This work was supported by a grant from the National Natural Science Foundation of China (No. 31871413) and two Programs of Guangdong Science and Technology (2017B020230002 and 2016B030231001). We are truly grateful to the researchers who have helped us during the study and to the staff members working in the animal center for their support in animal care.

<ol>
	<li>Zoukhri, D., Macari, E., Kublin, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+injection+of+interleukin-1+induces+reversible+aqueous+tear+deficiency,+lacrimal+gland+inflammation,+and+acinar+and+ductal+cell+proliferation.">A single injection of interleukin-1 induces reversible aqueous tear deficiency, lacrimal gland inflammation, and acinar and ductal cell proliferation.</a> Experimental Eye Research. 84 (5), 894-904 (2007).</li><li>Gromova, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lacrimal+gland+repair+using+progenitor+cells.">Lacrimal gland repair using progenitor cells.</a> Stem Cells Translational Medicine. 6 (1), 88-98 (2016).</li><li>Buzhor, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-based+therapy+approaches:+the+hope+for+incurable+diseases.">Cell-based therapy approaches: the hope for incurable diseases.</a> Regenerative Medicine. 9 (5), 649-672 (2014).</li><li>Tiwari, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishing+human+lacrimal+gland+cultures+with+secretory+function.">Establishing human lacrimal gland cultures with secretory function.</a> PLoS One. 7 (1), 29458 (2012).</li><li>You, S., Kublin, C. L., Avidan, O., Miyasaki, D., Zoukhri, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+propagation+of+mesenchymal+stem+cells+from+the+lacrimal+gland.">Isolation and propagation of mesenchymal stem cells from the lacrimal gland.</a> Investigative Ophthalmology &amp; Visual Science. 52 (5), 2087-2094 (2011).</li><li>Ackermann, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+investigation+of+presumptive+murine+lacrimal+gland+stem+cells.">Isolation and investigation of presumptive murine lacrimal gland stem cells.</a> Investigative Ophthalmology &amp; Visual Science. 56 (8), 4350-4363 (2015).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459 (7244), 262-265 (2009).</li><li>Lugli, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=R-spondin+1+and+noggin+facilitate+expansion+of+resident+stem+cells+from+non-damaged+gallbladders.">R-spondin 1 and noggin facilitate expansion of resident stem cells from non-damaged gallbladders.</a> EMBO Reports. 17 (5), 769-779 (2016).</li><li>Huch, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+culture+of+genome-stable+bipotent+stem+cells+from+adult+human+liver.">Long-term culture of genome-stable bipotent stem cells from adult human liver.</a> Cell. 160 (1), 299-312 (2015).</li><li>Boj, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoid+models+of+human+and+mouse+ductal+pancreatic+cancer.">Organoid models of human and mouse ductal pancreatic cancer.</a> Cell. 160 (1), 324-338 (2015).</li><li>Barker, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lgr5+(ve)+stem+cells+drive+self-renewal+in+the+stomach+and+build+long-lived+gastric+units+in+vitro.">Lgr5+(ve) stem cells drive self-renewal in the stomach and build long-lived gastric units in vitro.</a> Cell Stem Cell. 6 (1), 25-36 (2010).</li><li>Linnemann, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+regenerative+potential+in+primary+human+mammary+epithelial+cells.">Quantification of regenerative potential in primary human mammary epithelial cells.</a> Development. 142 (18), 3239-3251 (2015).</li><li>Rock, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basal+cells+as+stem+cells+of+the+mouse+trachea+and+human+airway+epithelium.">Basal cells as stem cells of the mouse trachea and human airway epithelium.</a> Proceedings of the National Academy of Sciences of the United States of America. 106 (31), 12771-12775 (2009).</li><li>Chua, C. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+luminal+epithelial+progenitors+can+generate+prostate+organoids+in+culture.">Single luminal epithelial progenitors can generate prostate organoids in culture.</a> Nature Cell Biology. 16 (1), 951-961 (2014).</li><li>Maimets, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+in+vitro+expansion+of+salivary+gland+stem+cells+driven+by+Wnt+signals.">Long-term in vitro expansion of salivary gland stem cells driven by Wnt signals.</a> Stem Cell Reports. 6 (1), 150-162 (2016).</li><li>Xiao, S., Zhang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+long-term+serum-free+culture+for+lacrimal+gland+stem+cells+aiming+at+lacrimal+gland+repair.">Establishment of long-term serum-free culture for lacrimal gland stem cells aiming at lacrimal gland repair.</a> Stem Cell Research &amp; Therapy. 11 (1), 20 (2020).</li><li>Shatos, M. A., Haugaard-Kedstrom, L., Hodges, R. R., Dartt, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+progenitor+cells+in+uninjured,+adult+rat+lacrimal+gland.">Isolation and characterization of progenitor cells in uninjured, adult rat lacrimal gland.</a> Investigative Ophthalmology &amp; Visual Science. 53 (6), 2749-2759 (2012).</li><li>Mishima, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transplantation+of+side+population+cells+restores+the+function+of+damaged+exocrine+glands+through+clusterin.">Transplantation of side population cells restores the function of damaged exocrine glands through clusterin.</a> Stem Cells. 30 (9), 1925-1937 (2012).</li><li>Aluri, H. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+bone+marrow-derived+mesenchymal+stem+cells+improves+tear+production+in+a+mouse+model+of+sj&#246;gren's+syndrome.">Delivery of bone marrow-derived mesenchymal stem cells improves tear production in a mouse model of sj&#246;gren's syndrome.</a> Stem Cells International. 2017, 1-10 (2017).</li><li>Dietrich, J., Schrader, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+lacrimal+gland+regeneration:+current+concepts+and+experimental+approaches.">Towards lacrimal gland regeneration: current concepts and experimental approaches.</a> Current Eye Research. 45 (3), 230-240 (2020).</li><li>Sato, T., Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SnapShot:+growing+organoids+from+stem+cells.">SnapShot: growing organoids from stem cells.</a> Cell. 161 (7), 1700 (2015).</li><li>Kleinman, H. K., Martin, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Matrigel:+basement+membrane+matrix+with+biological+activity.">Matrigel: basement membrane matrix with biological activity.</a> Seminars in Cancer Biology. 15 (5), 378-386 (2005).</li><li>Arnaoutova, I., George, J., Kleinman, H. K., Benton, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basement+membrane+matrix+(BME)+has+multiple+uses+with+stem+cells.">Basement membrane matrix (BME) has multiple uses with stem cells.</a> Stem Cell Reviews and Reports. 8 (1), 163-169 (2012).</li></ol>

The authors declare that they have no competing interests.

There are well-established methods for the isolation and in vitro culture of lacrimal stem cells for lacrimal stem cell culture and LG injury repair. Shatos et al.17 and Ackermannet al.6 successfully cultured and subcultured lacrimal stem cells of rats and mice by 2D culture methods, respectively, making it possible to transplant lacrimal stem cells for the treatment of ADDED. Studies on stem cells18 and mesenchymal stem cells<sup c...

Lacrimal gland stem cells (LGSCs) maintain lacrimal gland (LG) cell renewal and are the source of acinar and ductal cells. Therefore, LGSC transplantation is considered an alternative approach for treating severe inflammatory damage and aqueous-deficient dry eye disease (ADDED)1,2,3. Several culture methods have been applied to enrich LGSCs. Tiwari et al. separated and cultured primary LG cells using collagen I and matrix gel supplemented with several growth factors; however, the LG cells could not be continuously cultured4. Using two-dimensional (2D) culture, mouse LG-derived stem cells were isolated by You et al.5 and Ackermann et al.6, found to express the stem/progenitor cell marker genes, Oct4, Sox2, Nanog, and nestin, and could be subcultured. However, there is no clear indication that these cells can differentiate into acinar or ductal cells, and there is no transplantation experiment to verify the differentiation potential in vivo.
Recently, c-kit+ dim/EpCAM+/Sca1-/CD34-/CD45- cells were isolated from mouse LGs by flow cytometry, found to express LG progenitor cell markers, such as Pax6 and Runx1, and differentiated into ducts and acini in vitro. In mice with ADDED, orthotopic injection with these cells could repair damaged LGs and restore the secretory function of LGs2. However, the number of stem cells isolated by this method was small, and there are no suitable culture conditions for expanding the isolated LGSCs. In summary, an appropriate culture system needs to be established to effectively isolate and culture adult LGSCs with stable and continuous expansion for the study of LGSCs in the treatment of ADDED.
Organoids derived from stem cells or pluripotent stem cells are a group of cells that are histologically similar to the related organs and can maintain their own renewal. After the mouse intestine organoid was successfully cultured by Sato et al. in 20097, organoids from other organs were cultured in succession, based on Sato&#39;s culture system, such as gallbladder8, liver9, pancreas10, stomach11, breast12, lung13, prostate14, and salivary gland15. Due to the high proportion of adult stem cells before cell differentiation in organoid culture, the three-dimensional (3D) organoid culture method is considered optimal for the isolation and culture of adult stem cells of LG.
An adult mouse LGSC culture system was established in the present study by optimizing the 3D, serum-free culture method. It is proven that the LGSCs cultured from both normal and ADDED mice showed a stable capacity of self-renewal and proliferation. After transplantation into the ADDED mouse LGs, LGSCs colonized the impaired LGs and improved tear production. In addition, red fluorescent LGSCs were isolated from ROSA26mT/mG mice and cultured. This work provides a reliable reference for LGSC enrichment in vitro and LGSC autograft in clinical application for ADDED therapy.

<table><tbody><tr><td>&lt;u&gt;&lt;em&gt;Animal(Mouse)&lt;/em&gt;&lt;/u&gt;</td><td></td><td></td><td></td></tr><tr><td>Bal B/C</td><td>Model Animal Research Center of Nanjing University</td><td></td><td></td></tr><tr><td>C57 BL/6J</td><td>Laboratory Animal Center of Sun Yat-sen University</td><td></td><td></td></tr><tr><td>NOD/ShiLtJ</td><td>Model Animal Research Center of Nanjing University</td><td></td><td></td></tr><tr><td>ROSA26&lt;sup&gt;mT/mG&lt;/sup&gt;</td><td>Model Animal Research Center of Nanjing University</td><td></td><td></td></tr><tr><td>&lt;u&gt;&lt;em&gt;Equipment&lt;/em&gt;&lt;/u&gt;</td><td></td><td></td><td></td></tr><tr><td>Analytical balance</td><td>Sartorius</td><td></td><td></td></tr><tr><td>Automatic dehydrator</td><td>Thermo</td><td></td><td></td></tr><tr><td>Blood counting chamber</td><td>BLAU</td><td></td><td></td></tr><tr><td>Cell Counter</td><td>CountStar</td><td></td><td></td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt; constant temperature incubator</td><td>Thermo</td><td></td><td></td></tr><tr><td>ECL Gel imaging system</td><td>GE healthcare</td><td></td><td></td></tr><tr><td>Electric bath for water bath</td><td>Yiheng Technology</td><td></td><td></td></tr><tr><td>Electrophoresis apparatus</td><td>BioRad</td><td></td><td></td></tr><tr><td>Fluorescence quantitative PCR instrument</td><td>Roche</td><td></td><td></td></tr><tr><td>Frozen tissue slicer</td><td>Lecia</td><td></td><td></td></tr><tr><td>Horizontal centrifuge</td><td>CENCE</td><td></td><td></td></tr><tr><td>Inverted fluorescence microscope</td><td>Nikon</td><td></td><td></td></tr><tr><td>Inverted microscope</td><td>Olympus</td><td></td><td></td></tr><tr><td>Laser lamellar scanning micrograph</td><td>Carl Zeiss</td><td></td><td></td></tr><tr><td>Liquid nitrogen container</td><td>Thermo</td><td></td><td></td></tr><tr><td>Low temperature high speed centrifuge</td><td>Eppendorf</td><td></td><td></td></tr><tr><td>Micropipettor</td><td>Gilson</td><td></td><td></td></tr><tr><td>Microwave oven</td><td>Panasonic</td><td></td><td></td></tr><tr><td>Nanodrop ultraviolet spectrophotometer</td><td>Thermo</td><td>measure RNA concentration</td><td></td></tr><tr><td>Paraffin slicing machine</td><td>Thermo</td><td></td><td></td></tr><tr><td>PCR Amplifier</td><td>Eppendorf</td><td></td><td></td></tr><tr><td>pH value tester</td><td>Sartorius</td><td></td><td></td></tr><tr><td>4 &amp;deg;C Refrigerator</td><td>Haier</td><td></td><td></td></tr><tr><td>Thermostatic culture oscillator</td><td>ZHICHENG</td><td></td><td></td></tr><tr><td>Tissue paraffin embedding instrument</td><td>Thermo</td><td></td><td></td></tr><tr><td>&amp;nbsp;-80&amp;deg;C Ultra-low temperature refrigerator</td><td>Thermo</td><td></td><td></td></tr><tr><td>&amp;nbsp;-20&amp;deg;C Ultra-low temperature refrigerator</td><td>Thermo</td><td></td><td></td></tr><tr><td>Ultra pure water purification system</td><td>ELGA</td><td></td><td></td></tr><tr><td>&lt;u&gt;&lt;em&gt;Reagent&lt;/em&gt;&lt;/u&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Animal Experiment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>HCG</td><td>Sigma</td><td>9002-61-3</td><td></td></tr><tr><td>PMSG</td><td>Sigma</td><td>14158-65-7</td><td></td></tr><tr><td>Pentobarbital Sodium</td><td>Sigma</td><td>57-33-0</td><td></td></tr><tr><td>&lt;strong&gt;Cell Culture&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>B27</td><td>Gibco</td><td>17504044</td><td></td></tr><tr><td>Collagenase I</td><td>Gibco</td><td>17018029</td><td></td></tr><tr><td>Dispase</td><td>BD</td><td>354235</td><td></td></tr><tr><td>DMEM</td><td>Sigma</td><td>D6429</td><td></td></tr><tr><td>DMEM/F12</td><td>Sigma</td><td>D0697</td><td></td></tr><tr><td>DMSO</td><td>Sigma</td><td>67-68-5</td><td></td></tr><tr><td>EDTA</td><td>Sangon Biotech</td><td>A500895</td><td></td></tr><tr><td>Foetal Bovine Serum</td><td>Gibco</td><td>04-001-1ACS</td><td></td></tr><tr><td>GlutaMax</td><td>Gibco</td><td>35050087</td><td></td></tr><tr><td>Human FGF10</td><td>PeproTech</td><td>100-26</td><td></td></tr><tr><td>Matrigel (Matrix gel)</td><td>BD</td><td>356231</td><td></td></tr><tr><td>Murine Noggin</td><td>PeproTech</td><td>250-38</td><td></td></tr><tr><td>Murine Wnt3A</td><td>PeproTech</td><td>315-20</td><td></td></tr><tr><td>Murine EGF</td><td>PeproTech</td><td>315-09</td><td></td></tr><tr><td>NEAA</td><td>Gibco</td><td>11140050</td><td></td></tr><tr><td>N2</td><td>Gibco</td><td>17502048</td><td></td></tr><tr><td>R-spondin 1</td><td>PeproTech</td><td>120-38</td><td></td></tr><tr><td>Trypsin Inhibitor (TI)</td><td>Sigma</td><td>T6522</td><td>Derived from &lt;em&gt;Glycine max&lt;/em&gt;; can inhibit trypsin, chymotrypsin, and plasminase to a lesser extent. One mg will inhibit 1.0-3.0 mg of trypsin.</td></tr><tr><td>Trypsin</td><td>Sigma</td><td>&amp;nbsp;T4799</td><td></td></tr><tr><td>Y-27632</td><td>Selleck</td><td>S1049</td><td></td></tr><tr><td>&lt;strong&gt;HE staining &amp;amp; Immunostaining&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Alexa Fluor 488 donkey anti-Mouse IgG</td><td>Thermo</td><td>A-21202</td><td>Used dilution: IHC) 2 &amp;mu;g/mL, (IF) 0.2 &amp;mu;g/mL</td></tr><tr><td>Alexa Fluor 488 donkey anti-Rabbit IgG</td><td>Thermo</td><td>A-21206</td><td>Used dilution: (IHC) 2 &amp;mu;g/mL, (IF) 2 &amp;mu;g/mL</td></tr><tr><td>Alexa Fluor 568 donkey anti-Mouse IgG</td><td>Thermo</td><td>A-10037</td><td>Used dilution: (IHC) 2 &amp;mu;g/mL, (IF) 2 &amp;mu;g/mL</td></tr><tr><td>Alexa Fluor 568 donkey anti-Rabbit IgG</td><td>Thermo</td><td>A-10042</td><td>Used dilution: (IHC) 2 &amp;mu;g/mL, (IF) 4 &amp;mu;g/mL</td></tr><tr><td>Anti-AQP5 rabbit antibody</td><td>Abcam</td><td>ab104751</td><td>Used dilution: (IHC) 1 &amp;mu;g/mL, (IF) 0.1 &amp;mu;g/mL</td></tr><tr><td>Anti-E-cadherin Rat antibody</td><td>Abcam</td><td>ab11512</td><td>Used dilution: (IF)&amp;nbsp; 5 &amp;mu;g/mL</td></tr><tr><td>Anti-Keratin14 rabbit antibody</td><td>Abcam</td><td>ab181595</td><td>Used dilution: (IHC) 1 &amp;mu;g/mL, (IF) 2 &amp;mu;g/mL</td></tr><tr><td>Anti-Ki67 rabbit antibody</td><td>Abcam</td><td>ab15580</td><td>Used dilution: (IHC) 1 &amp;mu;g/mL, (IF) 1 &amp;mu;g/mL</td></tr><tr><td>Anti-mCherry mouse antibody</td><td>Abcam</td><td>ab125096</td><td>Used dilution: (IHC) 2 &amp;mu;g/mL, (IF) 2 &amp;mu;g/mL</td></tr><tr><td>Anti-mCherry rabbit antibody</td><td>Abcam</td><td>ab167453</td><td>Used dilution: (IF)&amp;nbsp; 2 &amp;mu;g/mL</td></tr><tr><td>C&lt;sub&gt;6&lt;/sub&gt;H&lt;sub&gt;8&lt;/sub&gt;O&lt;sub&gt;7&lt;/sub&gt;</td><td>Sangon Biotech</td><td>A501702-0500</td><td></td></tr><tr><td>Citric Acid</td><td>Sangon Biotech</td><td>201-069-1</td><td></td></tr><tr><td>DAB Kit (20x)</td><td>CWBIO</td><td>CW0125</td><td></td></tr><tr><td>DAPI</td><td>Thermo</td><td>62248</td><td></td></tr><tr><td>Eosin</td><td>BASO</td><td>68115</td><td></td></tr><tr><td>Fluorescent Mounting Medium</td><td>Dako</td><td>S3023</td><td></td></tr><tr><td>Formalin</td><td>Sangon Biotech</td><td>A501912-0500</td><td></td></tr><tr><td>Goat anti-Mouse IgG antibody (HRP)</td><td>Abcam</td><td>ab6789</td><td>Used dilution: 2 &amp;mu;g/mL</td></tr><tr><td>Goat anti-Rabbit IgG antibody(HRP)</td><td>Abcam</td><td>ab6721</td><td>Used dilution: 2 &amp;mu;g/mL</td></tr><tr><td>Hematoxylin</td><td>BASO</td><td>517-28-2</td><td></td></tr><tr><td>Histogel (Embedding hydrogel)</td><td>Thermo</td><td>HG-400-012</td><td></td></tr><tr><td>30% H&lt;sub&gt;2&lt;/sub&gt;O&lt;sub&gt;2&lt;/sub&gt;</td><td>Guangzhou Chemistry</td><td>KD10</td><td></td></tr><tr><td>30% Hydrogen Peroxide Solution</td><td>Guangzhou Chemistry</td><td>7722-84-1</td><td></td></tr><tr><td>Methanol</td><td>Guangzhou Chemistry</td><td>67-56-1</td><td></td></tr><tr><td>Na&lt;sub&gt;3&lt;/sub&gt;C&lt;sub&gt;6&lt;/sub&gt;H&lt;sub&gt;5&lt;/sub&gt;O&lt;sub&gt;7&lt;/sub&gt;.2H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Sangon Biotech</td><td>A501293-0500</td><td></td></tr><tr><td>Neutral balsam</td><td>SHANGHAI YIYANG</td><td>YY-Neutral balsam</td><td></td></tr><tr><td>Non-immunized Goat Serum</td><td>BOSTER</td><td>AR0009</td><td></td></tr><tr><td>Paraffin</td><td>Sangon Biotech</td><td>A601891-0500</td><td></td></tr><tr><td>Paraformaldehyde</td><td>DAMAO</td><td>200-001-8</td><td></td></tr><tr><td>Saccharose</td><td>Guangzhou Chemistry</td><td>57-50-1</td><td></td></tr><tr><td>Sodium citrate tribasic dihydrate</td><td>Sangon Biotech</td><td>200-675-3</td><td></td></tr><tr><td>Sucrose</td><td>Guangzhou Chemistry</td><td>IB11-AR-500G</td><td></td></tr><tr><td>Tissue-Tek O.T.C. Compound</td><td>SAKURA</td><td>SAKURA.4583</td><td></td></tr><tr><td>Triton X-100</td><td>DINGGUO</td><td>9002-93-1</td><td></td></tr><tr><td>Xylene</td><td>Guangzhou Chemistry</td><td>128686-03-3</td><td></td></tr><tr><td>&lt;strong&gt;RT-PCR &amp;amp; qRT-PCR&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Agarose</td><td>Sigma</td><td>9012-36-6</td><td></td></tr><tr><td>Alcohol</td><td>Guangzhou Chemistry</td><td>64-17-5</td><td></td></tr><tr><td>Chloroform</td><td>Guangzhou Chemistry</td><td>865-49-6</td><td></td></tr><tr><td>Ethidium Bromide</td><td>Sangon Biotech</td><td>214-984-6</td><td></td></tr><tr><td>Isopropyl Alcohol</td><td>Guangzhou Chemistry</td><td>67-63-0</td><td></td></tr><tr><td>LightCycler 480 SYBR Green I Master Mix</td><td>Roche</td><td>488735200H</td><td></td></tr><tr><td>ReverTra Ace qPCR RT Master Mix</td><td>TOYOBO</td><td>-</td><td></td></tr><tr><td>Taq DNA Polymerase</td><td>TAKARA</td><td>R10T1</td><td></td></tr><tr><td>Goldview (nucleic acid stain)</td><td>BioSharp</td><td>BS357A</td><td></td></tr><tr><td>TRIzol</td><td>Magen</td><td>R4801-02</td><td></td></tr><tr><td>&lt;strong&gt;Vector Construction &amp;amp; Cell Transfection&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Agar</td><td>OXID</td><td>-</td><td></td></tr><tr><td>Ampicillin</td><td>Sigma</td><td>69-52-3</td><td></td></tr><tr><td>Chloramphenicol</td><td>Sigma</td><td>56-75-7</td><td></td></tr><tr><td>Endotoxin-free Plasmid Extraction Kit</td><td>Thermo</td><td>A36227</td><td></td></tr><tr><td>Kanamycin</td><td>Sigma</td><td>25389-94-0</td><td></td></tr><tr><td>Lipo3000 Plasmid Transfection Kit</td><td>Thermo</td><td>L3000015</td><td></td></tr><tr><td>LR Reaction Kit</td><td>Thermo</td><td>11791019</td><td></td></tr><tr><td>Plasmid Extraction Kit</td><td>TIANGEN</td><td>DP103</td><td></td></tr><tr><td>Trans5&amp;alpha; Chemically Competent Cell</td><td>TRANSGEN</td><td>CD201-01</td><td></td></tr><tr><td>Trytone</td><td>OXID</td><td>-</td><td></td></tr><tr><td>Yeast Extract</td><td>OXID</td><td>-</td><td></td></tr><tr><td>&lt;strong&gt;Primers and Sequence&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Primer&lt;/strong&gt;: AQP5&lt;br/&gt; &lt;strong&gt;Sequence&lt;/strong&gt;:&lt;br/&gt; F: CATGAACCCAGCCCGATCTT&lt;br/&gt; R: CTTCTGCTCCCATCCCATCC</td><td>Synbio Tech</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Primer&lt;/strong&gt;: &amp;beta;-actin&lt;br/&gt; &lt;strong&gt;Sequence&lt;/strong&gt;:&lt;br/&gt; F: AGATCAAGATCATTGCTCCTCCT&lt;br/&gt; R: AGATCAAGATCATTGCTCCTCCT</td><td>Synbio Tech</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Primer&lt;/strong&gt;: Epcam&lt;br/&gt; &lt;strong&gt;Sequence&lt;/strong&gt;:&lt;br/&gt; F: CATTTGCTCCAAACTGGCGT&lt;br/&gt; R: TGTCCTTGTCGGTTCTTCGG</td><td>Synbio Tech</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Primer&lt;/strong&gt;: Krt5&lt;br/&gt; &lt;strong&gt;Sequence&lt;/strong&gt;:&lt;br/&gt; F: AGCAATGGCGTTCTGGAGG&lt;br/&gt; R: GCTGAAGGTCAGGTAGAGCC</td><td>Synbio Tech</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Primer&lt;/strong&gt;: Krt14&lt;br/&gt; &lt;strong&gt;Sequence&lt;/strong&gt;:&lt;br/&gt; F: CGGACCAAGTTTGAGACGGA&lt;br/&gt; R: GCCACCTCCTCGTGGTTC</td><td>Synbio Tech</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Primer&lt;/strong&gt;: Krt19&lt;br/&gt; &lt;strong&gt;Sequence&lt;/strong&gt;:&lt;br/&gt; F: TCTTTGAAAAACACTGAACCCTG&lt;br/&gt; R: TGGCTCCTCAGGGCAGTAAT</td><td>Synbio Tech</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Primer&lt;/strong&gt;: Ltf&lt;br/&gt; &lt;strong&gt;Sequence&lt;/strong&gt;:&lt;br/&gt; F: CACATGCTGTCGTATCCCGA&lt;br/&gt; R: CGATGCCCTGATGGACGA</td><td>Synbio Tech</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Primer&lt;/strong&gt;: Nestin&lt;br/&gt; &lt;strong&gt;Sequence&lt;/strong&gt;:&lt;br/&gt; F: GGGGCTACAGGAGTGGAAAC&lt;br/&gt; R: GACCTCTAGGGTTCCCGTCT</td><td>Synbio Tech</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Primer&lt;/strong&gt;: P63&lt;br/&gt; &lt;strong&gt;Sequence&lt;/strong&gt;:&lt;br/&gt; F: TCCTATCACGGGAAGGCAGA&lt;br/&gt; R: GTACCATCGCCGTTCTTTGC</td><td>Synbio Tech</td><td></td><td></td></tr><tr><td>&lt;u&gt;&lt;em&gt;Vector&lt;/em&gt;&lt;/u&gt;</td><td></td><td></td><td></td></tr><tr><td>pLX302 lentivirus no-load vector</td><td>Addgene</td><td></td><td></td></tr><tr><td>pENRTY-mCherry</td><td>Xiaofeng Qin laboratory, Sun Yat-sen University</td><td></td><td></td></tr></tbody></table>

three-dimensional, serum-free culture system for lacrimal gland stem cells

Lacrimal gland (LG) stem cell-based therapy is a promising strategy for lacrimal gland diseases. However, the lack of a reliable, serum-free culture method to obtain a sufficient number of LG stem cells (LGSCs) is one obstacle for further research and application. The three-dimensional (3D), serum-free culture method for adult mouse LGSCs is well established and shown here. The LGSCs could be continuously passaged and induced to differentiate to acinar or ductal-like cells.
For the LGSC primary culture, the LGs from 6-8-week-old mice were digested with dispase, collagenase I, and trypsin-EDTA. A total of 1 &#215; 104 single cells were seeded into 80 &#181;L of matrix gel-lacrimal gland stem cell medium (LGSCM) matrix in each well of a 24-well plate, precoated with 20 &#181;L of matrix gel-LGSCM matrix. The mix was solidified after incubation for 20 min at 37 &#176;C, and 600 &#181;L of LGSCM added.
For LGSC maintenance, LGSCs cultured for 7 days were disaggregated into single cells by dispase and trypsin-EDTA. The single cells were implanted and cultured according to the method used in the LGSC primary culture. LGSCs could be passaged over 40 times and continuously express stem/progenitor cell markers Krt14, Krt5, P63, and nestin. LGSCs cultured in LGSCM have self-renewal capacity and can differentiate into acinar or ductal-like cells in vitro and in vivo.

Establish 3D, serum-free culture system 
In this study, LGSCM containing EGF, Wnt3A, FGF10, and Y-27632 for mouse LGSCs was developed, and LGSCs were successfully isolated and cultured by a 3D culture method (Figure 1A). A successful 3D, serum-free culture system of LGSCs from C57BL/6 mice, NOD/ShiLtJ mice, BALB/c mice, and ROSA26mT/mG mice has been established using this method16. For a male mouse, 1.5-2 &#215; 106 cells we...

Watch this Scientific Journal Video about Three-Dimensional, Serum-Free Culture System for Lacrimal Gland Stem Cells at JoVE.com

Three-Dimensional, Serum-Free Culture System for Lacrimal Gland Stem Cells

The three-dimensional, serum-free culture method for adult lacrimal gland (LG) stem cells is well established for the induction of LG organoid formation and differentiation into acinar or ductal-like cells.

Lacrimal gland (LG) stem cell-based therapy is a promising strategy for lacrimal gland diseases. However, the lack of a reliable, serum-free culture ...

three-dimensional-serum-free-culture-system-for-lacrimal-gland-stem

Research

JoVE Journal

Biology

2.3K Views.  Sun Yat-sen University. The three-dimensional, serum-free culture method for adult lacrimal gland (LG) stem cells is well established for the induction of LG organoid formation and differentiation into acinar or ductal-like cells.

Video: Three-Dimensional, Serum-Free Culture System for Lacrimal Gland Stem Cells

A Simple Hanging Drop Cell Culture Protocol for Generation of 3D Spheroids

Studies of cell-cell cohesion and cell-substratum adhesion have historically been performed on monolayer cultures adherent to rigid substrates. Cells within a tissue, however, are typically encased within a closely packed tissue mass in which cells establish intimate connections with many near-neighbors and with extracellular matrix components. Accordingly, the chemical milieu and physical forces experienced by cells within a 3D tissue are fundamentally different than those experienced by cells grown in monolayer culture. This has been shown to markedly impact cellular morphology and signaling. Several methods have been devised to generate 3D cell cultures including encapsulation of cells in collagen gels1or in biomaterial scaffolds2. Such methods, while useful, do not recapitulate the intimate direct cell-cell adhesion architecture found in normal tissues. Rather, they more closely approximate culture systems in which single cells are loosely dispersed within a 3D meshwork of ECM products. Here, we describe a simple method in which cells are placed in hanging drop culture and incubated under physiological conditions until they form true 3D spheroids in which cells are in direct contact with each other and with extracellular matrix components. The method requires no specialized equipment and can be adapted to include addition of any biological agent in very small quantities that may be of interest in elucidating effects on cell-cell or cell-ECM interaction. The method can also be used to co-culture two (or more) different cell populations so as to elucidate the role of cell-cell or cell-ECM interactions in specifying spatial relationships between cells. Cell-cell cohesion and cell-ECM adhesion are the cornerstones of studies of embryonic development, tumor-stromal cell interaction in malignant invasion, wound healing, and for applications to tissue engineering. This simple method will provide a means of generating tissue-like cellular aggregates for measurement of biomechanical properties or for molecular and biochemical analysis in a physiologically relevant model.

We describe a simple, rapid method of generating 3D tissue-like spheroids and their potential application to quantify differences in cell-cell interactions.

Studies of cell-cell cohesion and cell-substratum adhesion have historically been performed on monolayer cultures adherent to rigid substrates. Cells ...

Bioengineering

Efficient and Scalable Directed Differentiation of Clinically Compatible Corneal Limbal Epithelial Stem Cells from Human Pluripotent Stem Cells

Corneal limbal epithelial stem cells (LESCs) are responsible for continuously renewing the corneal epithelium, and thus maintaining corneal homeostasis and visual clarity. Human pluripotent stem cell (hPSC)-derived LESCs provide a promising cell source for corneal cell replacement therapy. Undefined, xenogeneic culture and differentiation conditions cause variation in research results and impede the clinical translation of hPSC-derived therapeutics. This protocol provides a reproducible and efficient method for hPSC-LESC differentiation under xeno- and feeder cell-free conditions. Firstly, monolayer culture of undifferentiated hPSC on recombinant laminin-521 (LN-521) and defined hPSC medium serves as a foundation for robust production of high-quality starting material for differentiations. Secondly, a rapid and simple hPSC-LESC differentiation method yields LESC populations in only 24 days. This method includes a four-day surface ectodermal induction in suspension with small molecules, followed by adherent culture phase on LN-521/collagen IV combination matrix in defined corneal epithelial differentiation medium. Cryostoring and extended differentiation further purifies the cell population and enables banking of the cells in large quantities for cell therapy products. The resulting high-quality hPSC-LESCs provide a potential novel treatment strategy for corneal surface reconstruction to treat limbal stem cell deficiency (LSCD).

This protocol introduces a simple two-step method for differentiating corneal limbal epithelial stem cells from human pluripotent stem cells under xeno- and feeder cell-free culture conditions. The cell culture methods presented here enable cost-efficient, large-scale production of clinical quality cells applicable to corneal cell therapy use.

Corneal limbal epithelial stem cells (LESCs) are responsible for continuously renewing the corneal epithelium, and thus maintaining corneal homeostasis ...

Developmental Biology

Serum Free Production of Three-dimensional Human Hepatospheres from Pluripotent Stem Cells

The development of renewable sources of liver tissue is required to improve cell-based modelling, and develop human tissue&#160;for transplantation. Human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs) represent promising sources of human liver spheres. We have developed a serum free and defined method of cellular differentiation to generate three-dimensional human liver spheres formed from human pluripotent stem cells. A potential limitation of the technology is the production of dense spheres with dead material inside. In order to circumvent this, we have employed agarose microwell technology at defined cell densities to control the size of the 3D spheres, preventing the generation of apoptotic and/or necrotic cores.&#160; Notably, the spheres generated by our approach display liver function and stable phenotype, representing a valuable resource for basic and applied scientific research. We believe that our approach could be used as a platform technology to develop further tissues to model and treat human disease and in the future may permit the generation of human tissue with complex tissue architecture.

This protocol describes an approach to produce hepatospheres from human pluripotent stem cells using a defined culture system and cell self-assembly. This protocol is reproducible in a number of cell lines, cost effective and allows the production of stable human hepatospheres for biomedical application.

The development of renewable sources of liver tissue is required to improve cell-based modelling, and develop human tissue&#160;for transplantation. Human ...

Synthesis of Biocompatible Liquid Crystal Elastomer Foams as Cell Scaffolds for 3D Spatial Cell Cultures

Here, we present a step-by-step preparation of a 3D, biodegradable, foam-like cell scaffold. These scaffolds were prepared by cross-linking star block co-polymers featuring cholesterol units as side-chain pendant groups, resulting in smectic-A (SmA) liquid crystal elastomers (LCEs). Foam-like scaffolds, prepared using metal templates, feature interconnected microchannels, making them suitable as 3D cell culture scaffolds. The combined properties of the regular structure of the metal foam and of the elastomer result in a 3D cell scaffold that promotes not only higher cell proliferation compared to conventional porous templated films, but also better management of mass transport (i.e., nutrients, gases, waste, etc.). The nature of the metal template allows for the easy manipulation of foam shapes (i.e., rolls or films) and for the preparation of scaffolds of different pore sizes for different cell studies while preserving the interconnected porous nature of the template. The etching process does not affect the chemistry of the elastomers, preserving their biocompatible and biodegradable nature. We show that these smectic LCEs, when grown for extensive time periods, enable the study of clinically relevant and complex tissue constructs while promoting the growth and proliferation of cells.

This study presents a methodology to prepare 3D, biodegradable, foam-like cell scaffolds based on biocompatible side-chain liquid crystal elastomers (LCEs). Confocal microscopy experiments show that foam-like LCEs allow for cell attachment, proliferation, and the spontaneous alignment of C2C12s myoblasts.

Here, we present a step-by-step preparation of a 3D, biodegradable, foam-like cell scaffold. These scaffolds were prepared by cross-linking star block ...

Developing HiPSC Derived Serum Free Embryoid Bodies for the Interrogation of 3-D Stem Cell Cultures Using Physiologically Relevant Assays

Although a number of in vitro disease models have been developed using hiPSCs, one limitation is that these two-dimensional (2-D) systems may not represent the underlying cytoarchitectural and functional complexity of the affected individuals carrying suspected disease variants. Conventional 2-D models remain incomplete representations of in vivo-like structures and do not adequately capture the complexity of the brain. Thus, there is an emerging need for more 3-D hiPSC-based models that can better recapitulate the cellular interactions and functions seen in an in vivo system.
Here we report a protocol to develop a 3-D system from undifferentiated hiPSCs based on the serum free embryoid body (SFEB). This 3-D model mirrors aspects of a developing ventralized neocortex and allows for studies into functions integral to living neural cells and intact tissue such as migration, connectivity, communication, and maturation. Specifically, we demonstrate that the SFEBs using our protocol can be interrogated using physiologically relevant and high-content cell based assays such as calcium imaging, and multi-electrode array (MEA) recordings without cryosectioning. In the case of MEA recordings, we demonstrate that SFEBs increase both spike activity and network-level bursting activity during long-term culturing. This SFEB protocol provides a robust and scalable system for the study of developing network formation in a 3-D model that captures aspects of early cortical development.

Here we report a protocol to develop a three-dimensional (3-D) system from human induced-pluripotent stem cells (hiPSCs) called the serum free embryoid body (SFEB). This 3-D model can be used like an organotypic slice culture to model human cortical development and for the physiological interrogation of developing neural circuits.

Although a number of in vitro disease models have been developed using hiPSCs, one limitation is that these two-dimensional (2-D) systems may not ...

Neuroscience

Non-enzymatic, Serum-free Tissue Culture of Pre-invasive Breast Lesions for Spontaneous Generation of Mammospheres

Breast ductal carcinoma in situ (DCIS), by definition, is proliferation of neoplastic epithelial cells within the confines of the breast duct, without breaching the collagenous basement membrane. While DCIS is a non-obligate precursor to invasive breast cancers, the molecular mechanisms and cell populations that permit progression to invasive cancer are not fully known. To determine if progenitor cells capable of invasion existed within the DCIS cell population, we developed a methodology for collecting and culturing sterile human breast tissue at the time of surgery, without enzymatic disruption of tissue.
Sterile breast tissue containing ductal segments is harvested from surgically excised breast tissue following routine pathological examination. Tissue containing DCIS is placed in nutrient rich, antibiotic-containing, serum free medium, and transported to the tissue culture laboratory. The breast tissue is further dissected to isolate the calcified areas. Multiple breast tissue pieces (organoids) are placed in a minimal volume of serum free medium in a flask with a removable lid and cultured in a humidified CO2 incubator. Epithelial and fibroblast cell populations emerge from the organoid after 10 - 14 days. Mammospheres spontaneously form on and around the epithelial cell monolayer. Specific cell populations can be harvested directly from the flask without disrupting neighboring cells. Our non-enzymatic tissue culture system reliably reveals cytogenetically abnormal, invasive progenitor cells from fresh human DCIS lesions.

Primary cell culture using intact tissue organoids provides a model system that mimics the multi-cellular in vivo microenvironment. We developed a serum-free primary breast epithelium tissue culture model that perpetuates mixed cell culture lineages and exhibits differentiated morphology, without enzymatic tissue disruption. Breast organoids remain viable for &#62;6 months.

Breast ductal carcinoma in situ (DCIS), by definition, is proliferation of neoplastic epithelial cells within the confines of the breast duct, without ...

Manipulating the Murine Lacrimal Gland

The lacrimal gland (LG) secretes aqueous tears necessary for maintaining the structure and function of the cornea, a transparent tissue essential for vision. In the human a single LG resides in the orbit above the lateral end of each eye delivering tears to the ocular surface through 3 - 5 ducts. The mouse has three pairs of major ocular glands, the most studied of which is the exorbital lacrimal gland (LG) located anterior and ventral to the ear. Similar to other glandular organs, the LG develops through the process of epithelial branching morphogenesis in which a single epithelial bud within a condensed mesenchyme undergoes multiple rounds of bud and duct formation to form an intricate interconnected network of secretory acini and ducts. This elaborate process has been well documented in many other epithelial organs such as the pancreas and salivary gland. However, the LG has been much less explored and the mechanisms controlling morphogenesis are poorly understood. We suspect that this under-representation as a model system is a consequence of the difficulties associated with finding, dissecting and culturing the LG. Thus, here we describe dissection techniques for harvesting embryonic and post-natal LG and methods for ex vivo culture of the tissue.

The lacrimal gland (LG) is a branching organ that produces the aqueous components of tears necessary for maintaining vision and ocular health. Here we describe murine LG dissection and ex vivo culture techniques to decipher signaling pathways involved in LG development.

The lacrimal gland (LG) secretes aqueous tears necessary for maintaining the structure and function of the cornea, a transparent tissue essential for ...

Isolation of Myoepithelial Cells from Adult Murine Lacrimal and Submandibular Glands

The lacrimal gland (LG) is an exocrine tubuloacinar gland that secretes an aqueous layer of tear film. The LG epithelial tree is comprised of acinar, ductal epithelial, and myoepithelial cells (MECs). MECs express alpha smooth muscle actin (&#945;SMA) and have a contractile function. They are found in multiple glandular organs and are of ectodermal origin. In addition, the LG contains SMA+ vascular smooth muscle cells of endodermal origin called pericytes: contractile cells that envelop the surface of vascular tubes. A new protocol allows us to isolate both MECs and pericytes from adult murine LGs and submandibular glands (SMGs). The protocol is based on the genetic labeling of MECs and pericytes using the SMACreErt2/+:Rosa26-TdTomatofl/fl mouse strain, followed by preparation of the LG single-cell suspension for fluorescence activated cell sorting (FACS). The protocol allows for the separation of these two cell populations of different origins based on the expression of the epithelial cell adhesion molecule (EpCAM) by MECs, whereas pericytes do not express EpCAM. Isolated cells could be used for cell cultivation or gene expression analysis.

The lacrimal gland (LG) has two cell types expressing &#945;-smooth muscle actin (&#945;SMA): myoepithelial cells (MECs) and pericytes. MECs are of ectodermal origin, found in many glandular tissues, while pericytes are vascular smooth muscle cells of endodermal origin. This protocol isolates MECs and pericytes from murine LGs.

The lacrimal gland (LG) is an exocrine tubuloacinar gland that secretes an aqueous layer of tear film. The LG epithelial tree is comprised of acinar, ...

Establishment, Maintenance, Differentiation, Genetic Manipulation, and Transplantation of Mouse and Human Lacrimal Gland Organoids

The lacrimal gland is an essential organ for ocular surface homeostasis. By producing the aqueous part of the tear film, it protects the eye from desiccation stress and external insults. Little is known about lacrimal gland (patho)physiology because of the lack of adequate in vitro models. Organoid technology has proven itself as a useful experimental platform for multiple organs. Here, we share a protocol to establish and maintain mouse and human lacrimal gland organoids starting from lacrimal gland biopsies. By modifying the culture conditions, we enhance lacrimal gland organoid functionality. Organoid functionality can be probed through a "crying" assay, which involves exposing the lacrimal gland organoids to selected neurotransmitters to trigger tear release in their lumen. We explain how to image and quantify this phenomenon. To investigate the role of genes of interest in lacrimal gland homeostasis, these can be genetically modified. We thoroughly describe how to genetically modify lacrimal gland organoids using base editors-from guide RNA design to organoid clone genotyping. Lastly, we show how to probe the regenerative potential of human lacrimal gland organoids by orthotopic implantation in the mouse. Together, this comprehensive toolset provides resources to use mouse and human lacrimal gland organoids to study lacrimal gland (patho)physiology.

This protocol describes how to establish, maintain, genetically modify, differentiate, functionally characterize, and transplant lacrimal gland organoids derived from primary mouse and human tissue.

The lacrimal gland is an essential organ for ocular surface homeostasis. By producing the aqueous part of the tear film, it protects the eye from ...

Photobiomodulation Growth Augmentation of Hydrogel Embedded Stem Cells 

Three&#45;Dimensional Cell Culture of Adipose-Derived Stem Cells in a Hydrogel with Photobiomodulation Augmentation

Adipose-derived stem cells (ADSCs), possessing multipotent mesenchymal characteristics akin to stem cells, are frequently employed in regenerative medicine due to their capacity for a diverse range of cell differentiation and their ability to enhance migration, proliferation, and mitigate inflammation. However, ADSCs often face challenges in survival and engraftment within wounds, primarily due to unfavorable inflammatory conditions. To address this issue, hydrogels have been developed to sustain ADSC viability in wounds and expedite the wound healing process. Here, we aimed to assess the synergistic impact of photobiomodulation (PBM) on ADSC proliferation and cytotoxicity within a 3D cell culture framework. Immortalized ADSCs were seeded into 10 &#181;L hydrogels at a density of 2.5 x 103 cells and subjected to irradiation using 525 nm and 825 nm diodes at fluencies of 5 J/cm2 and 10 J/cm2. Morphological changes, cytotoxicity, and proliferation were evaluated at 24 h and 10 days post-PBM exposure. The ADSCs exhibited a rounded morphology and were dispersed throughout the gel as individual cells or spheroid aggregates. Importantly, both PBM and 3D culture framework displayed no cytotoxic effects on the cells, while PBM significantly enhanced the proliferation rates of ADSCs. In conclusion, this study demonstrates the use of hydrogel as a suitable 3D environment for ADSC culture and introduces PBM as a significant augmentation strategy, particularly addressing the slow proliferation rates associated with 3D cell culture.

Author Spotlight: Advancements in Stem Cell Regenerative Therapy Through Photobiomodulation

Here, we present a protocol demonstrating the use of hydrogel as a three-dimensional (3D) cell culture framework for adipose-derived stem cell (ADSC) culture and introducing photobiomodulation (PBM) to enhance the proliferation of ADSCs within the 3D culture setting.