This work was supported by NIH Grants R01GM131099, NIH R01GM124472, and NSF CAREER 1350829. We thank the NIH Tetramer Facility for pMHC ligands. This study was supported, in part, by the Emory Comprehensive Glycomics Core.

The OT-1 transgenic mice are housed at the Division of Animal Resources Facility at Emory University. All the experiments were approved and performed under the Institutional Animal Care and Use Committee (IACUC) protocol.
1. Oligonucleotide preparation
<ol>
	<li>Dissolve the ligand strand DNA in water (18.2 M&#937; resistivity, used throughout the whole protocol). Vortex and spin down the solution with a tabletop centrifuge. Tune the volume of water such that the final concentration is 1 mM. Validate the concentration by using a nanodrop spectrophotometer to measure the absorbance at 260 nm and determine the final concentration based on the extinction coefficient of the oligonucleotide. 
	NOTE: The ligand strand has a modification at each terminus, 5&#39; amine and 3&#39; biotin, to conjugate with the fluorophore and to present the biotinylated ligand. The amine group in the ligand strand needs to be conjugated with a fluorophore. Cy3B dye is used for this conjugation due to its high brightness and photostability, but it is not generally offered commercially and requires in-house conjugation. Accordingly, the following section describes the conjugation between amines and NHS ester dyes. For end users that do not have access to facilities or resources for nucleic acid modification, modified nucleic acids can instead be purchased from custom DNA synthesis vendors that offer bright and photostable dyes, such as the Alexa and Atto family of dyes.</li>
	<li>Prepare 10x PBS and 1 M NaHCO3 solutions. Mix 10 &#181;L of the 1 mM amine ligand strand solution (10 nmol) with 10 &#181;L of 10x PBS, 10 &#181;L of 1 M NaHCO3, and 60 &#181;L of H2O. Dissolve 50 &#181;g of Cy3B NHS ester in 10 &#181;L of DMSO immediately before use and add to the mixture for a total reaction volume of 100 &#181;L. Add Cy3B NHS ester last. Allow to react at room temperature for 1 h or 4 &#176;C overnight.</li>
	<li>Prepare the Atto647N locking strand by conjugating the amine locking strand with Atto647N NHS ester. Prepare 10x PBS and 1 M NaHCO3 solution. Mix 10 &#181;L of the 1 mM amine locking strand solution (10 nmol) with 10 &#181;L of 10x PBS, 10 &#181;L of 1 M NaHCO3, and 60 &#181;L of H2O. Dissolve 50 &#181;g of Atto647N NHS ester in 10 &#181;L of DMSO immediately before use and add to the mixture for a total reaction volume of 100 &#181;L. Add Atto647N NHS ester last. Allow to react at room temperature for 1 h or 4 &#176;C overnight.</li>
	<li>After the reactions, remove by-products, excess dye, and salts by P2 desalting gel filtration. Dilute the reaction mixture with H2O to a total volume of 300 &#181;L, which is appropriate for the subsequent HPLC purification step. Add 650 &#181;L of hydrated P2 gel to a centrifugal device and spin down at 18,000 x g for 1 min. Remove the liquid at the bottom of the device, add the reaction mixture to the column containing P2 gel, spin down at 18,000 x g for 1 min and collect the reaction mixture at the bottom of the device. 
	NOTE: P2 gel should be hydrated at least 4 h before use with H2O.</li>
	<li>Purify the desalted reaction mixture with HPLC using a C18 column designated for oligonucleotide purification, with solvent A: 0.1 M TEAA in H2O and B: ACN as the mobile phase for a linear gradient elution 10-100% B over 50 min at a flow rate of 0.5 mL/min. Inject the desalted reaction mixture in reverse-phase HPLC with a 500 &#181;L injection loop for purification. Collect the product that has an absorbance peak for the DNA (260 nm) and an absorbance peak for the fluorophore (560 nm for Cy3B and 647 nm for Atto647N) and dry them in a vacuum centrifugal concentrator overnight (see Figure 2A).</li>
	<li>Reconstitute the dried oligo-dye product in 100 &#181;L water. Determine the concentration of the Cy3B ligand strand and Atto647N locking strand with the nanodrop spectrophotometer. Ensure that the dye labeling ratio is close to 1:1. Correct for the 260 nm absorbance of the dye if needed when determining the oligonucleotide concentration.</li>
	<li>Validate the purified product with MALDI-TOF-MS using 3-HPA as the substrate in 50% ACN/H2O with 0.1% TFA and 5 mg/mL ammonium citrate using 0.5 &#181;L of the product at 1-5 &#181;M for MALDI-TOF-MS sample preparation. An example mass spectrum can be found in Figure 2B.</li>
	<li>Dissolve the hairpin strand and the quencher anchor strand in water and make sure the concentration of the stock solutions is between 50 and 100 &#181;M. 
	NOTE: The hairpin strand is unmodified and can be directly custom synthesized from a vendor. The anchor strand has a thiol anchoring group and a quencher BHQ2 and can be directly custom synthesized from a vendor.</li>
	<li>Aliquot all of the oligonucleotides. For short-term use and storage, store these oligonucleotides at 4 &#176;C. For long-term storage, freeze and keep them at -20 &#176;C. At this point, all of the oligonucleotides are ready for the DNA tension probe assembly. 
	&#8203;NOTE: Repeated freeze-thaw cycles are not problematic for oligonucleotides.</li>
</ol>
2. Surface preparation
NOTE: The preparation of DNA hairpin tension probe substrates takes two days. The DNA hairpin tension probe will be functionalized onto glass coverslips.
<ol>
	<li>Day 1
	<ol>
		<li>Place the 25 mm coverslips on a polytetrafluoroethylene rack in a 50 mL beaker. Each rack can hold up to 8 coverslips. Rinse the coverslips by submerging in water three times.</li>
		<li>Add 40 mL of a 1:1 ratio (v:v) solution of ethanol mixed with water to the beaker containing the rack and coverslips, and seal the beaker using a paraffin film.</li>
		<li>Sonicate the beaker for 15 min in an ultrasonics cleaner (operating frequency 35 KHz) to clean the coverslips. After sonication, discard the liquid and rinse the beaker with the rack and coverslips in it with water at least 6 times to remove any remaining organic solvent.</li>
		<li>Prepare fresh Piranha solution by mixing sulfuric acid and hydrogen peroxide in the ratio of 3:1. To make 40 mL of Piranha solution, add 30 mL of sulfuric acid to a clean 50 mL beaker first and then slowly add 10 mL of H2O2. The Piranha solution will rapidly heat and bubble upon addition of the H2O2. Gently mix the piranha using the end of a glass pipette.</li>
		<li>Next, transfer the rack that holds the coverslips to the beaker containing gently mixed Piranha solution for etching (Figure 3A). Allow the Piranha solution to hydroxylate and clean the coverslips for 30 min at room temperature. After Piranha etching, transfer the rack using steel or polytetrafluoroethylene tweezers to a clean 50 mL beaker with water and rinse again with water at least 6 times. 
		CAUTION: Large amounts of organic substances could react vigorously with Piranha solution and may cause explosion. Be careful and always work with Piranha solution in a fume hood. Make sure to wear a labcoat, gloves, and safety goggles. Never store fresh Piranha solution in a sealed container. 
		NOTE: The hydrogen peroxide to sulfuric acid ratio should be kept under 1:2 (v:v) and should never exceed 1:1. When submerging the rack with coverslips in Piranha solution, place them in the solution slowly and carefully. Do not discard the solution immediately after etching, as it is still active and hot. Leave it in the beaker overnight before pouring it in the acid waste container.</li>
		<li>Immerse the rack holding the coverslips in a 50 mL beaker with 40 mL ethanol to remove water. Discard the ethanol and repeat 3 times to ensure that the water has been removed.</li>
		<li>Then immerse the rack in 3% aminopropyl triethoxy silane (APTES) (v/v) in 40 mL of ethanol to react with the -OH on the coverslips for 1 h at room temperature (Figure 3B). 
		NOTE: Ethanol can be replaced by acetone.</li>
		<li>Rinse surfaces 6 times by submerging them into 40 mL ethanol, then dry in oven at 80 &#176;C for 20 min. After cooling, store the dried amine-modified coverslips at -20 &#176;C for future use (up to 6 months).</li>
		<li>Cover the bottom inner side of 10 cm diameter plastic Petri dishes with paraffin film. The paraffin film prevents the coverslips from sliding inside the Petri dish and helps in keeping the solution for the next steps of functionalization stay on the coverslips. Place the cooled-down amine-modified coverslips in the Petri dishes. The side to be functionalize should be facing up.</li>
		<li>To modify the amine groups on the coverslips, add 300 &#181;L of 0.5% w/v lipoic acid PEG NHS (LA-PEG-SC) and 2.5% w/v mPEG NHS (mPEG-SC) in 0.1 M NaHCO3 onto each coverslip and incubate for 1 h at room temperature (Figure 3C). For each 25 mm coverslip, weigh 1.5 mg of LA-PEG-SC and 7.5 mg of mPEG-SC. Dissolve the NHS reagents immediately before adding to the surfaces, as they have a short half-life (~10 min) in aqueous solution at room temperature. After the reaction, rinse surfaces 3 times with water. 
		NOTE: The NHS reaction can be performed at 4 &#176;C overnight. NHS reagents have longer half-life before hydrolysis at 4 &#176;C, which is around 4-6 h. This will result in a three-day surface prep procedure.</li>
		<li>Add 100 &#181;L of 0.1 M NaHCO3 containing 1 mg/mL of sulfo-NHS acetate to a set of &#34;sandwich&#34; coverslips (two coverslips facing towards each other with reaction buffer in between). Allow passivation to occur for at least 30 min. To save reagent, this step could be done with 50 &#181;L of 1 mg/mL sulfo-NHS acetate. Rinse with water three times after passivation.</li>
		<li>Add 0.5 mL of gold nanoparticles (AuNP, 8.8 nm, tannic acid, 0.05 mg/mL) to each coverslip and incubate for 30 min at room temperature (Figure 3D). To save the reagent, this step can be done by sandwiching two coverslips as well. Make sure no salts are present in the system from previous steps to avoid aggregation of gold nanoparticles. Do not leave the coverslips to dry after this step.</li>
		<li>Meanwhile, pre-hybridize 4.7 pN hairpin, Cy3B ligand strand, and BHQ2 anchor strand that form the DNA tension probes construct at a ratio of 1.1:1:1 in 1 M NaCl at 300 nM in a PCR tube. Anneal the strands by heating the solution up to 95 &#176;C for 5 min, then gradually cool down by decreasing the temperature to 20 &#176;C over 30 min in a thermal cycler.</li>
		<li>Rinse the coverslips with water three times after 30 min of incubation with gold nanoparticles. Add additional BHQ2 anchor strand (from 100 &#181;M stock) to the annealed DNA solution to make the ratio between BHQ2 anchor strand and Cy3B ligand strand 10:1. At this point, the DNA solution should contain 300 nM of tension probe construct and 2.7 &#181;M BHQ2 strand. Add 100 &#181;L per two coverslips to make the &#34;sandwich&#34; (Figure 3E).</li>
		<li>Carefully place a wet lab tissue ball in the Petri dish (away from coverslips) and seal the dish with paraffin film to prevent the solution from drying up. Cover the dish with foil and incubate at 4 &#176;C overnight.</li>
	</ol>
	</li>
	<li>Day 2
	<ol>
		<li>Wash off the excess probes from the coverslips with 1x PBS. Check for DNA tension probe surface quality under an epifluorescent microscope.</li>
		<li>Prepare 40 &#181;g/mL of streptavidin in 1x PBS and incubate on coverslips for 30 min at room temperature (Figure 3F). Usually, 100 &#181;L is sufficient for a 25 mm coverslip. Rinse with PBS 3 times after incubation to wash away the excess amount of streptavidin.</li>
		<li>Prepare 40 &#181;g/mL biotinylated antibody/ligand in 1x PBS. Add 50-100 &#181;L per sandwich and incubate for 30 min at room temperature (Figure 3G). Rinse with PBS three times after incubation to wash away the excess amount of biotinylated antibody/ligand.</li>
		<li>Assemble the clean imaging chambers with surfaces carefully. Surfaces can be easily cracked when tightening the chambers. Add 0.5-1 mL of Hank&#39;s balanced salt solution (HBSS) to the imaging chambers and keep them ready for imaging with cells (Figure 3H).</li>
	</ol>
	</li>
</ol>
3. Imaging cell receptor forces
<ol>
	<li>Prepare immune cells of interest in HBSS at 1-2 x 106 cells/mL. 
	NOTE: OT-1 CD8+ na&#239;ve cells are used as an example in this paper. Purify OT-1 CD8+ na&#239;ve T cells a from the spleens of sacrificed mice using the MACS mouse CD8+ T cell isolation kit with a MACS separator following manufacturer&#39;s instruction. Isolate and enrich the CD8+ T cells by removing any non CD8+ T cells that magnetic depleting antibody cocktail bound to. Resuspend purified OT-1 CD8+ na&#239;ve T cells in HBSS at 2 x 106 cells/mL and keep on ice prior to use.</li>
	<li>Check the quality of DNA hairpin tension probe surface under a fluorescence microscope (100x objective) for quality control before adding ligands or plating cells. Image and quantify the average background intensity in Cy3B channel of a DNA hairpin tension probe surface from at least 5 different positions and 3 replicates. Keep the imaging acquisition conditions consistent so that this value can be used as a reliable marker of surface quality and probe density (Figure 4C). 
	NOTE: Quantify the number of DNA strands per gold nanoparticle and the number of gold nanoparticles per &#181;m2 the first few times of surface preparation according to literature12, which can be used as another reliable marker of surface quality.</li>
	<li>Plate ~4 x 104 - 10 x 104 cells onto each DNA tension probe functionalized coverslip and allow them to attach and spread for ~15 min at room temperature.</li>
	<li>As cells are plated onto the DNA hairpin tension probes and start to spread, image the fluorescence signals that are generated in the Cy3B channel with the 100x objective (Figure 3I).</li>
	<li>After cells start to produce real-time tension signal on the DNA hairpin tension probe surface in the Cy3B channel, acquire images in both Cy3B and Atto647N channels (TIRF microscopy gives better signal-to-noise ratio than epifluorescence). Subsequently, add Atto647N strand to the imaging chambers at a final concentration of 200 nM for mechanically selective hybridization.</li>
	<li>After 10 min of incubation, quickly and gently remove the buffer containing the fluorescent Atto647N locking strand and replace with fresh Hank&#39;s balanced salts. Image in both Cy3B and Atto647N channels again and determine the Pearson&#39;s correlation coefficient with Fiji software15.</li>
	<li>At the timepoint of interest for the investigation, introduce non-fluorescent locking strand to the cells in the imaging chamber to store the tension signal. Prepare locking strand stock (100 &#181;M) and add to the cells at a final concentration of 1 &#181;M. Gently pipette to mix. The duration of locking can vary but 10 min is the recommended time.</li>
	<li>Acquire time-lapse movies or end-point images in epifluorescence for both qualitative tension mapping and quantitative analysis as needed (Figure 3J and Figure 5). 
	&#8203;NOTE: If tension measurement at multiple time points is desired, initiate erasing of stored tension signals by the addition of an unlocking strand. To avoid excess rinsing, a higher final concentration of unlocking strand at 2 &#181;M is used to initiate a toehold-mediated strand displacement reaction with the locking strand for 3 min, which erases the stored signals (Figure 3J). Gently rinse the excess oligonucleotides off with HBSS. The DNA hairpin tension probe surface and the cells are ready for another round of tension storing and mapping. Unlocking of tension signals is not necessary if only one time point is of interest in the study.</li>
</ol>
4. Data analysis
NOTE: Image analysis is performed using Fiji software, and the quantitative analysis is performed using analysis software.
<ol>
	<li>Correct any drift during image acquisition with Correct 3D drift command in Registration under the Plugins menu.</li>
	<li>Remove the camera background of the image with Subtract command under the Process menu.</li>
	<li>Determine the Pearson&#39;s correlation coefficient with the Colocalization function under Analyze menu.</li>
	<li>Average and subtract the fluorescence background produced by the unopened probes from three different local background regions. Draw ROIs of cells on either background-subtracted images or RICM (reflection interference contrast microscopy) images with Image J Freehand Selections tool. Measure any metric of interest of the ROIs, e.g., integrated fluorescence intensity and tension occupancy using Measure tool under Analyze menu (Figure 6).</li>
	<li>Export the measurements for quantitative analysis with analysis software.</li>
	<li>Plot the data with any analysis software.</li>
</ol>

<ol>
	<li>Dustin, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T-cell+activation+through+immunological+synapses+and+kinapses.">T-cell activation through immunological synapses and kinapses.</a> Immunological Reviews. 221 (1), 77-89 (2008).</li><li>Spillane, K. M., Tolar, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=B+cell+antigen+extraction+is+regulated+by+physical+properties+of+antigen-presenting+cells.">B cell antigen extraction is regulated by physical properties of antigen-presenting cells.</a> Journal of Cell Biology. 216 (1), 217-230 (2017).</li><li>Feng, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanosensing+drives+acuity+of+&#945;&#946;+T-cell+recognition.">Mechanosensing drives acuity of &#945;&#946; T-cell recognition.</a> Proceedings of the National Academy of Sciences. 114 (39), 8204-8213 (2017).</li><li>Hong, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+TCR+mechanotransduction+signaling+loop+induces+negative+selection+in+the+thymus.">A TCR mechanotransduction signaling loop induces negative selection in the thymus.</a> Nature Immunology. 19 (12), 1379-1390 (2018).</li><li>Basu, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytotoxic+T+cells+use+mechanical+force+to+potentiate+target+cell+killing.">Cytotoxic T cells use mechanical force to potentiate target cell killing.</a> Cell. 165 (1), 100-110 (2016).</li><li>Bashour, K. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD28+and+CD3+have+complementary+roles+in+T-cell+traction+forces.">CD28 and CD3 have complementary roles in T-cell traction forces.</a> Proceedings of the National Academy of Sciences. 111 (6), 2241-2246 (2014).</li><li>Ma, V. P. Y., Salaita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+nanotechnology+as+an+emerging+tool+to+study+mechanotransduction+in+living+systems.">DNA nanotechnology as an emerging tool to study mechanotransduction in living systems.</a> Small. 15 (26), 1900961 (2019).</li><li>Liu, Y., Yehl, K., Narui, Y., Salaita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tension+sensing+nanoparticles+for+mechano-imaging+at+the+living/nonliving+interface.">Tension sensing nanoparticles for mechano-imaging at the living/nonliving interface.</a> Journal of the American Chemical Society. 135 (14), 5320-5323 (2013).</li><li>Glazier, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+mechanotechnology+reveals+that+integrin+receptors+apply+pN+forces+in+podosomes+on+fluid+substrates.">DNA mechanotechnology reveals that integrin receptors apply pN forces in podosomes on fluid substrates.</a> Nature Communications. 10 (1), 1-13 (2019).</li><li>Galior, K., Liu, Y., Yehl, K., Vivek, S., Salaita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Titin-based+nanoparticle+tension+sensors+map+high-magnitude+integrin+forces+within+focal+adhesions.">Titin-based nanoparticle tension sensors map high-magnitude integrin forces within focal adhesions.</a> Nano Letters. 16 (1), 341-348 (2016).</li><li>Zhang, Y., Ge, C., Zhu, C., Salaita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-based+digital+tension+probes+reveal+integrin+forces+during+early+cell+adhesion.">DNA-based digital tension probes reveal integrin forces during early cell adhesion.</a> Nature Communications. 5, 5167 (2014).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-based+nanoparticle+tension+sensors+reveal+that+T-cell+receptors+transmit+defined+pN+forces+to+their+antigens+for+enhanced+fidelity.">DNA-based nanoparticle tension sensors reveal that T-cell receptors transmit defined pN forces to their antigens for enhanced fidelity.</a> Proceedings of the National Academy of Sciences. 113 (20), 5610-5615 (2016).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Platelet+integrins+exhibit+anisotropic+mechanosensing+and+harness+piconewton+forces+to+mediate+platelet+aggregation.">Platelet integrins exhibit anisotropic mechanosensing and harness piconewton forces to mediate platelet aggregation.</a> Proceedings of the National Academy of Sciences. 115 (2), 325-330 (2018).</li><li>Huang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+kinetics+of+two-dimensional+TCR+and+pMHC+interactions+determine+T-cell+responsiveness.">The kinetics of two-dimensional TCR and pMHC interactions determine T-cell responsiveness.</a> Nature. 464 (7290), 932-936 (2010).</li><li>Ma, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+probes+that+store+mechanical+information+reveal+transient+piconewton+forces+applied+by+T+cells.">DNA probes that store mechanical information reveal transient piconewton forces applied by T cells.</a> Proceedings of the National Academy of Sciences. 116 (34), 16949-16954 (2019).</li><li>Hui, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell+costimulatory+receptor+CD28+is+a+primary+target+for+PD-1-mediated+inhibition.">T cell costimulatory receptor CD28 is a primary target for PD-1-mediated inhibition.</a> Science. 355 (6332), 1428-1433 (2017).</li><li>Whitley, K. D., Comstock, M. J., Chemla, Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elasticity+of+the+transition+state+for+oligonucleotide+hybridization.">Elasticity of the transition state for oligonucleotide hybridization.</a> Nucleic Acids Research. 45 (2), 547-555 (2016).</li><li>Brockman, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live-cell+super-resolved+PAINT+imaging+of+piconewton+cellular+traction+forces.">Live-cell super-resolved PAINT imaging of piconewton cellular traction forces.</a> Nature Methods. 17 (10), 1018-1024 (2020).</li></ol>

The authors declare no conflict of interest.

With the detailed procedures provided here, one can prepare DNA hairpin tension probe substrates to map and quantify the receptor tension produced by immune cells. When cells are plated onto the DNA hairpin tension probe substrate, they land, attach, and spread as the receptors sense the ligands both chemically and mechanically, the latter of which is detected by our probes. However, in some cases cells may fail to spread (Figure 7A) or fail to produce tension signal. This is often a consequ...

Immune cells defend against pathogens and cancer cells by continuously crawling and scanning the surfaces of target cells for antigens, studding their surface1,2. Antigen recognition is initiated upon binding between the T cell receptor (TCR) and the peptide-major histocompatibility complex MHC (pMHC) complex expressed on the surface of target cells. Because TCR-pMHC recognition occurs at the junction between two mobile cells, it has long been suspected of experiencing mechanical forces. Moreover, this led to the mechanosensor model of TCR activation, which suggests that TCR forces contribute to its function3,4. To understand when, where, and how mechanical forces contribute to T cell function, it is imperative to develop tools to visualize the molecular forces transmitted by T cells. Traditionally, methods such as traction force microscopy (TFM) and micropillar arrays are used to investigate cellular forces5,6. However, the force sensitivity of TFM and micropillar arrays is at the nanonewton (nN) scale and thus is often insufficient to study the molecular piconewton (pN) forces transmitted by cell receptors7. To improve the force and spatial resolution for detection, our lab pioneered the development of molecular tension probes, which were initially synthesized using polyethylene glycol (PEG) polymers7. Molecular tension probes are comprised of an extendible molecular &#34;spring&#34; (PEG, protein, DNA) flanked by a fluorophore and quencher and are anchored on a surface. Forces applied to the terminus of the probe lead to its extension, separating the fluorophore and quencher, and thus generating a strong fluorescence signal (Figure 1A)8,9,10.
Over the past decade we have developed a library of different classes of molecular tension probes with spring elements made from nucleic acids11, proteins10, and polymers8. Among these, the DNA-based tension probes provide the highest signal to noise ratio and the greatest force sensitivity, which is easily tuned from a few pN up to ~20 pN11. We have used these real-time DNA tension probes to study the molecular forces generated by many diverse cell types, including fibroblasts, cancer cells, platelets, and immune cells11,12,13. This manuscript will describe protocols to synthesize and assemble DNA tension probes on a surface to map molecular receptor forces with pN force resolution using a conventional fluorescence microscope. While the current procedure includes chemical modifications to the nucleic acid to introduce the fluorescent reporter (Figure 1B), it is important to note that many of the modification and purification steps can be outsourced to custom DNA synthesis companies. Therefore, DNA tension probes technology is facile, and accessible to the broader cell biology and mechanobiology communities.
Briefly, to assemble DNA tension sensors, a DNA hairpin is hybridized to a fluorescent ligand strand on one arm and a quencher anchor strand on the other arm and then immobilized on a glass substrate (Figure 1C, real-time tension). In the absence of mechanical force, the hairpin is closed, and thus the fluorescence is quenched. However, when the applied mechanical force is greater than the F1/2 (the force at equilibrium that leads to a 50% probability of unfolding), the hairpin mechanically melts, and a fluorescent signal is generated.
Building on the real-time DNA tension sensor, we also describe protocols to map accumulated forces, which is particularly useful for studying interactions between receptors on immune cells and their natural ligand. This is because immune receptors often display short-lived bonds3,14. Accumulated forces are imaged using a &#34;locking&#34; strand that preferentially binds to open DNA hairpins and allows for the storage of fluorescence signals associated with mechanical pulling events (Figure 1C, locked tension). The locking strand is designed to bind a cryptic binding site that is exposed upon mechanically induced melting of the hairpin and lock the hairpin in the open state by blocking hairpin refolding, thus storing the tension signal, and generating an accumulated tension map. Moreover, the locking strand is designed with an eight-nucleotide toehold, which enables a toehold-mediated strand displacement reaction with its full complement, the &#34;unlocking&#34; strand. With the addition of the unlocking strand, the bound locking strand is stripped off the hairpin construct, erasing the stored tension signal and resetting the hairpin back to the real-time state.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/62348/62348fig01.jpg" /> 
Figure 1:&#160;Scheme of the state-of-art molecular tension probes. (A) General design of real-time molecular tension probe, (B) Strands for the DNA-based tension probe construct, and (C) engineered DNA-based tension probes and their toggling between real-time state and locked state. <a href="https://www.jove.com/files/ftp_upload/62348/62348fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
The main protocol consists of four major sections - oligonucleotide preparation, surface preparation, imaging, and data analysis. This protocol has been successfully demonstrated by our lab and others in na&#239;ve and activated OT-1 CD8+ T cells, OT-II CD4+ cells, as well as hybridomas, and can be applied to interrogate different immune cell receptors including T cell receptor, programmed cell death receptor (PD1), and lymphocyte function-associated antigen 1 (LFA-1) forces. OT-1 CD8+ na&#239;ve T cells are used as an example cell line in this paper.

<table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>&#160;3-hydroxypicolinic acid (3-HPA)</td>
			<td>Sigma</td>
			<td>56197</td>
			<td>maldi-TOF-MS matrix</td>
		</tr>
		<tr>
			<td>&#160;mPEG-SC</td>
			<td>Biochempeg</td>
			<td>MF001023-2K</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>(3-Aminopropyl)triethoxysilane</td>
			<td>Acros</td>
			<td>AC430941000</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>10x Red blood cell lysis buffer</td>
			<td>Biolegend</td>
			<td>00-4333-57</td>
			<td>buffer</td>
		</tr>
		<tr>
			<td>8.8 nm gold nanoparticles, tannic acid</td>
			<td>Nanocomposix</td>
			<td>customized order</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>Atto647N NHS ester</td>
			<td>Sigma</td>
			<td>18373-1MG-F</td>
			<td>fluorophore, oligo prep</td>
		</tr>
		<tr>
			<td>Attofluor Cell Chamber, for microscopy</td>
			<td>Thermo Fisher Scientific</td>
			<td>A7816</td>
			<td>imaging</td>
		</tr>
		<tr>
			<td>BD Syringes only with Luer-Lok</td>
			<td>BD bioscience</td>
			<td>309657</td>
			<td>cells</td>
		</tr>
		<tr>
			<td>biotinylated anti-mouse CD3e</td>
			<td>ebioscience</td>
			<td>13-0031-82</td>
			<td>antibody/ligand</td>
		</tr>
		<tr>
			<td>Biotinylated pMHC ovalbumin (SIINFEKL)</td>
			<td>NIH Tetramer Core Facility at Emory University</td>
			<td>NA</td>
			<td>antibody/ligand</td>
		</tr>
		<tr>
			<td>bovine serum albumin</td>
			<td>Sigma</td>
			<td>735078001</td>
			<td>block non-specific interactions</td>
		</tr>
		<tr>
			<td>Cell strainers</td>
			<td>Biologix</td>
			<td>15-1100</td>
			<td>cells</td>
		</tr>
		<tr>
			<td>Coverslip Mini-Rack, teflon</td>
			<td>Thermo Fisher Scientific</td>
			<td>C14784</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>Cy3B NHS ester</td>
			<td>GE Healthcare</td>
			<td>PA63101</td>
			<td>fluorophore, oligo prep</td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s phosphate-buffered saline (DPBS)</td>
			<td>Corning</td>
			<td>21-031-CM</td>
			<td>buffer</td>
		</tr>
		<tr>
			<td>ethanol</td>
			<td>Sigma</td>
			<td>459836</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>Hank&#8217;s balanced salts (HBSS)</td>
			<td>Sigma</td>
			<td>H8264</td>
			<td>buffer</td>
		</tr>
		<tr>
			<td>hydrogen peroxide</td>
			<td>Sigma</td>
			<td>H1009</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>LA-PEG-SC</td>
			<td>Biochempeg</td>
			<td>HE039023-3.4K</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>Midi MACS (LS) startup kit</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-301</td>
			<td>cells</td>
		</tr>
		<tr>
			<td>mouse CD8+ T cell isolation kit</td>
			<td>Miltenyi Biotec</td>
			<td>130-104-075</td>
			<td>cells</td>
		</tr>
		<tr>
			<td>Nanosep MF centrifugal devices</td>
			<td>Pall laboratory</td>
			<td>ODM02C35</td>
			<td>oligo prep</td>
		</tr>
		<tr>
			<td>No. 2 round glass coverslips</td>
			<td>VWR</td>
			<td>48382-085</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>NTA-SAM</td>
			<td>Dojindo Molecular Technologies</td>
			<td>N475-10</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>P2 gel</td>
			<td>Bio-rad</td>
			<td>1504118</td>
			<td>oligo prep</td>
		</tr>
		<tr>
			<td>sufuric acid</td>
			<td>EMD Millipore Corporation</td>
			<td>SX1244-6</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>Sulfo-NHS acetate</td>
			<td>Thermo Fisher Scientific</td>
			<td>26777</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent AdvanceBio Oligonucleotide C18 column, 4.6 x 150 mm, 2.7 &#956;m</td>
			<td>653950-702</td>
			<td></td>
			<td>oligonucleotide preparation</td>
		</tr>
		<tr>
			<td>Barnstead Nanopure water purifying system</td>
			<td>Thermo Fisher</td>
			<td></td>
			<td>water</td>
		</tr>
		<tr>
			<td>CFI Apo 100&#215; NA 1.49 objective</td>
			<td>Nikon</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>Cy5 cube</td>
			<td>CHROMA</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>evolve electron multiplying charge coupled device (EMCCD)</td>
			<td>Photometrics</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>High-performance liquid chromatography</td>
			<td>Agilent 1100</td>
			<td></td>
			<td>oligonucleotide preparation</td>
		</tr>
		<tr>
			<td>Intensilight epifluorescence source</td>
			<td>Nikon</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>Matrix-assisted laser desorption/ionization time-of-flight mass spectrometer (MALDI-TOF-MS)</td>
			<td>Voyager STR</td>
			<td></td>
			<td>oligonucleotide preparation</td>
		</tr>
		<tr>
			<td>Nanodrop 2000 UV-Vis Spectrophotometer</td>
			<td>Thermo Fisher</td>
			<td></td>
			<td>oligonucleotide preparation</td>
		</tr>
		<tr>
			<td>Nikon Eclipse Ti inverted microscope</td>
			<td>Nikon</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>Nikon Perfect Focus System</td>
			<td>Nikon</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>NIS Elements software</td>
			<td>Nikon</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>quad band TIRF 405/488/561/647 cube</td>
			<td>CHROMA</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>RICM cube</td>
			<td>CHROMA</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>TIRF launcher with 488 nm (50 mW), 561 nm (50 mW), and 640 nm</td>
			<td>Coherent</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>TRITC cube</td>
			<td>CHROMA</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>oligo name</td>
			<td>5&#39; modification / 3&#39; modification</td>
			<td>sequence (5&#39; to 3&#39;)</td>
			<td>Use</td>
		</tr>
		<tr>
			<td>15mer amine locking strand</td>
			<td>5&#39; modification: no modification 
			3&#39; modification: /3AmMO/</td>
			<td>AAA AAA CAT TTA TAC CCT ACC TA</td>
			<td>locking real-time tension signal</td>
		</tr>
		<tr>
			<td>15mer Atto647N locking strand</td>
			<td>5&#39; modification: Atto647N 
			3&#39; modification: /3AmMO/</td>
			<td>AAA AAA CAT TTA TAC CCT ACC TA</td>
			<td>locking real-time tension signal</td>
		</tr>
		<tr>
			<td>15mer non-fluoresccent locking strand</td>
			<td>5&#39; modification: no modification 
			3&#39; modification: no modification</td>
			<td>A AAA AAC ATT TAT AC</td>
			<td>locking real-time tension signal for quantitative analysis</td>
		</tr>
		<tr>
			<td>4.7 pN hairpin strand</td>
			<td>5&#39; modification: no modification 
			3&#39; modification: no modification</td>
			<td>GTGAAATACCGCACAGATGCGT 
 TTGTATAAATGTTTTTTTCATTTAT 
 ACTTTAAGAGCGCCACGTAGCC 
CAGC</td>
			<td>hairpin probe</td>
		</tr>
		<tr>
			<td>amine ligand strand</td>
			<td>5&#39; modification: /5AmMC6/ 
			3&#39; modification: /3Bio/</td>
			<td>CGCATCTGTGCG GTA TTT CAC TTT</td>
			<td>hairpin probe</td>
		</tr>
		<tr>
			<td>BHQ2 anchor strand</td>
			<td>5&#39; modification: /5ThiolMC6-D/ 
			3&#39; modification: /3BHQ_2/</td>
			<td>TTTGCTGGGCTACGTGGCGCTCTT</td>
			<td>&#160;&#160;&#160;hairpin probe</td>
		</tr>
		<tr>
			<td>Cy3B ligand strand</td>
			<td>5&#39; modification: Cy3B 
			3&#39; modification: /3Bio/</td>
			<td>CGCATCTGTGCG GTA TTT CAC TTT</td>
			<td>hairpin probe</td>
		</tr>
		<tr>
			<td>unlocking strand</td>
			<td>5&#39; modification: no modification 
			3&#39; modification: no modification</td>
			<td>TAG GTA GGG TAT AAA TGT TTT TTT C</td>
			<td>unlocking accumulated tension signal</td>
		</tr>
	</tbody>
</table>

dna tension probes to map the transient piconewton receptor forces by immune cells

Mechanical forces transmitted at the junction between two neighboring cells and at the junction between cells and the extracellular matrix are critical for regulating many processes ranging from development to immunology. Therefore, developing the tools to study these forces at the molecular scale is critical. Our group developed a suite of molecular tension sensors to quantify and visualize the forces generated by cells and transmitted to specific ligands. The most sensitive class of molecular tension sensors are comprised of nucleic acid stem-loop hairpins. These sensors use fluorophore-quencher pairs to report on the mechanical extension and unfolding of DNA hairpins under force. One challenge with DNA hairpin tension sensors is that they are reversible with rapid hairpin refolding upon termination of the tension and thus transient forces are difficult to record. In this article, we describe the protocols for preparing DNA tension sensors that can be "locked" and prevented from refolding to enable "storing" of mechanical information. This allows for the recording of highly transient piconewton forces, which can be subsequently "erased" by the addition of complementary nucleic acids that remove the lock. This ability to toggle between real-time tension mapping and mechanical information storing reveals weak, short-lived, and less abundant forces, that are commonly employed by T cells as part of their immune functions.

Here we show representative surface quality control images (Figure 4). A high-quality surface should have a clean background in RICM channel (Figure 4B), and uniform fluorescence intensity in Cy3B channel (Figure 4C). With the same imaging equipment and identical fluorescence imaging acquisition conditions, the background fluorescence intensity should be consistent and reproducible each time when conducting experiments with DNA prob...

Watch this Scientific Journal Video about DNA Tension Probes to Map the Transient Piconewton Receptor Forces by Immune Cells at JoVE.com

DNA Tension Probes to Map the Transient Piconewton Receptor Forces by Immune Cells

This paper describes a detailed protocol for using DNA-based tension probes to image the receptor forces applied by immune cells. This approach can map receptor forces &gt;4.7pN in real-time and can integrate forces over time.

Mechanical forces transmitted at the junction between two neighboring cells and at the junction between cells and the extracellular matrix are critical ...

dna-tension-probes-to-map-transient-piconewton-receptor-forces-immune

Research

JoVE Journal

Bioengineering

2.6K Views.  Emory University. This paper describes a detailed protocol for using DNA-based tension probes to image the receptor forces applied by immune cells. This approach can map receptor forces >4.7pN in real-time and can integrate forces over time.

Video: DNA Tension Probes to Map the Transient Piconewton Receptor Forces by Immune Cells

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic valve leaflets are composed of interstitial cells suspended within an extracellular matrix (ECM) and are lined with an endothelial cell monolayer. The valve withstands a harsh, dynamic environment and is constantly exposed to shear, flexion, tension, and compression. Research has shown calcific lesions in diseased valves occur in areas of high mechanical stress as a result of endothelial disruption or interstitial matrix damage1-3. Hence, it is not surprising that epidemiological studies have shown high blood pressure to be a leading risk factor in the onset of aortic valve disease4. 
The only treatment option currently available for valve disease is surgical replacement of the diseased valve with a bioprosthetic or mechanical valve5. Improved understanding of valve biology in response to physical stresses would help elucidate the mechanisms of valve pathogenesis. In turn, this could help in the development of non-invasive therapies such as pharmaceutical intervention or prevention. Several bioreactors have been previously developed to study the mechanobiology of native or engineered heart valves6-9. Pulsatile bioreactors have also been developed to study a range of tissues including cartilage10, bone11 and bladder12. The aim of this work was to develop a cyclic pressure system that could be used to elucidate the biological response of aortic valve leaflets to increased pressure loads. 
The system consisted of an acrylic chamber in which to place samples and produce cyclic pressure, viton diaphragm solenoid valves to control the timing of the pressure cycle, and a computer to control electrical devices. The pressure was monitored using a pressure transducer, and the signal was conditioned using a load cell conditioner. A LabVIEW program regulated the pressure using an analog device to pump compressed air into the system at the appropriate rate. The system mimicked the dynamic transvalvular pressure levels associated with the aortic valve; a saw tooth wave produced a gradual increase in pressure, typical of the transvalvular pressure gradient that is present across the valve during diastole, followed by a sharp pressure drop depicting valve opening in systole. The LabVIEW program allowed users to control the magnitude and frequency of cyclic pressure. The system was able to subject tissue samples to physiological and pathological pressure conditions. This device can be used to increase our understanding of how heart valves respond to changes in the local mechanical environment.

Design of a Cyclic Pressure Bioreactor for the Ex Vivo Study of Aortic Heart Valves

A cyclic pressure bioreactor capable of subjecting heart valve tissue to physiological and pathological pressure conditions has been designed. A LabVIEW program allows users to control pressure magnitude, amplitude and frequency. This device can be used to study the mechanobiology of heart valve tissue or isolated cells.

The aortic valve, located between the left ventricle and the aorta, allows for unidirectional blood flow, preventing backflow into the ventricle. Aortic ...

Attaching Biological Probes to Silica Optical Biosensors Using Silane Coupling Agents

In order to interface with biological environments, biosensor platforms, such as the popular Biacore system (based on the Surface Plasmon Resonance (SPR) technique), make use of various surface modification techniques, that can, for example, prevent surface fouling, tune the hydrophobicity / hydrophilicity of the surface, adapt to a variety of electronic environments, and most frequently, induce specificity towards a target of interest.1-5 These techniques extend the functionality of otherwise highly sensitive biosensors to real-world applications in complex environments, such as blood, urine, and wastewater analysis.2,6-7 While commercial biosensing platforms, such as Biacore, have well-understood, standard techniques for performing such surface modifications, these techniques have not been translated in a standardized fashion to other label-free biosensing platforms, such as Whispering Gallery Mode (WGM) optical resonators.8-9
WGM optical resonators represent a promising technology for performing label-free detection of a wide variety of species at ultra-low concentrations.6,10-12 The high sensitivity of these platforms is a result of their unique geometric optics: WGM optical resonators confine circulating light at specific, integral resonance frequencies.13 Like the SPR platforms, the optical field is not totally confined to the sensor device, but evanesces; this "evanescent tail" can then interact with species in the surrounding environment. This interaction causes the effective refractive index of the optical field to change, resulting in a slight, but detectable, shift in the resonance frequency of the device. Because the optical field circulates, it can interact many times with the environment, resulting in an inherent amplification of the signal, and very high sensitivities to minor changes in the environment.2,14-15
To perform targeted detection in complex environments, these platforms must be paired with a probe molecule (usually one half of a binding pair, e.g. antibodies / antigens) through surface modification.2 Although WGM optical resonators can be fabricated in several geometries from a variety of material systems, the silica microsphere is the most common. These microspheres are generally fabricated on the end of an optical fiber, which provides a "stem" by which the microspheres can be handled during functionalization and detection experiments. Silica surface chemistries may be applied to attach probe molecules to their surfaces; however, traditional techniques generated for planar substrates are often not adequate for these three-dimensional structures, as any changes to the surface of the microspheres (dust, contamination, surface defects, and uneven coatings) can have severe, negative consequences on their detection capabilities. Here, we demonstrate a facile approach for the surface functionalization of silica microsphere WGM optical resonators using silane coupling agents to bridge the inorganic surface and the biological environment, by attaching biotin to the silica surface.8,16 Although we use silica microsphere WGM resonators as the sensor system in this report, the protocols are general and can be used to functionalize the surface of any silica device with biotin.

Biosensors interface with complex, biological environments and perform targeted detection by combining highly sensitive sensors with highly specific probes attached to the sensor via surface modification. Here, we demonstrate the surface functionalization of silica optical sensors with biotin using silane coupling agents to bridge the sensor and the biological environment.

In order to interface with biological environments, biosensor platforms, such as the popular Biacore system (based on the Surface Plasmon Resonance (SPR) ...

Measurement of Tension Release During Laser Induced Axon Lesion to Evaluate Axonal Adhesion to the Substrate at Piconewton and Millisecond Resolution

The formation of functional connections in a developing neuronal network is influenced by extrinsic cues. The neurite growth of developing neurons is subject to chemical and mechanical signals, and the mechanisms by which it senses and responds to mechanical signals are poorly understood. Elucidating the role of forces in cell maturation will enable the design of scaffolds that can promote cell adhesion and cytoskeletal coupling to the substrate, and therefore improve the capacity of different neuronal types to regenerate after injury.
Here, we describe a method to apply simultaneous force spectroscopy measurements during laser induced cell lesion. We measure tension release in the partially lesioned axon by simultaneous interferometric tracking of an optically trapped probe adhered to the membrane of the axon. Our experimental protocol detects the tension release with piconewton sensitivity, and the dynamic of the tension release at millisecond time resolution. Therefore, it offers a high-resolution method to study how the mechanical coupling between cells and substrates can be modulated by pharmacological treatment and/or by distinct mechanical properties of the substrate.

We measured the tension release in an axon that was partially lesioned with a laser dissector by simultaneous force spectroscopy measurement performed on an optically-trapped probe adhered to the membrane of the axon. The developed experimental protocol evaluates the axon adhesion to the culture substrate.

The formation of functional connections in a developing neuronal network is influenced by extrinsic cues. The neurite growth of developing neurons is ...

Insertion of Flexible Neural Probes Using Rigid Stiffeners Attached with Biodissolvable Adhesive

Microelectrode arrays for neural interface devices that are made of biocompatible thin-film polymer are expected to have extended functional lifetime because the flexible material may minimize adverse tissue response caused by micromotion. However, their flexibility prevents them from being accurately inserted into neural tissue. This article demonstrates a method to temporarily attach a flexible microelectrode probe to a rigid stiffener using biodissolvable polyethylene glycol (PEG) to facilitate precise, surgical insertion of the probe. A unique stiffener design allows for uniform distribution of the PEG adhesive along the length of the probe. Flip-chip bonding, a common tool used in microelectronics packaging, enables accurate and repeatable alignment and attachment of the probe to the stiffener. The probe and stiffener are surgically implanted together, then the PEG is allowed to dissolve so that the stiffener can be extracted leaving the probe in place. Finally, an in vitro test method is used to evaluate stiffener extraction in an agarose gel model of brain tissue. This approach to implantation has proven particularly advantageous for longer flexible probes (&gt;3 mm). It also provides a feasible method to implant dual-sided flexible probes. To date, the technique has been used to obtain various in vivo recording data from the rat cortex.

Insertion of flexible neural microelectrode probes is enabled by attaching probes to rigid stiffeners with polyethylene glycol (PEG). A unique assembly process ensures uniform and repeatable attachment. After insertion into tissue, the PEG dissolves and the stiffener is extracted. An in vitro test method evaluates the technique in agarose gel.

Microelectrode  arrays for neural interface devices that are made of biocompatible thin-film  polymer are expected to have extended functional lifetime ...

Studying the Stoichiometry of Epidermal Growth Factor Receptor in Intact Cells using Correlative Microscopy

This protocol describes the labeling of epidermal growth factor receptor (EGFR) on COS7 fibroblast cells, and subsequent correlative fluorescence microscopy and environmental scanning electron microscopy (ESEM) of whole cells in hydrated state. Fluorescent quantum dots (QDs) were coupled to EGFR via a two-step labeling protocol, providing an efficient and specific protein labeling, while avoiding label-induced clustering of the receptor. Fluorescence microscopy provided overview images of the cellular locations of the EGFR. The scanning transmission electron microscopy (STEM) detector was used to detect the QD labels with nanoscale resolution. The resulting correlative images provide data of the cellular EGFR distribution, and the stoichiometry at the single molecular level in the natural context of the hydrated intact cell. ESEM-STEM images revealed the receptor to be present as monomer, as homodimer, and in small clusters. Labeling with two different QDs, i.e.,&#160;one emitting at 655 nm and at 800 revealed similar characteristic results.

This protocol describes the labeling of epidermal growth factor receptor (EGFR) on COS7 fibroblast cells, and subsequent correlative light- and electron microscopy of whole cells in hydrated state. The label contained fluorescent quantum dots. The protocol can be used to study the stoichiometry of EGFR at the single molecule level.

This protocol describes the labeling of epidermal growth factor receptor (EGFR) on COS7 fibroblast cells, and subsequent correlative fluorescence ...

Probing the Roles of Physical Forces in Early Chick Embryonic Morphogenesis

Embryonic development is traditionally studied from the perspective of biomolecular genetics, but the fundamental importance of mechanics in morphogenesis is becoming increasingly recognized. In particular, the embryonic chick heart and brain tube, which undergo drastic morphological changes as they develop, are among the prime candidates to study the role of physical forces in morphogenesis. Progressive ventral bending&#160;and rightward torsion of the tubular embryonic chick brain happen at the earliest stage of organ-level left-right asymmetry in chick embryonic development. The vitelline membrane (VM) constrains the dorsal side of the embryo and has been implicated in providing the force necessary to induce torsion of the developing brain. Here we present a combination of new ex-ovo experiments and physical modeling to identify the mechanics of brain torsion. At Hamburger-Hamilton stage 11, embryos are harvested and cultured ex ovo (in media). The VM is subsequently removed using a pulled capillary tube. By controlling the level of the fluid and subjecting the embryo to a fluid-air interface, the fluid surface tension of the media can be used to replace the mechanical role of the VM. Microsurgery experiments were also performed to alter the position of the heart to find the resultant change in the chirality of brain torsion. Results from this protocol illustrate the fundamental roles of mechanics in driving morphogenesis.

Here, we present a protocol introducing a set of new ex-ovo experiments and physical modeling approaches for studying the mechanics of morphogenesis during early chick embryonic brain torsion.

Embryonic development is traditionally studied from the perspective of biomolecular genetics, but the fundamental importance of mechanics in morphogenesis ...

Detection of Endotoxin in Nano-formulations Using Limulus Amoebocyte Lysate (LAL) Assays

When present in pharmaceutical products, a Gram-negative bacterial cell wall component endotoxin (often also called lipopolysaccharide) can cause inflammation, fever, hypo- or hypertension, and, in extreme cases, can lead to tissue and organ damage that may become fatal. The amounts of endotoxin in pharmaceutical products, therefore, are strictly regulated. Among the methods available for endotoxin detection and quantification, the Limulus Amoebocyte Lysate (LAL) assay is commonly used worldwide. While any pharmaceutical product can interfere with the LAL assay, nano-formulations represent a particular challenge due to their complexity. The purpose of this paper is to provide a practical guide to researchers inexperienced in estimating endotoxins in engineered nanomaterials and nanoparticle-formulated drugs. Herein, practical recommendations for performing three LAL formats including turbidity, chromogenic and gel-clot assays are discussed. These assays can be used to determine endotoxin contamination in nanotechnology-based drug products, vaccines, and adjuvants.

Detection of Endotoxin in Nano-formulations Using Limulus Amoebocyte Lysate LAL Assays

Detection of endotoxins in engineered nanomaterials represents one of the grand challenges in the field of nanomedicine. Here, we present a case study that describes the framework composed of three different LAL formats to estimate potential endotoxin contamination in nanoparticles.

When present in pharmaceutical products, a Gram-negative bacterial cell wall component endotoxin (often also called lipopolysaccharide) can cause ...

Single-Cell Optical Action Potential Measurement in Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes

Conventional intracellular microelectrode techniques to quantify cardiomyocyte electrophysiology are extremely complex, labor intensive, and typically carried out in low throughput. Rapid and ongoing expansion of induced pluripotent stem cell (iPSC) technology presents a new standard in cardiovascular research and alternate methods are now necessary to increase throughput of electrophysiological data at a single cell level. VF2.1Cl is a recently derived voltage sensitive dye which provides a rapid single channel, high magnitude response to fluctuations in membrane potential. It possesses kinetics superior to those of other existing voltage indicators and makes available functional data equivalent to that of traditional microelectrode techniques. Here, we demonstrate simplified, non-invasive action potential characterization in externally paced human iPSC derived cardiomyocytes using a modular and highly affordable photometry system.

Here we describe optical acquisition and characterization of action potentials from induced pluripotent stem cell derived cardiomyocytes using a high-speed modular photometry system.

Conventional intracellular microelectrode techniques to quantify cardiomyocyte electrophysiology are extremely complex, labor intensive, and typically ...

Fibroblast Derived Human Engineered Connective Tissue for Screening Applications

Fibroblasts are phenotypically highly dynamic cells, which quickly transdifferentiate into myofibroblasts in response to biochemical and biomechanical stimuli. The current understanding of fibrotic processes, including cardiac fibrosis, remains poor, which hampers the development of new anti-fibrotic therapies. Controllable and reliable human model systems are crucial for a better understanding of fibrosis pathology. This is a highly reproducible and scalable protocol to generate engineered connective tissues (ECT) in a 48-well casting plate to facilitate studies of fibroblasts and the pathophysiology of fibrotic tissue in a 3-dimensional (3D) environment. ECT are generated around the poles with tunable stiffness, allowing for studies under a defined biomechanical load. Under the defined loading conditions, phenotypic adaptations controlled by cell-matrix interactions can be studied. Parallel testing is feasible in the 48-well format with the opportunity for the time-course analysis of multiple parameters, such as tissue compaction and contraction against the load. From these parameters, biomechanical properties such as tissue stiffness and elasticity can be studied.

Presented here is a protocol to generate engineered connective tissues for a parallel culture of 48 tissues in a multi-well plate with double poles, suitable for mechanistic studies, disease modeling, and screening applications. The protocol is compatible with fibroblasts from different organs and species and is exemplified here with human primary cardiac fibroblasts.

Fibroblasts are phenotypically highly dynamic cells, which quickly transdifferentiate into myofibroblasts in response to biochemical and biomechanical ...

Residue-Specific Exchange of Proline by Proline Analogs in Fluorescent Proteins: How "Molecular Surgery" of the Backbone Affects Folding and Stability

Replacement of proline (Pro) residues in proteins by the traditional site-directed mutagenesis by any of the remaining 19 canonical amino acids is often detrimental to protein folding and, in particular, chromophore maturation in green fluorescent proteins and related variants. A reasonable alternative is to manipulate the translation of the protein so that all Pro residues are replaced residue-specifically by analogs, a method known as selective pressure incorporation (SPI). The built-in chemical modifications can be used as a kind of &#34;molecular surgery&#34; to finely dissect measurable changes or even rationally manipulate different protein properties. Here, the study demonstrates the usefulness of the SPI method to study the role of prolines in the organization of the typical &#946;-barrel structure of spectral variants of the green fluorescent protein (GFP) with 10-15 prolines in their sequence: enhanced green fluorescent protein (EGFP), NowGFP, and KillerOrange. Pro residues are present in connecting sections between individual &#946;-strands and constitute the closing lids of the barrel scaffold, thus being responsible for insulation of the chromophore from water, i.e., fluorescence properties. Selective pressure incorporation experiments with (4R)-fluoroproline (R-Flp), (4S)-fluoroproline (S-Flp), 4,4-difluoroproline (Dfp), and 3,4-dehydroproline (Dhp) were performed using a proline-auxotrophic E. coli strain as expression host. We found that fluorescent proteins with S-Flp and Dhp are active (i.e., fluorescent), while the other two analogs (Dfp and R-Flp) produced dysfunctional, misfolded proteins. Inspection of UV-Vis absorption and fluorescence emission profiles showed few characteristic alterations in the proteins containing Pro analogs. Examination of the folding kinetic profiles in EGFP variants showed an accelerated refolding process in the presence of S-Flp, while the process was similar to wild-type in the protein containing Dhp. This study showcases the capacity of the SPI method to produce subtle modifications of protein residues at an atomic level (&#34;molecular surgery&#34;), which can be adopted for the study of other proteins of interest. It illustrates the outcomes of proline replacements with close chemical analogs on the folding and spectroscopic properties in the class of &#946;-barrel fluorescent proteins.

To overcome the limitations of classical site-directed mutagenesis, proline analogs with specific modifications were incorporated into several fluorescent proteins. We show how the replacement of hydrogen by fluorine or of the single by double bonds in proline residues ("molecular surgery") affects fundamental protein properties, including their folding and interaction with light.

Replacement of proline (Pro) residues in proteins by the traditional site-directed mutagenesis by any of the remaining 19 canonical amino acids is often ...