This work was generously supported by 1R21AI129881-01 (to T.M.C.), start-up funds from the National Emerging Infectious Diseases Laboratories, and the Boston University School of Medicine.

Serum samples used in this study were obtained from human participants of a cohort from Columbia. Sample collection was approved by the internal review board (IRB) at Universidad de Pamplona (Columbia, South America) and Los Potios Hospital8. The samples were anonymously provided and investigators had no access to patient information. The serum samples were checked for the DENV serotype. The samples were further confirmed to neutralize DENV infection in vitro. For control, serum samples from healthy individuals (HC) from the USA were used.
NOTE: This protocol can be used to examine the ADE of ZIKV replication in any human cell type expressing the Fc&#947; receptor. The protocol consists of three parts (Figure 1).
1. Cell Seeding and Infection Setup
NOTE: For this particular study, human primary macrophages or U937 myelomonocytic cell line (ATCC-CRL-1593.2) were used. The cells were maintained in RPMI growth medium supplemented with 10% fetal bovine serum (FBS) at a 37 &#176;C incubator with 5% carbon dioxide (CO2). All the steps were carried out in a biosafety level 2 (BSL-2) biosafety cabinet in sterile conditions.
<ol>
	<li>Seed 3 x 104 cells per well in a sterile flat-bottom 96-well plate along with 100 &#181;L of medium and place them in the 37 &#176;C incubator with 5% CO2.</li>
	<li>After seeding the cells, thaw serum samples at room temperature and make 10-fold serial dilutions (i.e., 1/10, 1/100, 1/1,000, 1/10,000) by mixing the samples in serum-free medium. Aliquot the dilutions into a sterile 96-well plate. Use the virus without serum as an additional control.</li>
	<li>Thaw the ZIKV stock at 37 &#176;C in a water bath for 1 - 2 min and quickly transfer them to ice for future use.</li>
	<li>Add a 0.1 multiplicity of infection (MOI) equivalent amount of ZIKV strain MR766 to the serum aliquots. 
	NOTE: Make sure that the dilution factor remains constant and the total volume is ~200 &#181;L; that is enough for triplicates of each treatment. Keep three wells uninfected to use as negative control for downstream analysis.</li>
	<li>Incubate the serum dilutions with the added virus in the 37 &#176;C incubator with 5% CO2 for 1 h in order to allow the DENV antibodies to form complexes with the Zika virions (for convenience, hereafter referred to as &#34;immune complexes&#34;).</li>
	<li>Aspirate the media from the cells that were seeded in the flat-bottom 96-well plate. Wash the cells with sterile 1x phosphate-buffered saline (1x PBS).</li>
	<li>Add 50 &#181;L of the immune complexes to each well and incubate them in the 37 &#176;C incubator with 5% CO2 for 2 h.</li>
	<li>After 2 h of incubation, aspirate the media containing the immune complexes from the cells, using a multichannel pipette, and wash the cells 2x with 1x PBS to completely remove the immune complexes and any unattached virions.</li>
	<li>Add 100 &#181;L of fresh complete media supplemented with 10% FBS to each well and incubate the cells in the 37 &#176;C incubator with 5% CO2 for 48 h.</li>
</ol>
2. RNA Extraction
<ol>
	<li>Remove the 96-well plate from the incubator and transfer it to the biosafety cabinet.</li>
	<li>Aspirate the media, wash the cells 2x with 1x PBS, and proceed to RNA extraction. 
	NOTE: RNA can be extracted by any method of choice (refer to the Table of Materials).</li>
	<li>Add 250 &#181;L of cell lysis buffer with 10% &#946;-mercaptoethanol per well. Pipette the buffer up and down at least 5x along with scratching the cells with the pipette tip to speed up the lysis procedure.</li>
	<li>Transfer the cell lysates to new, labeled, sterile 1.5 mL tubes.</li>
	<li>Add an equal amount of 70% ethanol (250 &#181;L). Pipette up and down 4x - 5x until the mixture is clear.</li>
	<li>Transfer the mixture (~500 &#181;L) to labeled silica-based columns in 2 mL collection tubes and centrifuge at 15,000 x g for 30 s. Discard the flow through and keep the columns in the same collection tubes.</li>
	<li>Add 700 &#181;L of wash buffer 1 to each column and centrifuge at 15,000 x g for 30 s. Discard the flow through and keep the columns in the same collection tubes.</li>
	<li>Add 500 &#181;L of wash buffer 2 to each column and centrifuge at 15,000 x g for 30 s. Discard the supernatant. Repeat this step 2x.</li>
	<li>Transfer the columns to new 2 mL collection tubes and centrifuge at 15,000 x g for 2 min. Ensure that silica-based columns get completely dry and there is no ethanol left from wash buffer 2.</li>
	<li>Discard the 2 mL tubes and place the columns in new, sterile, labeled, 1.5 mL recovery tubes.</li>
	<li>Add prewarmed (42 &#176;C) 30 &#181;L of RNase-free water at the center of each column and centrifuge at 15,000 x g for 1 min.</li>
	<li>Recover the eluted RNA and quantify the samples, using a spectrophotometer at a 260 nm wavelength. 
	NOTE: Ideally, determine the purity of the RNA by calculating the ratio between the absorbance values at 260 nm and 280 nm. Purified RNA&#39;s 260/280 ratio is ideally between 1.8 - 2.0.</li>
</ol>
3. Quantitative Real-time Polymerase Chain Reaction
NOTE: Quantitative real-time polymerase chain reaction (qRT-PCR) can be carried out by using any SYBR green mix which usually is composed of SYBR Green I dye, Taq DNA polymerase, deoxynucleotide triphosphates (dNTPs), and a passive dye. Any qPCR machine capable of the detection of SYBR green can be used to perform the reaction and acquire the data. For this experiment, a one-step RT-PCR kit was used which had a cocktail of SYBR Green I, ROX dye, Taq DNA polymerase, dNTPs, and an additional mixture of reverse transcriptase (refer to Table of Materials). The primers designed against the envelope region and used in this study to quantify ZIKV genomic levels are CCGCTGCCCAACACAAG for ZIKV-qF and CCACTAACGTTCTTTTGCAGACAT for ZIKV-qR. As a control, human &#946;-2-microglobulin (B2M) was measured and used to normalize the expression of ZIKV (housekeeping gene). The primer sequences to quantify the B2M gene expression used in this study are CTCCGTGGCCTTAGCTGTG for B2M-qF and TTTGGAGTACGCTGGATAGCCT for B2M-qR. Ensure to put three technical replicates for each sample for both the ZIKV and the B2M genes. The setup of the RT-PCR is briefly described below.
<ol>
	<li>RT-PCR setup
	<ol>
		<li>Use 100 ng of RNA per sample.</li>
		<li>Add 1 &#181;L from 10 &#181;M stocks of both forward and reverse primers of a particular gene for each reaction.</li>
		<li>Add 0.25 &#181;L of reverse transcriptase mix per sample.</li>
		<li>For each individual reaction, add 12.5 &#181;L of SYBR Green mix.</li>
		<li>Add up to 25 &#181;L of water. Make a master mix of all the above-mentioned reagents except RNA, aliquot it in the 96-well PCR plate, and add RNA last.</li>
		<li>Seal the plate with transparent adhesive tape.</li>
		<li>Centrifuge the plate at 1,000 x g for 1 min to mix the reagents.</li>
		<li>Put the plate in the qPCR machine.</li>
	</ol>
	</li>
	<li>RT-PCR profile 
	NOTE: Use the RT-PCR profile shown in Table 1.
	<ol>
		<li>Incubate the samples at 50 &#176;C for 10 min in order to ensure the synthesis of complementary DNA (cDNA).</li>
		<li>After the cDNA synthesis, activate the Taq DNA polymerase at 95 &#176;C for 5 min.</li>
		<li>Perform 40 cycles of denaturation at 95 &#176;C for 10 s and primer annealing and extension at 60 &#176;C for 30 s.</li>
		<li>Put the additional melt curve step (65&#176;C) in the end.</li>
	</ol>
	</li>
	<li>Data analysis
	<ol>
		<li>Monitor the melt curve by clicking the melt curve tab in the program used to run the qPCR machine, which, ideally, shows a single peak in all the samples for a particular gene to confirm the presence of only one amplicon and an amplification value more than 1.6 if the algorithm considers 2 as the 100% amplification value (the amplification value varies according to the algorithm used by the qPCR machine). Make sure to use 0.5 &#176;C temperature increments between steps and a minimum holding time of 10 s in the melt curve protocol, for optimal results.</li>
		<li>After making sure there are a single amplicon and good amplification value, first click on the quantification data tab to get a quantitative cycle (Ct/Cq value) of each sample and export to Microsoft Excel.</li>
		<li>Using a spreadsheet, calculate the average of each sample using the Ct value. Next, click in the formulas and select the average. The average CT values of each sample (replicate) are used for further analysis.</li>
		<li>Next, calculate the &#916;Ct using the formula &#916;Ct = average Ct of the target gene - average Ct of the control gene (in this case, &#916;Ct = average Ct of the ZIKV gene - average Ct of the B2M gene).</li>
		<li>Calculate &#916;&#916;Ct to normalize the data (in this case, &#916;&#916;Ct = &#916;Ct ZIKV samples - B2M samples).</li>
		<li>Calculate the fold increase gene expression by typing the formula 2^-(&#916;&#916;Ct) for every single &#916;&#916;Ct normalized value. The results of the fold increase to perform statistical tests can be obtained as described in earlier studies9,10.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Hayes, E. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+virus+outside+Africa.">Zika virus outside Africa.</a> Emerging Infectious Diseases. 15, 1347-1350 (2009).</li><li>Grard, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+virus+in+Gabon+(Central+Africa)+-+2007:+a+new+threat+from+Aedes+albopictus.">Zika virus in Gabon (Central Africa) - 2007: a new threat from Aedes albopictus.</a> PLoS Neglected Tropical Diseases. 8 (2), 2681 (2014).</li><li>Fauci, A. S., Morens, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+Virus+in+the+Americas--Yet+Another+Arbovirus+Threat.">Zika Virus in the Americas--Yet Another Arbovirus Threat.</a> New England Journal of Medicine. 374 (7), 601-604 (2016).</li><li>Hawkes, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+the+Infectivity+of+Arboviruses+by+Specific+Antisera+Produced+in+Domestic+Fowls.">Enhancement of the Infectivity of Arboviruses by Specific Antisera Produced in Domestic Fowls.</a> Australian Journal of Experimental Biology and Medical Science. 42, 465-482 (1964).</li><li>Musso, D., Gubler, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+Virus.">Zika Virus.</a> Clinical Microbiology Reviews. 29 (3), 487-524 (2016).</li><li>Vaughn, D. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dengue+viremia+titer,+antibody+response+pattern,+and+virus+serotype+correlate+with+disease+severity.">Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity.</a> The Journal of Infectious Diseases. 181 (1), 2-9 (2000).</li><li>Khandia, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modulation+of+Dengue/Zika+Virus+Pathogenicity+by+Antibody-Dependent+Enhancement+and+Strategies+to+Protect+Against+Enhancement+in+Zika+Virus+Infection.">Modulation of Dengue/Zika Virus Pathogenicity by Antibody-Dependent Enhancement and Strategies to Protect Against Enhancement in Zika Virus Infection.</a> Frontiers of Immunology. 9, 597 (2018).</li><li>Londono-Renteria, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+relevant+in+vitro+human+model+for+the+study+of+Zika+virus+antibody-dependent+enhancement.">A relevant in vitro human model for the study of Zika virus antibody-dependent enhancement.</a> Journal of General Virology. 98 (7), 1702-1712 (2017).</li><li>Ganger, M. T., Dietz, G. D., Ewing, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+common+base+method+for+analysis+of+qPCR+data+and+the+application+of+simple+blocking+in+qPCR+experiments.">A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments.</a> BMC Bioinformatics. 18 (1), 534 (2017).</li><li>Renn, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+quantitative+real-time+RT-PCR+assay+for+determining+expression+profiles+of+types+I+and+III+interferon+subtypes.">High-throughput quantitative real-time RT-PCR assay for determining expression profiles of types I and III interferon subtypes.</a> Journal of Visualized Experiments. (97), e52650 (2015).</li><li>McArthur, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dengue+vaccines:+recent+developments,+ongoing+challenges+and+current+candidates.">Dengue vaccines: recent developments, ongoing challenges and current candidates.</a> Expert Review of Vaccines. 12 (8), 933-953 (2013).</li><li>Priyamvada, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Humoral+cross-reactivity+between+Zika+and+dengue+viruses:+implications+for+protection+and+pathology.">Humoral cross-reactivity between Zika and dengue viruses: implications for protection and pathology.</a> Emerging Microbes and Infections. 6 (5), 33 (2017).</li><li>Dai, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+basis+of+antibody-mediated+neutralization+and+protection+against+flavivirus.">Molecular basis of antibody-mediated neutralization and protection against flavivirus.</a> IUBMB Life. 68 (10), 783-791 (2016).</li><li>Dai, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structures+of+the+Zika+Virus+Envelope+Protein+and+Its+Complex+with+a+Flavivirus+Broadly+Protective+Antibody.">Structures of the Zika Virus Envelope Protein and Its Complex with a Flavivirus Broadly Protective Antibody.</a> Cell Host &amp; Microbe. 19 (5), 696-704 (2016).</li><li>Sirohi, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+3.8+A+resolution+cryo-EM+structure+of+Zika+virus.">The 3.8 A resolution cryo-EM structure of Zika virus.</a> Science. 352 (6284), 467-470 (2016).</li><li>George, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prior+Exposure+to+Zika+Virus+Significantly+Enhances+Peak+Dengue-2+Viremia+in+Rhesus+Macaques.">Prior Exposure to Zika Virus Significantly Enhances Peak Dengue-2 Viremia in Rhesus Macaques.</a> Scientific Reports. 7 (1), 10498 (2017).</li><li>Morens, D. M., Halstead, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measurement+of+antibody-dependent+infection+enhancement+of+four+dengue+virus+serotypes+by+monoclonal+and+polyclonal+antibodies.">Measurement of antibody-dependent infection enhancement of four dengue virus serotypes by monoclonal and polyclonal antibodies.</a> Journal of General Virology. 71, 2909-2914 (1990).</li><li>Dejnirattisai, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-reacting+antibodies+enhance+dengue+virus+infection+in+humans.">Cross-reacting antibodies enhance dengue virus infection in humans.</a> Science. 328 (5979), 745-748 (2010).</li><li>Priyamvada, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+antibody+responses+after+dengue+virus+infection+are+highly+cross-reactive+to+Zika+virus.">Human antibody responses after dengue virus infection are highly cross-reactive to Zika virus.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (28), 7852-7857 (2016).</li><li>Charles, A. S., Christofferson, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Utility+of+a+Dengue-Derived+Monoclonal+Antibody+to+Enhance+Zika+Infection+In+Vitro.">Utility of a Dengue-Derived Monoclonal Antibody to Enhance Zika Infection In Vitro.</a> PLoS Currents. 8, (2016).</li><li>Swanstrom, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dengue+Virus+Envelope+Dimer+Epitope+Monoclonal+Antibodies+Isolated+from+Dengue+Patients+Are+Protective+against+Zika+Virus.">Dengue Virus Envelope Dimer Epitope Monoclonal Antibodies Isolated from Dengue Patients Are Protective against Zika Virus.</a> MBio. 7 (4), (2016).</li></ol>

The authors have nothing to declare.

Cross-reactivity of DENV antibodies leading to the ADE of other DENV serotypes has hindered the development of an effective vaccine11. ZIKV belongs to the same family, Flaviviridae, and has a considerable homology with other flaviviruses, especially DENV12. The main target of neutralizing antibodies for both ZIKV and DENV is the envelope protein, which shares a very high structural and quaternary sequence homology between the two viruses13,</sup...

Among the mosquitoes-borne viral diseases, Zika infection is one of the most clinically important1. The infection is caused by the flavivirus ZIKV which, in most cases, uses Aedes aegypti as its primary vector1,2. However, there are studies that have reported Aedes albopictus as a primary vector in some ZIKV outbreaks3. Although the infection is asymptomatic in many cases, the most common symptoms are fever, headache, and muscle pain2. There is no cure or vaccine available for ZIKV infection and the treatment available is mostly supportive. Recent outbreaks of ZIKV in South America led to severe cases of the disease and an approximately 20-fold increase in the neurodevelopmental disorder in fetuses named microcephaly2. As South America is an area endemic to several arboviruses such as DENV and West Nile virus, it is crucial to investigate whether prior immunity to other flavivirus(es) plays a role in the severity of ZIKV infections and disease.
Throughout the ages, viruses have evolved different strategies to increase their chance of infectivity in order to take over the host cell machinery and suppress the antiviral response. One of the most fascinating of all is the use of host pre-immune antibodies by viruses to enhance their replication with the phenomenon ADE4. ADE across all four serotypes of DENV has been well studied and demonstrated to increase viral titers and disease outcome5,6,7. In a previous in vitro study, we have shown significant enhancement of ZIKV replication due to pre-existing DENV immunity in primary human immune cells8. We also demonstrated a relevant in vitro method to quantify the capability of DENV pre-existing antibodies to enhance ZIKV replication in primary cells.
The protocol that we have developed uses human serum samples that are tested for DENV neutralization in TCID-50 or plaque reduction neutralization test (PRNT) assays, along with ZIKV in biologically relevant cells or cells derived from tissues that ZIKV can infect.

<table><tbody><tr><td>Fetal Bovine Serum&amp;nbsp;</td><td>GEMINI</td><td>100-106</td><td></td></tr><tr><td>iCycler&amp;nbsp;</td><td>BioRad</td><td>785BR02188</td><td>Model No. CFX96 Optics Module</td></tr><tr><td>Microfuge 18 Centrifuge</td><td>Beckman Coulter&amp;nbsp;</td><td>367160</td><td></td></tr><tr><td>Nanodrop-1000</td><td>Thermoscientific&amp;nbsp;</td><td>1072</td><td></td></tr><tr><td>Quantifast SYBR-One step RT-PCR kit&amp;nbsp;</td><td>Qiagen&amp;nbsp;</td><td>204154</td><td>Used for 1 step RT-qPCR</td></tr><tr><td>RNeasy RNA Isolation Kit&amp;nbsp;</td><td>Qiagen&amp;nbsp;</td><td>74106</td><td>Used for RNA extraction</td></tr><tr><td>RPMI-medium&amp;nbsp;</td><td>Gibco</td><td>11875093</td><td></td></tr></tbody></table>

quantification of antibody-dependent enhancement of the zika virus in primary human cells

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought serious public safety concerns. Among the risk factors, antibody-dependent enhancement (ADE) poses the most significant threat, as the recent re-emergence of the Zika virus (ZIKV) is primarily in areas where the population has been exposed and is in a state of pre-immunity to other closely related flaviviruses, especially dengue virus (DENV). Here, we describe a protocol for quantifying the effect of human serum antibodies against DENV on ZIKV infection in primary human cells or cell lines.

In Figure 1, there is a step-by-step diagrammatic illustration of all the steps involved to carry out the ADE protocol. It is a schematic diagram showing the whole procedure of ADE of ZIKV due to pre-existing immunity to DENV. Figure 2 shows how human serum samples were categorized into three different groups: DENV infection-confirmed samples are referred to as the DENV-infected group, DENV antibody-confirmed samples are referred...

Watch this Scientific Journal Video about Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells at JoVE.com

Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells

We describe a method to evaluate the effect of pre-existing immunity against dengue virus on the Zika virus infection by using human serum, primary human cells, and infection quantification by quantitative real-time polymerase chain reaction.

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought ...

quantification-antibody-dependent-enhancement-zika-virus-primary

Research

JoVE Journal

Immunology and Infection

8.7K Views.  Boston University School of Medicine. We describe a method to evaluate the effect of pre-existing immunity against dengue virus on the Zika virus infection by using human serum, primary human cells, and infection quantification by quantitative real-time polymerase chain reaction.

Video: Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells

Zika Virus Infection of Cultured Human Fetal Brain Neural Stem Cells for Immunocytochemical Analysis

Human fetal brain neural stem cells are a unique non-genetically modified model system to study the impact of various stimuli on human developmental neurobiology. Rather than use an animal model or genetically modified induced pluripotent cells, human neural stem cells provide an effective in vitro system to examine the effects of treatments, screen drugs, or examine individual differences. Here, we provide the detailed protocols for methods used to expand human fetal brain neural stem cells in culture with serum-free media, to differentiate them into various neuronal subtypes and astrocytes via different priming procedures, and to freeze and recover these cells. Furthermore, we describe a procedure of using human fetal brain neural stem cells to study Zika virus infection.

This article details the methods that are used to expand human fetal brain neural stem cells in culture, as well as how to differentiate them into various neuronal subtypes and astrocytes, with an emphasis on the use of neural stem cells to study Zika virus infection.

Human fetal brain neural stem cells are a unique non-genetically modified model system to study the impact of various stimuli on human developmental ...

Developmental Biology

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV is an RNA virus of the Flaviviridae family. ZIKV is mainly transmitted by mosquitoes, but can also be spread by maternal to fetal vertical transmission as well as sexual contact. To date, there are no reliable treatment or vaccine options available to protect those infected by the virus. The development of a reproducible, effective Zika virus infectious cell culture system is critical for studying the molecular mechanisms of ZIKV replication as well as drug and vaccine development. In this regard, a protocol describing a mammalian cell-based in vitro Zika virus culture system for viral production and growth analysis is reported here. Details on the formation of plaques by Zika virus on a cell monolayer and plaque assay for measuring viral titer are presented. Viral genome replication kinetics and double-stranded RNA genome replicatory intermediates are determined. This culture platform was utilized to screen against a library of a small set of cytokines resulting in the identification of interferon-&#945; (IFN-&#945;), IFN-&#946; and IFN-&#947; as potent inhibitors of Zika viral growth. In summary, an in vitro infectious Zika viral culture system and various virological assays are demonstrated in this study, which has the potential to greatly benefit the research community in elucidating further the mechanisms of viral pathogenesis and the evolution of viral virulence. Antiviral IFN-alpha can further be evaluated as a prophylactic, post-exposure prophylactic, and treatment option for Zika virus infections in high-risk populations, including infected pregnant women.

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV), an emerging pathogen, is linked to fetal developmental abnormalities and microcephaly. The establishment of an effective infectious cell culture system is crucial for studies of ZIKV replication as well as vaccine and drug development. In this study, various virological assays pertaining to ZIKV are illustrated and discussed.

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV ...

A Simple Flow Cytometry Based Assay to Determine In Vitro Antibody Dependent Enhancement of Dengue Virus Using Zika Virus Convalescent Serum

Antibody dependent enhancement of infection has been shown to play a major role in Dengue viral pathogenesis. Traditional assays that measure the capacity of antibodies or serum to enhance infection in impermissible cell lines have relied on using viral output in the media followed by plaque assays to quantify infection. More recently, these assays have examined Dengue virus (DENV) infection in the cell lines using fluorescently labeled antibodies. Both these approaches have limitations that restrict the widespread use of these techniques. Here, we describe a simple in vitro assay using Dengue virus reporter viral particles (RVPs) that express green fluorescent protein and K562 cells to examine antibody dependent enhancement (ADE) of DENV infection using serum that was obtained from rhesus macaques 16 weeks after infection with Zika virus (ZIKV). This technique is reliable, involves minimal manipulation of cells, does not involve the use of live replication competent virus, and can be performed in a high throughput format to get a quantitative readout using flow cytometry. Additionally, this assay can be easily adapted to examine antibody dependent enhancement (ADE) of other flavivirus infections such as Yellow Fever virus (YFV), Japanese Equine Encephalitis virus (JEEV), West Nile virus (WNV) etc. where RVPs are available. The ease of setting up the assay, analyzing the data, and interpreting results makes it highly amenable to most laboratory settings.

A Simple Flow Cytometry Based Assay to Determine In Vitro Antibody Dependent Enhancement of Dengue Virus Using Zika Virus Convalescent Serum

We describe a simple and easy protocol for measuring antibody dependent enhancement of infection by Zika virus convalescent serum using Dengue virus Reporter Viral Particles.

Antibody dependent enhancement of infection has been shown to play a major role in Dengue viral pathogenesis. Traditional assays that measure the capacity ...

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1-/- Mice

The Zika virus (ZIKV) can induce inflammation in immunoprivileged organs (e.g., the brain and testis), leading to the Guillain-Barr&#233; syndrome and damaging the testes. During an infection with the ZIKV, immune cells have been shown to infiltrate into the tissues. However, the cellular mechanisms that define the protection and/or immunopathogenesis of these immune cells during a ZIKV infection are still largely unknown. Herein, we describe methods to evaluate the virus-specific T-cell functionality in these immunoprivileged organs of ZIKV-infected mice. These methods include a) a ZIKV infection and vaccine inoculation in Ifnar1-/- mice; b) histopathology, immunofluorescence, and immunohistochemistry assays to detect the virus infection and inflammation in the brain, testes, and spleen; c) the preparation of a tetramer of ZIKV-derived T-cell epitopes; d) the detection of ZIKV-specific T cells in the monocytes isolated from the brain, testes, and spleen. Using these approaches, it is possible to detect the antigen-specific T cells that have infiltrated into the immunoprivileged organs and to evaluate the functions of these T cells during the infection: potential immune protection via virus clearance and/or immunopathogenesis to exacerbate the inflammation. These findings may also help to clarify the contribution of T cells induced by the immunization against ZIKV.

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1-/- Mice

A protocol to evaluate antigen-specific T-cell responses in the immunoprivileged organs of the Ifnar1-/- murine model for the Zika virus (ZIKV) infection is described. This method is pivotal for investigating the cellular mechanisms of the protection and immunopathogenesis of ZIKV vaccines and is also valuable for their efficacy evaluation.

The Zika virus (ZIKV) can induce inflammation in immunoprivileged organs (e.g., the brain and testis), leading to the Guillain-Barr&#233; syndrome and ...

Rescue of Recombinant Zika Virus from a Bacterial Artificial Chromosome cDNA Clone

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines and/or antivirals have underscored the urgent need to develop ZIKV reverse genetic systems to facilitate the study of ZIKV biology and the development of therapeutic and/or prophylactic approaches. However, like with other flaviviruses, the generation of ZIKV full-length infectious cDNA clones has been hampered due to the toxicity of viral sequences during its amplification in bacteria. To overcome this problem, we have developed a nontraditional approach based on the use of bacterial artificial chromosomes (BACs). Using this approach, the full-length cDNA copy of the ZIKV strain Rio Grande do Norte Natal (ZIKV-RGN) is generated from four synthetic DNA fragments and assembled into the single-copy pBeloBAC11 plasmid under the control of the human cytomegalovirus (CMV) immediate-early promoter. The assembled BAC cDNA clone is stable during propagation in bacteria, and infectious recombinant (r)ZIKV is recovered in Vero cells after transfection of the BAC cDNA clone. The protocol described here provides a powerful technique for the generation of infectious clones of flaviviruses, including ZIKV, and other positive-strand RNA viruses, particularly those with large genomes that have stability problems during bacterial&#160;propagation.

The recent epidemic of Zika virus highlights the importance of establishing reverse genetic approaches to develop vaccines and/or therapeutic strategies. Here, we describe the protocol to rescue an infectious recombinant Zika virus from a full-length cDNA clone assembled in a bacterial artificial chromosome under the control of the human cytomegalovirus immediate-early promoter.

The association of Zika virus (ZIKV) infection with neurological complications during the recent worldwide outbreak and the lack of approved vaccines ...

Isolation and Quantification of Zika Virus from Multiple Organs in a Mouse

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral load. The purpose of the procedure is to quantify viral titers in peripheral and CNS areas of the mouse at different time points post infection or under different experimental conditions to identify virologic and immunological factors that regulate Zika virus infection. The organ isolation procedures demonstrated allow for both focus forming assay quantification and quantitative PCR assessment of viral titers. The rapid organ isolation techniques are designed for the preservation of virus titer. Viral titer quantification by focus forming assay allows for the rapid throughput assessment of Zika virus. The benefit of the focus forming assay is the assessment of infectious virus, the limitation of this assay is the potential for organ toxicity reducing the limit of detection. Viral titer assessment is combined with quantitative PCR, and using a recombinant RNA copy control viral genome copy number within the organ is assessed with low limit of detection. Overall these techniques provide an accurate rapid high throughput method for the analysis of Zika viral titers in the periphery and CNS of Zika virus infected animals and can be applied to the assessment of viral titers in the organs of animals infected with most pathogens, including Dengue virus.

The goal of the protocol is to demonstrate the techniques used to investigate viral disease by isolating and quantifying Zika virus, from multiple organs in a mouse following infection.

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral ...

Virus Propagation and Cell-Based Colorimetric Quantification

Zika virus (ZIKV) is a mosquito-borne virus belonging to the genus Flavivirus. ZIKV infection has been associated with congenital brain abnormalities and potentially Guillain-Barr&#233; syndrome in adults. Research on ZIKV to understand the disease mechanisms is important to facilitate vaccine and treatment development. The method of quantifying viruses is crucial and fundamental in the field of virology. The focus forming assay (FFA) is a virus quantification assay that detects the viral antigen with antibodies and identifies the infection foci of cells using the peroxidase immunostaining technique. The current study describes the virus propagation and quantification protocol using both 24-well and 96-well (high throughput) formats. Compared with other similar studies, this protocol has further described foci size optimization, which can serve as a guide to expand the use of this assay for other viruses. Firstly, ZIKV propagation is performed in Vero cells for 3 days. The culture supernatant containing ZIKV is harvested and quantitated using the FFA. Briefly, the virus culture is inoculated onto Vero cells and incubated for 2-3 days. Foci formation is then determined after optimized staining processes, including cell fixation, permeabilization, blocking, antibody binding, and incubation with peroxidase substrate. The stained virus foci are visualized using a stereo microscope (manual counting in 24-well format) or software analyzer (automated counting in 96-well format). The FFA provides reproducible, relatively fast results (3-4 days) and is suitable to be used for different viruses, including non-plaque-forming viruses. Subsequently, this protocol is useful for the study of ZIKV infection and could be used to detect other clinically important viruses.

The present protocol describes the propagation of Zika virus (ZIKV) in Vero African green monkey kidney cells and the quantification of ZIKV using cell-based colorimetric immunodetection methods in 24-well and 96-well (high throughput) formats.

Zika virus (ZIKV) is a mosquito-borne virus belonging to the genus Flavivirus. ZIKV infection has been associated with congenital brain abnormalities and ...

Cell-Based Electrical Impedance Platform to Evaluate Zika Virus Inhibitors in Real Time

Cell-based electrical impedance (CEI)&#160;technology measures changes in impedance caused by a growing or manipulated adherent cell monolayer on culture plate wells embedded with electrodes. The technology can be used to monitor the consequences of Zika virus (ZIKV) infection and adherent cell replication in real time, as this virus is highly cytopathogenic. It is a straightforward assay that does not require the use of labels or invasive methods and has the benefit of providing real-time data. The kinetics of ZIKV infection are highly dependent on the employed cell line, virus strain, and multiplicity of infection (MOI), which cannot be easily studied with conventional endpoint assays. Furthermore, the CEI assay can also be used for the evaluation and characterization of antiviral compounds, which can also have dynamic inhibitory properties over the course of infection. This methods article gives a detailed explanation of the practical execution of the CEI assay and its potential applications in ZIKV research and antiviral research in general.

Here, we demonstrate the use of cell-based electrical impedance (CEI) as a very easy and straightforward method to study Zika virus infection and replication in human cells in real time. Furthermore, the CEI assay is useful for the evaluation of antiviral compounds.

Cell-based electrical impedance (CEI)&#160;technology measures changes in impedance caused by a growing or manipulated adherent cell monolayer on culture ...

An In Vitro Assay for Screening Interferons as Potent Inhibitors of Zika Virus Growth

Source: Contreras, D. et al., <a href="https://app.jove.com/v/54767">Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons.</a> J. Vis. Exp. (2016)
The video demonstrates an in vitro assay for screening interferons with antiviral activity against the Zika virus, a human pathogen. Within the host cell, the Zika virus undergoes multiplication upon internalization, infecting neighboring cells and creating distinct zones or viral plaques. Type I interferon, acting as an antiviral agent, hinders virus multiplication, thereby preventing the formation of viral plaques in the host cell monolayer.

Test in vitro do badań przesiewowych interferonów jako silnych inhibitorów wzrostu wirusa Zika

1. Screening Cytokine Library against Zika Virus Infection

	Seed naive Vero cells at 1 x 105 cells per well using a 12-well plate. Once the cells are ...

JoVE Encyclopedia of Experiments

Immunology

Immunotherapy

Immunogenics and Vaccine Development

A Focus-Forming Assay for Quantifying Virus Titers in the Organs of an Infected Mouse

Source: Brien, J. D. et al., <a href="https://app.jove.com/v/59632">Isolation and Quantification of Zika Virus from Multiple Organs in a Mouse.</a> J. Vis. Exp.&#160;(2019)
The video demonstrates a procedure for quantifying the Zika virus in multiple mouse organs via a focus-forming assay. The process involves infecting mammalian cell monolayers with virus-infected tissue homogenates, followed by the use of methyl cellulose to prevent viral spread. Subsequently, immunostaining is employed to enable precise quantification and measurement of organ-specific infectivity.

Test skupiający się do ilościowego określania mian wirusa w narządach zakażonej myszy

All procedures involving animal models have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.

1. Organ ...

Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Zika Virus Infection of Cultured Human Fetal Brain Neural Stem Cells for Immunocytochemical Analysis

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

A Simple Flow Cytometry Based Assay to Determine In Vitro Antibody Dependent Enhancement of Dengue Virus Using Zika Virus Convalescent Serum

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1^-/- Mice

Rescue of Recombinant Zika Virus from a Bacterial Artificial Chromosome cDNA Clone

Isolation and Quantification of Zika Virus from Multiple Organs in a Mouse

Virus Propagation and Cell-Based Colorimetric Quantification

Cell-Based Electrical Impedance Platform to Evaluate Zika Virus Inhibitors in Real Time

Test in vitro do badań przesiewowych interferonów jako silnych inhibitorów wzrostu wirusa Zika

Test skupiający się do ilościowego określania mian wirusa w narządach zakażonej myszy