Resolution Fluorescent In Situ Hybridization in Drosophila Embryos and Tissues Using Tyramide Signal Amplification

In our efforts to determine the patterns of expression and subcellular localization of Drosophila RNAs on a genome-wide basis, and in a variety of tissues, we have developed numerous modifications and improvements to our original fluorescent in situ hybridization (FISH) protocol. To facilitate throughput and cost effectiveness, all steps, from probe generation to signal detection, are performed using exon 96-well microtiter plates. Digoxygenin (DIG)-labelled antisense RNA probes are produced using either cDNA clones or genomic DNA as templates. After tissue fixation and permeabilization, probes are hybridized to transcripts of interest and then detected using a succession of anti-DIG antibody conjugated to biotin, streptavidin conjugated to horseradish peroxidase (HRP) and fluorescently conjugated tyramide, which in the presence of HRP, produces a highly reactive intermediate that binds to electron dense regions of immediately adjacent proteins. These amplification and localization steps produce a robust and highly localized signal that facilitates both cellular and subcellular transcript localization. The protocols provided have been optimized to produce highly specific signals in a variety of tissues and developmental stages. References are also provided for additional variations that allow the simultaneous detection of multiple transcripts, or transcripts and proteins, at the same time.

High Resolution Fluorescent In Situ Hybridization in Drosophila Embryos and Tissues Using Tyramide Signal Amplification

The described RNA in situ hybridization protocol allows the detection of RNA in whole Drosophila embryos or dissected tissues. Using 96-well microtiter plates and tyramide signal amplification, transcripts can be detected at high resolution, sensitivity, and throughput, and at a relatively low cost.

높은 해상도 교 잡 형광 제자리에 초파리 태아와 Tyramide 신호 증폭을 사용 하 여 조직에서

In our efforts to determine the patterns of expression and subcellular localization of Drosophila RNAs on a genome-wide basis, and in a variety of ...

연구

유전학

RNA Blot Analysis for the Detection and Quantification of Plant MicroRNAs

MicroRNAs (miRNAs) are a class of endogenously expressed non-coding, ~21 nt small RNAs involved in the regulation of gene expression in both plants and animals. Most miRNAs act as negative switches of gene expression targeting key genes. In plants, primary miRNAs (pri-miRNAs) transcripts are generated by RNA polymerase II, and they form varying lengths of stable stem-loop structures called pre-miRNAs. An endonuclease, Dicer-like1, processes the pre-miRNAs into miRNA-miRNA* duplexes. One of the strands from miRNA-miRNA* duplex is selected and loaded onto Argonaute 1 protein or its homologs to mediate the cleavage of target mRNAs. Although miRNAs are key signaling molecules, their detection is often carried out by less than optimal PCR-based methods instead of a sensitive northern blot analysis. We describe a simple, reliable, and extremely sensitive northern method that is ideal for the quantification of miRNA levels with very high sensitivity, literally from any plant tissue. Additionally, this method can be used to confirm the size, stability and the abundance of miRNAs and their precursors.

This method demonstrates use of the northern hybridization technique to detect miRNAs from total RNA extract.

식물 MicroRNAs의 검출 및 정량화를 위한 RNA 블롯 분석

MicroRNAs (miRNAs) are a class of endogenously expressed non-coding, ~21 nt small RNAs involved in the regulation of gene expression in both plants and ...

생화학

Isolation and Purification of Drosophila Peripheral Neurons by Magnetic Bead Sorting

The Drosophila peripheral nervous system (PNS) is a powerful model for investigating the complex processes of neuronal development and dendrite morphogenesis at the functional and molecular levels. To aid in these analyses, we have developed a strategy for the isolation of a subclass of PNS neurons called dendritic arborization (da) neurons that have been widely used for studying dendrite morphogenesis1,2. These neurons are very difficult to isolate as a pure population, due in part to their extremely low occurrence and their difficult-to-reach location below the tough chitinous larval cuticle. Our newly developed method overcomes these challenges, and is based on a fast and specific cell enrichment using antibody-coated magnetic beads. For our magnetic bead sorting studies, we have used age-matched third instar larvae expressing a mouse CD8 tagged GFP fusion protein (UAS-mCD8-GFP)3 under the control of either the class IV dendritic arborization (da) neuron-specific pickpocket (ppk)-GAL4 driver4 or the control of the pan-da neuron-specific GAL421-7 driver5. Although this protocol has been optimized for isolating PNS cells which are attached to the inner wall of the larval cuticle, by varying a few parameters, the same protocol could be used to isolate many different cell types attached to the cuticle at larval or pupal stages of development (e.g. epithelia, muscle, oenocytes etc.), or other cell types from larval organs depending upon the GAL4-specific driver expression pattern. The RNA isolated by this method is of high quality and can be readily used for downstream genomic analyses such as microarray gene expression profiling studies. This approach offers a powerful new tool to perform studies on isolated Drosophila dendritic arborization (da) neurons thereby providing novel insights into the molecular mechanisms underlying dendrite morphogenesis.

Isolation and Purification of Drosophila Peripheral Neurons by Magnetic Bead Sorting

In this video-article we present a method for the isolation and purification of Drosophila peripheral neurons using a fast magnetic bead assisted cell sorting strategy. RNA obtained from the isolated cells can be readily used for downstream applications including microarray analyses.

의 분리 및 정제 Drosophila</em마그네틱 비드별로 정렬> 주변 뉴런

The Drosophila peripheral nervous system (PNS) is a powerful model for investigating the complex processes of neuronal development and dendrite ...

생물학

Single Nucleotide Polymorphism-sensitive FISH Detection of Locus-specific Ribosomal RNA Transcription in Drosophila melanogaster

In order to ensure sufficient ribosomal RNA (rRNA) is transcribed for ribosome function, genomes contain hundreds of tandem duplications of the sequences that encode rRNAs, composing regions called ribosomal DNA (rDNA) loci. Many organisms' genomes contain more than one rDNA locus distributed across different chromosomes, and rRNA may be transcribed from multiple rDNA loci or only a single locus. Changes in rRNA transcription sources often indicate ribosomal distress. However, the homogeneity of rRNA obstructs distinguishing if rRNA is transcribed from multiple or a single rDNA locus. Here, we describe a method that uses single nucleotide polymorphism-sensitive fluorescence in situ hybridization (SNP-FISH) to distinguish rRNA transcription between Drosophila melanogaster rDNA loci on the X and Y chromosomes. This method leverages locus-specific rRNA variants to enable easy detection of the source of rRNA transcription with single-cell resolution. This assay can be applied to any Drosophila cell type and may be adapted for use in other systems.

The protocol describes single nucleotide polymorphisms-sensitive fluorescence in situ hybridization (SNP-FISH) method to distinguish ribosomal RNA transcripts derived from the X or Y chromosome ribosomal DNA locus in Drosophila melanogaster.

Single Nucleotide Polymorphism-sensitive FISH: Drosophila melanogaster에서 유전자좌 특이적 리보솜 RNA 전사 검출

In order to ensure sufficient ribosomal RNA (rRNA) is transcribed for ribosome function, genomes contain hundreds of tandem duplications of the sequences ...

RNAi Interference by dsRNA Injection into Drosophila Embryos

Genetic screening is one of the most powerful methods available for gaining insights into complex biological process 1. Over the years many improvements and tools for genetic manipulation have become available in Drosophila 2. Soon after the initial discovery by Frie and Mello 3 that double stranded RNA can be used to knockdown the activity of individual genes in Caenorhabditis elegans, RNA interference (RNAi) was shown to provide a powerful reverse genetic approach to analyze gene functions in Drosophila organ development 4, 5.
Many organs, including lung, kidney, liver, and vascular system, are composed of branched tubular networks that transport vital fluids or gases 6, 7. The analysis of Drosophila tracheal formation provides an excellent model system to study the morphogenesis of other tubular organs 8. The Berkeley Drosophila genome project has revealed hundreds of genes that are expressed in the tracheal system. To study the molecular and cellular mechanism of tube formation, the challenge is to understand the roles of these genes in tracheal development. Here, we described a detailed method of dsRNA injection into Drosophila embryo to knockdown individual gene expression. We successfully knocked down endogenous dysfusion(dys) gene expression by dsRNA injection. Dys is a bHLH-PAS protein expressed in tracheal fusion cells, and it is required for tracheal branch fusion 9, 10. dys-RNAi completely eliminated dys expression and resulted in tracheal fusion defect. This relatively simple method provides a tool to identify genes requried for tissure and organ development in Drosophila.

RNAi Interference by dsRNA Injection into Drosophila Embryos

RNA interference has been proven very effective to analyze gene function in Drosophila tracheal development. A detailed protocol used by Jiang lab to inject dsRNA into fly embryos to knockdown gene expression is illustrated. This technique has the potential for screening genes required for tissue and organ development in Drosophila.

dsRNA 주입하여 RNAi 간섭에 Drosophila 태아

Genetic screening is one of the most powerful methods available for gaining insights into complex biological process 1. Over the years many improvements ...

Detection and Quantification of Single mRNA Molecules in Drosophila(초파리에서 단일 mRNA 분자의 검출 및 정량화)

Studying Muscle Transcriptional Dynamics at Single-molecule Scales in Drosophila

Skeletal muscles are large syncytia made up of many bundled myofibers that produce forces and enable body motion. Drosophila is a classical model to study muscle biology. The combination of both Drosophila genetics and advanced omics approaches led to the identification of key conserved molecules that regulate muscle morphogenesis and regeneration. However, the transcriptional dynamics of these molecules and the spatial distribution of their messenger RNA within the syncytia cannot be assessed by conventional methods. Here we optimized an existing single-molecule RNA fluorescence in situ hybridization (smFISH) method to enable the detection and quantification of individual mRNA molecules within adult flight muscles and their muscle stem cells. As a proof of concept, we have analyzed the mRNA expression and distribution of two evolutionary conserved transcription factors, Mef2 and Zfh1/Zeb. We show that this method can efficiently detect and quantify single mRNA molecules for both transcripts in the muscle precursor cells, adult muscles, and muscle stem cells.

저자 스포트라이트: Investigating mRNA Spatial Distribution in Drosophila Muscle Tissue 

Drosophila is a well-established model for studying key molecules that regulate myogenesis. However, current methods are insufficient to determine mRNA transcriptional dynamics and spatial distribution within syncytia. To address this limitation, we optimized an RNA fluorescence in situ hybridization method allowing the detection and quantification of mRNAs at a single-molecule scale.

Studying Muscle Transcriptional Dynamics at Single-molecule Scales in Drosophila (초파리의 단일 분자 스케일에서 근육 전사 역학 연구)

Skeletal muscles are large syncytia made up of many bundled myofibers that produce forces and enable body motion. Drosophila is a classical model to study ...

발생학

Isolation of Drosophila melanogaster Testes

The testes of Drosophila melanogaster provide an important model for the study of stem cell maintenance and differentiation, meiosis, and soma-germline interactions. Testes are typically isolated from adult males 0-3 days after eclosion from the pupal case. The testes of wild-type flies are easily distinguished from other tissues because they are yellow, but the testes of white mutant flies, a common genetic background for laboratory experiments are similar in both shape and color to the fly gut. Performing dissection on a glass microscope slide with a black background makes identifying the testes considerably easier. Testes are removed from the flies using dissecting needles. Compared to protocols that use forceps for testes dissection, our method is far quicker, allowing a well-practiced individual to dissect testes from 200-300 wild-type flies per hour, yielding 400-600 testes. Testes from white flies or from mutants that reduce testes size are harder to dissect and typically yield 200-400 testes per hour.

Isolation of Drosophila melanogaster Testes

Drosophila melanogaster testes can be rapidly and efficiently isolated from adult males using dissecting needles. With practice, one can readily isolate in one or two days an amount of testes sufficient for the analysis of DNA or RNA by high throughput sequencing or more traditional molecular biology methods or of protein for antibody- or enzyme-based assays.

의 분리 Drosophila melanogaster Testes

The testes of Drosophila melanogaster provide an important model for the study of stem cell maintenance and differentiation, meiosis, and soma-germline ...

Whole Mount RNA Fluorescent in situ Hybridization of Drosophila Embryos

Assessing the expression pattern of a gene, as well as the subcellular localization properties of its transcribed RNA, are key features for understanding its biological function during development. RNA in situ hybridization (RNA-ISH) is a powerful method used for visualizing RNA distribution properties, be it at the organismal, cellular or subcellular levels 1. RNA-ISH is based on the hybridization of a labeled nucleic acid probe (e.g. antisense RNA, oligonucleotides) complementary to the sequence of an mRNA or a non-coding RNA target of interest 2. As the procedure requires primary sequence information alone to generate sequence-specific probes, it can be universally applied to a broad range of organisms and tissue specimens 3. Indeed, a number of large-scale ISH studies have been implemented to document gene expression and RNA localization dynamics in various model organisms, which has led to the establishment of important community resources 4-11. While a variety of probe labeling and detection strategies have been developed over the years, the combined usage of fluorescently-labeled detection reagents and enzymatic signal amplification steps offer significant enhancements in the sensitivity and resolution of the procedure 12. Here, we describe an optimized fluorescent in situ hybridization method (FISH) employing tyramide signal amplification (TSA) to visualize RNA expression and localization dynamics in staged Drosophila embryos. The procedure is carried out in 96-well PCR plate format, which greatly facilitates the simultaneous processing of large numbers of samples.

Whole Mount RNA Fluorescent in situ Hybridization of Drosophila Embryos

Here we describe a whole-mount fluorescent in situ hybridization (FISH) protocol for determining the expression and localization properties of RNAs expressed during embryogenesis in the fruit fly, Drosophila melanogaster.

작은 RNA 종의 북부 오 탐지의 향상된

요약

더 많은 비디오 탐색

이 비디오의 챕터

높은 해상도 교 잡 형광 제자리에 초파리 태아와 Tyramide 신호 증폭을 사용 하 여 조직에서

식물 MicroRNAs의 검출 및 정량화를 위한 RNA 블롯 분석

의 분리 및 정제 Drosophila 주변 뉴런

Single Nucleotide Polymorphism-sensitive FISH: Drosophila melanogaster에서 유전자좌 특이적 리보솜 RNA 전사 검출

dsRNA 주입하여 RNAi 간섭에 Drosophila 태아

Studying Muscle Transcriptional Dynamics at Single-molecule Scales in Drosophila (초파리의 단일 분자 스케일에서 근육 전사 역학 연구)

Studying Muscle Transcriptional Dynamics at Single-molecule Scales in Drosophila (초파리의 단일 분자 스케일에서 근육 전사 역학 연구)

Studying Muscle Transcriptional Dynamics at Single-molecule Scales in Drosophila (초파리의 단일 분자 스케일에서 근육 전사 역학 연구)

의 분리 Drosophila melanogaster Testes

전체 마운트 RNA 형광