This work was supported by NIH Grants R01GM131099, NIH R01GM124472, and NSF CAREER 1350829. We thank the NIH Tetramer Facility for pMHC ligands. This study was supported, in part, by the Emory Comprehensive Glycomics Core.

The OT-1 transgenic mice are housed at the Division of Animal Resources Facility at Emory University. All the experiments were approved and performed under the Institutional Animal Care and Use Committee (IACUC) protocol.
1. Oligonucleotide preparation
<ol>
	<li>Dissolve the ligand strand DNA in water (18.2 M&#937; resistivity, used throughout the whole protocol). Vortex and spin down the solution with a tabletop centrifuge. Tune the volume of water such that the final concentration is 1 mM....

<ol>
	<li>Dustin, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T-cell+activation+through+immunological+synapses+and+kinapses.">T-cell activation through immunological synapses and kinapses.</a> Immunological Reviews. 221 (1), 77-89 (2008).</li><li>Spillane, K. M., Tolar, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=B+cell+antigen+extraction+is+regulated+by+physical+properties+of+antigen-presenting+cells.">B cell antigen extraction is regulated by physical properties of antigen-presenting cells.</a> Journal of Cell Biology. 216 (1), 217-230 (2017).</li><li>Feng, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanosensing+drives+acuity+of+&#945;&#946;+T-cell+recognition.">Mechanosensing drives acuity of &#945;&#946; T-cell recognition.</a> Proceedings of the National Academy of Sciences. 114 (39), 8204-8213 (2017).</li><li>Hong, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+TCR+mechanotransduction+signaling+loop+induces+negative+selection+in+the+thymus.">A TCR mechanotransduction signaling loop induces negative selection in the thymus.</a> Nature Immunology. 19 (12), 1379-1390 (2018).</li><li>Basu, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytotoxic+T+cells+use+mechanical+force+to+potentiate+target+cell+killing.">Cytotoxic T cells use mechanical force to potentiate target cell killing.</a> Cell. 165 (1), 100-110 (2016).</li><li>Bashour, K. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD28+and+CD3+have+complementary+roles+in+T-cell+traction+forces.">CD28 and CD3 have complementary roles in T-cell traction forces.</a> Proceedings of the National Academy of Sciences. 111 (6), 2241-2246 (2014).</li><li>Ma, V. P. Y., Salaita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+nanotechnology+as+an+emerging+tool+to+study+mechanotransduction+in+living+systems.">DNA nanotechnology as an emerging tool to study mechanotransduction in living systems.</a> Small. 15 (26), 1900961 (2019).</li><li>Liu, Y., Yehl, K., Narui, Y., Salaita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tension+sensing+nanoparticles+for+mechano-imaging+at+the+living/nonliving+interface.">Tension sensing nanoparticles for mechano-imaging at the living/nonliving interface.</a> Journal of the American Chemical Society. 135 (14), 5320-5323 (2013).</li><li>Glazier, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+mechanotechnology+reveals+that+integrin+receptors+apply+pN+forces+in+podosomes+on+fluid+substrates.">DNA mechanotechnology reveals that integrin receptors apply pN forces in podosomes on fluid substrates.</a> Nature Communications. 10 (1), 1-13 (2019).</li><li>Galior, K., Liu, Y., Yehl, K., Vivek, S., Salaita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Titin-based+nanoparticle+tension+sensors+map+high-magnitude+integrin+forces+within+focal+adhesions.">Titin-based nanoparticle tension sensors map high-magnitude integrin forces within focal adhesions.</a> Nano Letters. 16 (1), 341-348 (2016).</li><li>Zhang, Y., Ge, C., Zhu, C., Salaita, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-based+digital+tension+probes+reveal+integrin+forces+during+early+cell+adhesion.">DNA-based digital tension probes reveal integrin forces during early cell adhesion.</a> Nature Communications. 5, 5167 (2014).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-based+nanoparticle+tension+sensors+reveal+that+T-cell+receptors+transmit+defined+pN+forces+to+their+antigens+for+enhanced+fidelity.">DNA-based nanoparticle tension sensors reveal that T-cell receptors transmit defined pN forces to their antigens for enhanced fidelity.</a> Proceedings of the National Academy of Sciences. 113 (20), 5610-5615 (2016).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Platelet+integrins+exhibit+anisotropic+mechanosensing+and+harness+piconewton+forces+to+mediate+platelet+aggregation.">Platelet integrins exhibit anisotropic mechanosensing and harness piconewton forces to mediate platelet aggregation.</a> Proceedings of the National Academy of Sciences. 115 (2), 325-330 (2018).</li><li>Huang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+kinetics+of+two-dimensional+TCR+and+pMHC+interactions+determine+T-cell+responsiveness.">The kinetics of two-dimensional TCR and pMHC interactions determine T-cell responsiveness.</a> Nature. 464 (7290), 932-936 (2010).</li><li>Ma, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+probes+that+store+mechanical+information+reveal+transient+piconewton+forces+applied+by+T+cells.">DNA probes that store mechanical information reveal transient piconewton forces applied by T cells.</a> Proceedings of the National Academy of Sciences. 116 (34), 16949-16954 (2019).</li><li>Hui, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell+costimulatory+receptor+CD28+is+a+primary+target+for+PD-1-mediated+inhibition.">T cell costimulatory receptor CD28 is a primary target for PD-1-mediated inhibition.</a> Science. 355 (6332), 1428-1433 (2017).</li><li>Whitley, K. D., Comstock, M. J., Chemla, Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elasticity+of+the+transition+state+for+oligonucleotide+hybridization.">Elasticity of the transition state for oligonucleotide hybridization.</a> Nucleic Acids Research. 45 (2), 547-555 (2016).</li><li>Brockman, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live-cell+super-resolved+PAINT+imaging+of+piconewton+cellular+traction+forces.">Live-cell super-resolved PAINT imaging of piconewton cellular traction forces.</a> Nature Methods. 17 (10), 1018-1024 (2020).</li></ol>

With the detailed procedures provided here, one can prepare DNA hairpin tension probe substrates to map and quantify the receptor tension produced by immune cells. When cells are plated onto the DNA hairpin tension probe substrate, they land, attach, and spread as the receptors sense the ligands both chemically and mechanically, the latter of which is detected by our probes. However, in some cases cells may fail to spread (Figure 7A) or fail to produce tension signal. This is often a consequ...

Immune cells defend against pathogens and cancer cells by continuously crawling and scanning the surfaces of target cells for antigens, studding their surface1,2. Antigen recognition is initiated upon binding between the T cell receptor (TCR) and the peptide-major histocompatibility complex MHC (pMHC) complex expressed on the surface of target cells. Because TCR-pMHC recognition occurs at the junction between two mobile cells, it has long been suspected of experiencing mechanical forces. Moreover, this led to the mechanosensor model of TCR activation, which suggests that TCR forces contribute to its function3,4. To understand when, where, and how mechanical forces contribute to T cell function, it is imperative to develop tools to visualize the molecular forces transmitted by T cells. Traditionally, methods such as traction force microscopy (TFM) and micropillar arrays are used to investigate cellular forces5,6. However, the force sensitivity of TFM and micropillar arrays is at the nanonewton (nN) scale and thus is often insufficient to study the molecular piconewton (pN) forces transmitted by cell receptors7. To improve the force and spatial resolution for detection, our lab pioneered the development of molecular tension probes, which were initially synthesized using polyethylene glycol (PEG) polymers7. Molecular tension probes are comprised of an extendible molecular &#34;spring&#34; (PEG, protein, DNA) flanked by a fluorophore and quencher and are anchored on a surface. Forces applied to the terminus of the probe lead to its extension, separating the fluorophore and quencher, and thus generating a strong fluorescence signal (Figure 1A)8,9,10.
Over the past decade we have developed a library of different classes of molecular tension probes with spring elements made from nucleic acids11, proteins10, and polymers8. Among these, the DNA-based tension probes provide the highest signal to noise ratio and the greatest force sensitivity, which is easily tuned from a few pN up to ~20 pN11. We have used these real-time DNA tension probes to study the molecular forces generated by many diverse cell types, including fibroblasts, cancer cells, platelets, and immune cells11,12,13. This manuscript will describe protocols to synthesize and assemble DNA tension probes on a surface to map molecular receptor forces with pN force resolution using a conventional fluorescence microscope. While the current procedure includes chemical modifications to the nucleic acid to introduce the fluorescent reporter (Figure 1B), it is important to note that many of the modification and purification steps can be outsourced to custom DNA synthesis companies. Therefore, DNA tension probes technology is facile, and accessible to the broader cell biology and mechanobiology communities.
Briefly, to assemble DNA tension sensors, a DNA hairpin is hybridized to a fluorescent ligand strand on one arm and a quencher anchor strand on the other arm and then immobilized on a glass substrate (Figure 1C, real-time tension). In the absence of mechanical force, the hairpin is closed, and thus the fluorescence is quenched. However, when the applied mechanical force is greater than the F1/2 (the force at equilibrium that leads to a 50% probability of unfolding), the hairpin mechanically melts, and a fluorescent signal is generated.
Building on the real-time DNA tension sensor, we also describe protocols to map accumulated forces, which is particularly useful for studying interactions between receptors on immune cells and their natural ligand. This is because immune receptors often display short-lived bonds3,14. Accumulated forces are imaged using a &#34;locking&#34; strand that preferentially binds to open DNA hairpins and allows for the storage of fluorescence signals associated with mechanical pulling events (Figure 1C, locked tension). The locking strand is designed to bind a cryptic binding site that is exposed upon mechanically induced melting of the hairpin and lock the hairpin in the open state by blocking hairpin refolding, thus storing the tension signal, and generating an accumulated tension map. Moreover, the locking strand is designed with an eight-nucleotide toehold, which enables a toehold-mediated strand displacement reaction with its full complement, the &#34;unlocking&#34; strand. With the addition of the unlocking strand, the bound locking strand is stripped off the hairpin construct, erasing the stored tension signal and resetting the hairpin back to the real-time state.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/62348/62348fig01.jpg" /> 
Figure 1:&#160;Scheme of the state-of-art molecular tension probes. (A) General design of real-time molecular tension probe, (B) Strands for the DNA-based tension probe construct, and (C) engineered DNA-based tension probes and their toggling between real-time state and locked state. <a href="https://www.jove.com/files/ftp_upload/62348/62348fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
The main protocol consists of four major sections - oligonucleotide preparation, surface preparation, imaging, and data analysis. This protocol has been successfully demonstrated by our lab and others in na&#239;ve and activated OT-1 CD8+ T cells, OT-II CD4+ cells, as well as hybridomas, and can be applied to interrogate different immune cell receptors including T cell receptor, programmed cell death receptor (PD1), and lymphocyte function-associated antigen 1 (LFA-1) forces. OT-1 CD8+ na&#239;ve T cells are used as an example cell line in this paper.

<table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>&#160;3-hydroxypicolinic acid (3-HPA)</td>
			<td>Sigma</td>
			<td>56197</td>
			<td>maldi-TOF-MS matrix</td>
		</tr>
		<tr>
			<td>&#160;mPEG-SC</td>
			<td>Biochempeg</td>
			<td>MF001023-2K</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>(3-Aminopropyl)triethoxysilane</td>
			<td>Acros</td>
			<td>AC430941000</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>10x Red blood cell lysis buffer</td>
			<td>Biolegend</td>
			<td>00-4333-57</td>
			<td>buffer</td>
		</tr>
		<tr>
			<td>8.8 nm gold nanoparticles, tannic acid</td>
			<td>Nanocomposix</td>
			<td>customized order</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>Atto647N NHS ester</td>
			<td>Sigma</td>
			<td>18373-1MG-F</td>
			<td>fluorophore, oligo prep</td>
		</tr>
		<tr>
			<td>Attofluor Cell Chamber, for microscopy</td>
			<td>Thermo Fisher Scientific</td>
			<td>A7816</td>
			<td>imaging</td>
		</tr>
		<tr>
			<td>BD Syringes only with Luer-Lok</td>
			<td>BD bioscience</td>
			<td>309657</td>
			<td>cells</td>
		</tr>
		<tr>
			<td>biotinylated anti-mouse CD3e</td>
			<td>ebioscience</td>
			<td>13-0031-82</td>
			<td>antibody/ligand</td>
		</tr>
		<tr>
			<td>Biotinylated pMHC ovalbumin (SIINFEKL)</td>
			<td>NIH Tetramer Core Facility at Emory University</td>
			<td>NA</td>
			<td>antibody/ligand</td>
		</tr>
		<tr>
			<td>bovine serum albumin</td>
			<td>Sigma</td>
			<td>735078001</td>
			<td>block non-specific interactions</td>
		</tr>
		<tr>
			<td>Cell strainers</td>
			<td>Biologix</td>
			<td>15-1100</td>
			<td>cells</td>
		</tr>
		<tr>
			<td>Coverslip Mini-Rack, teflon</td>
			<td>Thermo Fisher Scientific</td>
			<td>C14784</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>Cy3B NHS ester</td>
			<td>GE Healthcare</td>
			<td>PA63101</td>
			<td>fluorophore, oligo prep</td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s phosphate-buffered saline (DPBS)</td>
			<td>Corning</td>
			<td>21-031-CM</td>
			<td>buffer</td>
		</tr>
		<tr>
			<td>ethanol</td>
			<td>Sigma</td>
			<td>459836</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>Hank&#8217;s balanced salts (HBSS)</td>
			<td>Sigma</td>
			<td>H8264</td>
			<td>buffer</td>
		</tr>
		<tr>
			<td>hydrogen peroxide</td>
			<td>Sigma</td>
			<td>H1009</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>LA-PEG-SC</td>
			<td>Biochempeg</td>
			<td>HE039023-3.4K</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>Midi MACS (LS) startup kit</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-301</td>
			<td>cells</td>
		</tr>
		<tr>
			<td>mouse CD8+ T cell isolation kit</td>
			<td>Miltenyi Biotec</td>
			<td>130-104-075</td>
			<td>cells</td>
		</tr>
		<tr>
			<td>Nanosep MF centrifugal devices</td>
			<td>Pall laboratory</td>
			<td>ODM02C35</td>
			<td>oligo prep</td>
		</tr>
		<tr>
			<td>No. 2 round glass coverslips</td>
			<td>VWR</td>
			<td>48382-085</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>NTA-SAM</td>
			<td>Dojindo Molecular Technologies</td>
			<td>N475-10</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>P2 gel</td>
			<td>Bio-rad</td>
			<td>1504118</td>
			<td>oligo prep</td>
		</tr>
		<tr>
			<td>sufuric acid</td>
			<td>EMD Millipore Corporation</td>
			<td>SX1244-6</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>Sulfo-NHS acetate</td>
			<td>Thermo Fisher Scientific</td>
			<td>26777</td>
			<td>surface prep</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Agilent AdvanceBio Oligonucleotide C18 column, 4.6 x 150 mm, 2.7 &#956;m</td>
			<td>653950-702</td>
			<td></td>
			<td>oligonucleotide preparation</td>
		</tr>
		<tr>
			<td>Barnstead Nanopure water purifying system</td>
			<td>Thermo Fisher</td>
			<td></td>
			<td>water</td>
		</tr>
		<tr>
			<td>CFI Apo 100&#215; NA 1.49 objective</td>
			<td>Nikon</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>Cy5 cube</td>
			<td>CHROMA</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>evolve electron multiplying charge coupled device (EMCCD)</td>
			<td>Photometrics</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>High-performance liquid chromatography</td>
			<td>Agilent 1100</td>
			<td></td>
			<td>oligonucleotide preparation</td>
		</tr>
		<tr>
			<td>Intensilight epifluorescence source</td>
			<td>Nikon</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>Matrix-assisted laser desorption/ionization time-of-flight mass spectrometer (MALDI-TOF-MS)</td>
			<td>Voyager STR</td>
			<td></td>
			<td>oligonucleotide preparation</td>
		</tr>
		<tr>
			<td>Nanodrop 2000 UV-Vis Spectrophotometer</td>
			<td>Thermo Fisher</td>
			<td></td>
			<td>oligonucleotide preparation</td>
		</tr>
		<tr>
			<td>Nikon Eclipse Ti inverted microscope</td>
			<td>Nikon</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>Nikon Perfect Focus System</td>
			<td>Nikon</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>NIS Elements software</td>
			<td>Nikon</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>quad band TIRF 405/488/561/647 cube</td>
			<td>CHROMA</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>RICM cube</td>
			<td>CHROMA</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>TIRF launcher with 488 nm (50 mW), 561 nm (50 mW), and 640 nm</td>
			<td>Coherent</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>TRITC cube</td>
			<td>CHROMA</td>
			<td></td>
			<td>Microscopy</td>
		</tr>
		<tr>
			<td>oligo name</td>
			<td>5&#39; modification / 3&#39; modification</td>
			<td>sequence (5&#39; to 3&#39;)</td>
			<td>Use</td>
		</tr>
		<tr>
			<td>15mer amine locking strand</td>
			<td>5&#39; modification: no modification 
			3&#39; modification: /3AmMO/</td>
			<td>AAA AAA CAT TTA TAC CCT ACC TA</td>
			<td>locking real-time tension signal</td>
		</tr>
		<tr>
			<td>15mer Atto647N locking strand</td>
			<td>5&#39; modification: Atto647N 
			3&#39; modification: /3AmMO/</td>
			<td>AAA AAA CAT TTA TAC CCT ACC TA</td>
			<td>locking real-time tension signal</td>
		</tr>
		<tr>
			<td>15mer non-fluoresccent locking strand</td>
			<td>5&#39; modification: no modification 
			3&#39; modification: no modification</td>
			<td>A AAA AAC ATT TAT AC</td>
			<td>locking real-time tension signal for quantitative analysis</td>
		</tr>
		<tr>
			<td>4.7 pN hairpin strand</td>
			<td>5&#39; modification: no modification 
			3&#39; modification: no modification</td>
			<td>GTGAAATACCGCACAGATGCGT 
 TTGTATAAATGTTTTTTTCATTTAT 
 ACTTTAAGAGCGCCACGTAGCC 
CAGC</td>
			<td>hairpin probe</td>
		</tr>
		<tr>
			<td>amine ligand strand</td>
			<td>5&#39; modification: /5AmMC6/ 
			3&#39; modification: /3Bio/</td>
			<td>CGCATCTGTGCG GTA TTT CAC TTT</td>
			<td>hairpin probe</td>
		</tr>
		<tr>
			<td>BHQ2 anchor strand</td>
			<td>5&#39; modification: /5ThiolMC6-D/ 
			3&#39; modification: /3BHQ_2/</td>
			<td>TTTGCTGGGCTACGTGGCGCTCTT</td>
			<td>&#160;&#160;&#160;hairpin probe</td>
		</tr>
		<tr>
			<td>Cy3B ligand strand</td>
			<td>5&#39; modification: Cy3B 
			3&#39; modification: /3Bio/</td>
			<td>CGCATCTGTGCG GTA TTT CAC TTT</td>
			<td>hairpin probe</td>
		</tr>
		<tr>
			<td>unlocking strand</td>
			<td>5&#39; modification: no modification 
			3&#39; modification: no modification</td>
			<td>TAG GTA GGG TAT AAA TGT TTT TTT C</td>
			<td>unlocking accumulated tension signal</td>
		</tr>
	</tbody>
</table>

dna tension probes to map the transient piconewton receptor forces by immune cells

Mechanical forces transmitted at the junction between two neighboring cells and at the junction between cells and the extracellular matrix are critical for regulating many processes ranging from development to immunology. Therefore, developing the tools to study these forces at the molecular scale is critical. Our group developed a suite of molecular tension sensors to quantify and visualize the forces generated by cells and transmitted to specific ligands. The most sensitive class of molecular tension sensors are comprised of nucleic acid stem-loop hairpins. These sensors use fluorophore-quencher pairs to report on the mechanical extension and unfolding of DNA hairpins under force. One challenge with DNA hairpin tension sensors is that they are reversible with rapid hairpin refolding upon termination of the tension and thus transient forces are difficult to record. In this article, we describe the protocols for preparing DNA tension sensors that can be "locked" and prevented from refolding to enable "storing" of mechanical information. This allows for the recording of highly transient piconewton forces, which can be subsequently "erased" by the addition of complementary nucleic acids that remove the lock. This ability to toggle between real-time tension mapping and mechanical information storing reveals weak, short-lived, and less abundant forces, that are commonly employed by T cells as part of their immune functions.

Here we show representative surface quality control images (Figure 4). A high-quality surface should have a clean background in RICM channel (Figure 4B), and uniform fluorescence intensity in Cy3B channel (Figure 4C). With the same imaging equipment and identical fluorescence imaging acquisition conditions, the background fluorescence intensity should be consistent and reproducible each time when conducting experiments with DNA prob...

Watch this Scientific Journal Video about DNA Tension Probes to Map the Transient Piconewton Receptor Forces by Immune Cells at JoVE.com

DNA Tension Probes to Map the Transient Piconewton Receptor Forces by Immune Cells

This paper describes a detailed protocol for using DNA-based tension probes to image the receptor forces applied by immune cells. This approach can map receptor forces &gt;4.7pN in real-time and can integrate forces over time.

Mechanical forces transmitted at the junction between two neighboring cells and at the junction between cells and the extracellular matrix are critical ...

This protocol offers a method to map the molecular forces generated by cells and particularly immune cells. The protocol is critical to labs interested in studying mechanotransduction in mechanobiology. The main advantage of this technique is that it is super easy and allows one to use conventional fluorescence microscopy to quantify force transmission in immortalized and primary cells.To begin, place 25 millimeter coverslips on a polytetrafluoroethylene rack in a 50 milliliter beaker and rinse the coverslips three times by submerging them in water. Mix equal volumes of ethanol and water and add 40 milliliters of this solution to the beaker containing the rack and the coverslips. Then, seal the beaker using parafilm tape.Clean the coverslips by sonicating the beaker for 15 minutes in an ultrasonic cleaner and discard the liquid after sonication. Then, rinse the beaker containing the rack and coverslips with water at least six times to remove any remaining organic solvent. To prepare a fresh piranha solution, add 30 milliliters of sulfuric acid to a 50 milliliter beaker and slowly add 10 milliliters of hydrogen peroxide.Gently mix the piranha solution using the end of a glass pipette. To initiate etching, transfer the rack holding the coverslips to the beaker containing piranha solution and incubate for 30 minutes at room temperature to cleanse and hydroxylate the coverslips. Then, transfer the rack using steel or polytetrafluoroethylene tweezers to a clean 50 milliliter beaker and rinse with water six times.In order to remove water completely, immerse the rack holding the coverslips in a 50 milliliter beaker with 40 milliliters of ethanol. Then, discard the ethanol. Next, immerse the rack in 40 milliliters of ethanol containing 3%aminopropyltriethoxysilane for one hour at room temperature to initiate the reaction with the hydroxyl group on the coverslips.Rinse the surface of the coverslips six times by submerging them in 40 milliliters of ethanol and dry them in an oven at 80 degrees Celsius for 20 minutes. Cover the inner bottom of the Petri dish with a parafilm tape to prevent the coverslips from sliding inside the Petri dish. Then place the amine covered coverslips with the side to be functionalized with DNA tension probes facing up.Cover the coverslips at 20 degrees Celsius for future use. To modify the amine groups on the coverslips, add lipoic acid PEG NHS and mPEG NHS and incubate the Petri dish at room temperature for one hour. At the end of the incubation, rinse the surface three times with water.After that, add 100 microliters of 0.1 molar sodium bicarbonate containing one milligram per milliliter of Sulfo-NHS-Acetate to a set of sandwich coverslips and incubate for 30 minutes for passivation to occur. Add 0.5 milliliters of gold nanoparticles to each coverslip and incubate for 30 minutes at room temperature. After incubation, rinse the coverslips with water three times.After adding Black Hole Quencher 2 strand to the annealed DNA tension probe at a ten to one ratio, add 100 microliters of the mixture per two coverslips to make the sandwich. Carefully place a wet lab tissue ball in the Petri dish away from the coverslips and seal the dish with parafilm tape to prevent the solution from drying. After that, cover the dish with a foil and incubate it at four degrees Celsius overnight.On the next day, assemble the imaging chamber, taking care to prevent surface cracking while tightening the chamber. Then, add 0.5 to one milliliters of Hank's Balanced Salt Solution to the imaging chamber. Use the Cy3B channel with a 100X objective to capture fluorescent signals of cells plated onto the DNA hairpin tension probes when they start to spread.After preparing 100 microMolar non fluorescent locking strand stock, at the desired time point, add it to the cells at a final concentration of one microMolar in the imaging chamber to store the tension signal and mix it with the cells by pipetting. After about 10 minutes of locking, acquire time-lapse movies or endpoint images in epifluorescence for both qualitative tension mapping and quantitative analysis. A successful surface had a pale pink color.The high quality of the surface was demonstrated with a clean background and the reflection interference contrast microscopy or RICM channel and uniform fluorescence intensity in the Cy3B channel. Time-lapse images of tension locking indicated that both TCR anti-CD3 epsilon and TCR-peptide-MHC tension signals were amplified because of hairpin locking and signal accumulation. The locking strand recorded short-lived mechanical pulling events of TCR peptide MHCN4 starting at zero minutes, which facilitated quantitative analysis and revealed the distinct pattern of the TCR peptide MHC force that resembled the bullseye pattern of immune synapses.Every step, your intention probe substrate preparation needs attention to detail and careful handling of the materials. This technology enables visualization of transient molecular forces that occur at the cell surface when it interacts with the environment, especially in the immune cells in search for antigens.

dna-tension-probes-to-map-transient-piconewton-receptor-forces-immune

Research

JoVE Journal

Bioengineering

2.5K 조회수.  Emory University. 이 프로토콜은 세포, 특히 면역 세포에서 생성된 분자력을 매핑하는 방법을 제공합니다. 이 프로토콜은 기계 생물학에서 기계 변환을 연구하는 데 관심이 있는 실험실에 매우 중요합니다. 이 기술의 가장 큰 장점은 매우 쉽고 기존의 형광 현미경을 사용하여 불멸화 및 일차 세포에서 힘 전달을 정량화할 수 있다는 것입니다.시작하려면 25밀리리터 비커의 폴리테트라플?...