This work was supported by a grant from the National Natural Science Foundation of China (No. 31871413) and two Programs of Guangdong Science and Technology (2017B020230002 and 2016B030231001). We are truly grateful to the researchers who have helped us during the study and to the staff members working in the animal center for their support in animal care.

<ol>
	<li>Zoukhri, D., Macari, E., Kublin, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+injection+of+interleukin-1+induces+reversible+aqueous+tear+deficiency,+lacrimal+gland+inflammation,+and+acinar+and+ductal+cell+proliferation.">A single injection of interleukin-1 induces reversible aqueous tear deficiency, lacrimal gland inflammation, and acinar and ductal cell proliferation.</a> Experimental Eye Research. 84 (5), 894-904 (2007).</li><li>Gromova, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lacrimal+gland+repair+using+progenitor+cells.">Lacrimal gland repair using progenitor cells.</a> Stem Cells Translational Medicine. 6 (1), 88-98 (2016).</li><li>Buzhor, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-based+therapy+approaches:+the+hope+for+incurable+diseases.">Cell-based therapy approaches: the hope for incurable diseases.</a> Regenerative Medicine. 9 (5), 649-672 (2014).</li><li>Tiwari, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishing+human+lacrimal+gland+cultures+with+secretory+function.">Establishing human lacrimal gland cultures with secretory function.</a> PLoS One. 7 (1), 29458 (2012).</li><li>You, S., Kublin, C. L., Avidan, O., Miyasaki, D., Zoukhri, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+propagation+of+mesenchymal+stem+cells+from+the+lacrimal+gland.">Isolation and propagation of mesenchymal stem cells from the lacrimal gland.</a> Investigative Ophthalmology &amp; Visual Science. 52 (5), 2087-2094 (2011).</li><li>Ackermann, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+investigation+of+presumptive+murine+lacrimal+gland+stem+cells.">Isolation and investigation of presumptive murine lacrimal gland stem cells.</a> Investigative Ophthalmology &amp; Visual Science. 56 (8), 4350-4363 (2015).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459 (7244), 262-265 (2009).</li><li>Lugli, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=R-spondin+1+and+noggin+facilitate+expansion+of+resident+stem+cells+from+non-damaged+gallbladders.">R-spondin 1 and noggin facilitate expansion of resident stem cells from non-damaged gallbladders.</a> EMBO Reports. 17 (5), 769-779 (2016).</li><li>Huch, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+culture+of+genome-stable+bipotent+stem+cells+from+adult+human+liver.">Long-term culture of genome-stable bipotent stem cells from adult human liver.</a> Cell. 160 (1), 299-312 (2015).</li><li>Boj, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoid+models+of+human+and+mouse+ductal+pancreatic+cancer.">Organoid models of human and mouse ductal pancreatic cancer.</a> Cell. 160 (1), 324-338 (2015).</li><li>Barker, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lgr5+(ve)+stem+cells+drive+self-renewal+in+the+stomach+and+build+long-lived+gastric+units+in+vitro.">Lgr5+(ve) stem cells drive self-renewal in the stomach and build long-lived gastric units in vitro.</a> Cell Stem Cell. 6 (1), 25-36 (2010).</li><li>Linnemann, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+regenerative+potential+in+primary+human+mammary+epithelial+cells.">Quantification of regenerative potential in primary human mammary epithelial cells.</a> Development. 142 (18), 3239-3251 (2015).</li><li>Rock, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basal+cells+as+stem+cells+of+the+mouse+trachea+and+human+airway+epithelium.">Basal cells as stem cells of the mouse trachea and human airway epithelium.</a> Proceedings of the National Academy of Sciences of the United States of America. 106 (31), 12771-12775 (2009).</li><li>Chua, C. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+luminal+epithelial+progenitors+can+generate+prostate+organoids+in+culture.">Single luminal epithelial progenitors can generate prostate organoids in culture.</a> Nature Cell Biology. 16 (1), 951-961 (2014).</li><li>Maimets, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+in+vitro+expansion+of+salivary+gland+stem+cells+driven+by+Wnt+signals.">Long-term in vitro expansion of salivary gland stem cells driven by Wnt signals.</a> Stem Cell Reports. 6 (1), 150-162 (2016).</li><li>Xiao, S., Zhang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+long-term+serum-free+culture+for+lacrimal+gland+stem+cells+aiming+at+lacrimal+gland+repair.">Establishment of long-term serum-free culture for lacrimal gland stem cells aiming at lacrimal gland repair.</a> Stem Cell Research &amp; Therapy. 11 (1), 20 (2020).</li><li>Shatos, M. A., Haugaard-Kedstrom, L., Hodges, R. R., Dartt, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+progenitor+cells+in+uninjured,+adult+rat+lacrimal+gland.">Isolation and characterization of progenitor cells in uninjured, adult rat lacrimal gland.</a> Investigative Ophthalmology &amp; Visual Science. 53 (6), 2749-2759 (2012).</li><li>Mishima, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transplantation+of+side+population+cells+restores+the+function+of+damaged+exocrine+glands+through+clusterin.">Transplantation of side population cells restores the function of damaged exocrine glands through clusterin.</a> Stem Cells. 30 (9), 1925-1937 (2012).</li><li>Aluri, H. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+bone+marrow-derived+mesenchymal+stem+cells+improves+tear+production+in+a+mouse+model+of+sj&#246;gren's+syndrome.">Delivery of bone marrow-derived mesenchymal stem cells improves tear production in a mouse model of sj&#246;gren's syndrome.</a> Stem Cells International. 2017, 1-10 (2017).</li><li>Dietrich, J., Schrader, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+lacrimal+gland+regeneration:+current+concepts+and+experimental+approaches.">Towards lacrimal gland regeneration: current concepts and experimental approaches.</a> Current Eye Research. 45 (3), 230-240 (2020).</li><li>Sato, T., Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SnapShot:+growing+organoids+from+stem+cells.">SnapShot: growing organoids from stem cells.</a> Cell. 161 (7), 1700 (2015).</li><li>Kleinman, H. K., Martin, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Matrigel:+basement+membrane+matrix+with+biological+activity.">Matrigel: basement membrane matrix with biological activity.</a> Seminars in Cancer Biology. 15 (5), 378-386 (2005).</li><li>Arnaoutova, I., George, J., Kleinman, H. K., Benton, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basement+membrane+matrix+(BME)+has+multiple+uses+with+stem+cells.">Basement membrane matrix (BME) has multiple uses with stem cells.</a> Stem Cell Reviews and Reports. 8 (1), 163-169 (2012).</li></ol>

The authors declare that they have no competing interests.

There are well-established methods for the isolation and in vitro culture of lacrimal stem cells for lacrimal stem cell culture and LG injury repair. Shatos et al.17 and Ackermannet al.6 successfully cultured and subcultured lacrimal stem cells of rats and mice by 2D culture methods, respectively, making it possible to transplant lacrimal stem cells for the treatment of ADDED. Studies on stem cells18 and mesenchymal stem cells<sup c...

Lacrimal gland stem cells (LGSCs) maintain lacrimal gland (LG) cell renewal and are the source of acinar and ductal cells. Therefore, LGSC transplantation is considered an alternative approach for treating severe inflammatory damage and aqueous-deficient dry eye disease (ADDED)1,2,3. Several culture methods have been applied to enrich LGSCs. Tiwari et al. separated and cultured primary LG cells using collagen I and matrix gel supplemented with several growth factors; however, the LG cells could not be continuously cultured4. Using two-dimensional (2D) culture, mouse LG-derived stem cells were isolated by You et al.5 and Ackermann et al.6, found to express the stem/progenitor cell marker genes, Oct4, Sox2, Nanog, and nestin, and could be subcultured. However, there is no clear indication that these cells can differentiate into acinar or ductal cells, and there is no transplantation experiment to verify the differentiation potential in vivo.
Recently, c-kit+ dim/EpCAM+/Sca1-/CD34-/CD45- cells were isolated from mouse LGs by flow cytometry, found to express LG progenitor cell markers, such as Pax6 and Runx1, and differentiated into ducts and acini in vitro. In mice with ADDED, orthotopic injection with these cells could repair damaged LGs and restore the secretory function of LGs2. However, the number of stem cells isolated by this method was small, and there are no suitable culture conditions for expanding the isolated LGSCs. In summary, an appropriate culture system needs to be established to effectively isolate and culture adult LGSCs with stable and continuous expansion for the study of LGSCs in the treatment of ADDED.
Organoids derived from stem cells or pluripotent stem cells are a group of cells that are histologically similar to the related organs and can maintain their own renewal. After the mouse intestine organoid was successfully cultured by Sato et al. in 20097, organoids from other organs were cultured in succession, based on Sato&#39;s culture system, such as gallbladder8, liver9, pancreas10, stomach11, breast12, lung13, prostate14, and salivary gland15. Due to the high proportion of adult stem cells before cell differentiation in organoid culture, the three-dimensional (3D) organoid culture method is considered optimal for the isolation and culture of adult stem cells of LG.
An adult mouse LGSC culture system was established in the present study by optimizing the 3D, serum-free culture method. It is proven that the LGSCs cultured from both normal and ADDED mice showed a stable capacity of self-renewal and proliferation. After transplantation into the ADDED mouse LGs, LGSCs colonized the impaired LGs and improved tear production. In addition, red fluorescent LGSCs were isolated from ROSA26mT/mG mice and cultured. This work provides a reliable reference for LGSC enrichment in vitro and LGSC autograft in clinical application for ADDED therapy.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Animal(Mouse)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Bal B/C</td>
			<td>Model Animal Research Center of Nanjing University</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>C57 BL/6J</td>
			<td>Laboratory Animal Center of Sun Yat-sen University</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>NOD/ShiLtJ</td>
			<td>Model Animal Research Center of Nanjing University</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ROSA26mT/mG</td>
			<td>Model Animal Research Center of Nanjing University</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Analytical balance</td>
			<td>Sartorius</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Automatic dehydrator</td>
			<td>Thermo</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Blood counting chamber</td>
			<td>BLAU</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Cell Counter</td>
			<td>CountStar</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CO2 constant temperature incubator</td>
			<td>Thermo</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ECL Gel imaging system</td>
			<td>GE healthcare</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Electric bath for water bath</td>
			<td>Yiheng Technology</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Electrophoresis apparatus</td>
			<td>BioRad</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescence quantitative PCR instrument</td>
			<td>Roche</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Frozen tissue slicer</td>
			<td>Lecia</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Horizontal centrifuge</td>
			<td>CENCE</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Inverted fluorescence microscope</td>
			<td>Nikon</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Inverted microscope</td>
			<td>Olympus</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Laser lamellar scanning micrograph</td>
			<td>Carl Zeiss</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Liquid nitrogen container</td>
			<td>Thermo</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Low temperature high speed centrifuge</td>
			<td>Eppendorf</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Micropipettor</td>
			<td>Gilson</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microwave oven</td>
			<td>Panasonic</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Nanodrop ultraviolet spectrophotometer</td>
			<td>Thermo</td>
			<td>measure RNA concentration</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraffin slicing machine</td>
			<td>Thermo</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PCR Amplifier</td>
			<td>Eppendorf</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pH value tester</td>
			<td>Sartorius</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>4 &#176;C Refrigerator</td>
			<td>Haier</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Thermostatic culture oscillator</td>
			<td>ZHICHENG</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Tissue paraffin embedding instrument</td>
			<td>Thermo</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>&#160;-80&#176;C Ultra-low temperature refrigerator</td>
			<td>Thermo</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>&#160;-20&#176;C Ultra-low temperature refrigerator</td>
			<td>Thermo</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra pure water purification system</td>
			<td>ELGA</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Animal Experiment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HCG</td>
			<td>Sigma</td>
			<td>9002-61-3</td>
			<td></td>
		</tr>
		<tr>
			<td>PMSG</td>
			<td>Sigma</td>
			<td>14158-65-7</td>
			<td></td>
		</tr>
		<tr>
			<td>Pentobarbital Sodium</td>
			<td>Sigma</td>
			<td>57-33-0</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell Culture</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>B27</td>
			<td>Gibco</td>
			<td>17504044</td>
			<td></td>
		</tr>
		<tr>
			<td>Collagenase I</td>
			<td>Gibco</td>
			<td>17018029</td>
			<td></td>
		</tr>
		<tr>
			<td>Dispase</td>
			<td>BD</td>
			<td>354235</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Sigma</td>
			<td>D6429</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/F12</td>
			<td>Sigma</td>
			<td>D0697</td>
			<td></td>
		</tr>
		<tr>
			<td>DMSO</td>
			<td>Sigma</td>
			<td>67-68-5</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Sangon Biotech</td>
			<td>A500895</td>
			<td></td>
		</tr>
		<tr>
			<td>Foetal Bovine Serum</td>
			<td>Gibco</td>
			<td>04-001-1ACS</td>
			<td></td>
		</tr>
		<tr>
			<td>GlutaMax</td>
			<td>Gibco</td>
			<td>35050087</td>
			<td></td>
		</tr>
		<tr>
			<td>Human FGF10</td>
			<td>PeproTech</td>
			<td>100-26</td>
			<td></td>
		</tr>
		<tr>
			<td>Matrigel (Matrix gel)</td>
			<td>BD</td>
			<td>356231</td>
			<td></td>
		</tr>
		<tr>
			<td>Murine Noggin</td>
			<td>PeproTech</td>
			<td>250-38</td>
			<td></td>
		</tr>
		<tr>
			<td>Murine Wnt3A</td>
			<td>PeproTech</td>
			<td>315-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Murine EGF</td>
			<td>PeproTech</td>
			<td>315-09</td>
			<td></td>
		</tr>
		<tr>
			<td>NEAA</td>
			<td>Gibco</td>
			<td>11140050</td>
			<td></td>
		</tr>
		<tr>
			<td>N2</td>
			<td>Gibco</td>
			<td>17502048</td>
			<td></td>
		</tr>
		<tr>
			<td>R-spondin 1</td>
			<td>PeproTech</td>
			<td>120-38</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin Inhibitor (TI)</td>
			<td>Sigma</td>
			<td>T6522</td>
			<td>Derived from Glycine max; can inhibit trypsin, chymotrypsin, and plasminase to a lesser extent. One mg will inhibit 1.0-3.0 mg of trypsin.</td>
		</tr>
		<tr>
			<td>Trypsin</td>
			<td>Sigma</td>
			<td>&#160;T4799</td>
			<td></td>
		</tr>
		<tr>
			<td>Y-27632</td>
			<td>Selleck</td>
			<td>S1049</td>
			<td></td>
		</tr>
		<tr>
			<td>HE staining &#38; Immunostaining</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa Fluor 488 donkey anti-Mouse IgG</td>
			<td>Thermo</td>
			<td>A-21202</td>
			<td>Used dilution: IHC) 2 &#956;g/mL, (IF) 0.2 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Alexa Fluor 488 donkey anti-Rabbit IgG</td>
			<td>Thermo</td>
			<td>A-21206</td>
			<td>Used dilution: (IHC) 2 &#956;g/mL, (IF) 2 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Alexa Fluor 568 donkey anti-Mouse IgG</td>
			<td>Thermo</td>
			<td>A-10037</td>
			<td>Used dilution: (IHC) 2 &#956;g/mL, (IF) 2 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Alexa Fluor 568 donkey anti-Rabbit IgG</td>
			<td>Thermo</td>
			<td>A-10042</td>
			<td>Used dilution: (IHC) 2 &#956;g/mL, (IF) 4 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Anti-AQP5 rabbit antibody</td>
			<td>Abcam</td>
			<td>ab104751</td>
			<td>Used dilution: (IHC) 1 &#956;g/mL, (IF) 0.1 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Anti-E-cadherin Rat antibody</td>
			<td>Abcam</td>
			<td>ab11512</td>
			<td>Used dilution: (IF)&#160; 5 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Anti-Keratin14 rabbit antibody</td>
			<td>Abcam</td>
			<td>ab181595</td>
			<td>Used dilution: (IHC) 1 &#956;g/mL, (IF) 2 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Anti-Ki67 rabbit antibody</td>
			<td>Abcam</td>
			<td>ab15580</td>
			<td>Used dilution: (IHC) 1 &#956;g/mL, (IF) 1 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Anti-mCherry mouse antibody</td>
			<td>Abcam</td>
			<td>ab125096</td>
			<td>Used dilution: (IHC) 2 &#956;g/mL, (IF) 2 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Anti-mCherry rabbit antibody</td>
			<td>Abcam</td>
			<td>ab167453</td>
			<td>Used dilution: (IF)&#160; 2 &#956;g/mL</td>
		</tr>
		<tr>
			<td>C6H8O7</td>
			<td>Sangon Biotech</td>
			<td>A501702-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>Citric Acid</td>
			<td>Sangon Biotech</td>
			<td>201-069-1</td>
			<td></td>
		</tr>
		<tr>
			<td>DAB Kit (20x)</td>
			<td>CWBIO</td>
			<td>CW0125</td>
			<td></td>
		</tr>
		<tr>
			<td>DAPI</td>
			<td>Thermo</td>
			<td>62248</td>
			<td></td>
		</tr>
		<tr>
			<td>Eosin</td>
			<td>BASO</td>
			<td>68115</td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescent Mounting Medium</td>
			<td>Dako</td>
			<td>S3023</td>
			<td></td>
		</tr>
		<tr>
			<td>Formalin</td>
			<td>Sangon Biotech</td>
			<td>A501912-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>Goat anti-Mouse IgG antibody (HRP)</td>
			<td>Abcam</td>
			<td>ab6789</td>
			<td>Used dilution: 2 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Goat anti-Rabbit IgG antibody(HRP)</td>
			<td>Abcam</td>
			<td>ab6721</td>
			<td>Used dilution: 2 &#956;g/mL</td>
		</tr>
		<tr>
			<td>Hematoxylin</td>
			<td>BASO</td>
			<td>517-28-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Histogel (Embedding hydrogel)</td>
			<td>Thermo</td>
			<td>HG-400-012</td>
			<td></td>
		</tr>
		<tr>
			<td>30% H2O2</td>
			<td>Guangzhou Chemistry</td>
			<td>KD10</td>
			<td></td>
		</tr>
		<tr>
			<td>30% Hydrogen Peroxide Solution</td>
			<td>Guangzhou Chemistry</td>
			<td>7722-84-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Methanol</td>
			<td>Guangzhou Chemistry</td>
			<td>67-56-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Na3C6H5O7.2H2O</td>
			<td>Sangon Biotech</td>
			<td>A501293-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>Neutral balsam</td>
			<td>SHANGHAI YIYANG</td>
			<td>YY-Neutral balsam</td>
			<td></td>
		</tr>
		<tr>
			<td>Non-immunized Goat Serum</td>
			<td>BOSTER</td>
			<td>AR0009</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraffin</td>
			<td>Sangon Biotech</td>
			<td>A601891-0500</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraformaldehyde</td>
			<td>DAMAO</td>
			<td>200-001-8</td>
			<td></td>
		</tr>
		<tr>
			<td>Saccharose</td>
			<td>Guangzhou Chemistry</td>
			<td>57-50-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium citrate tribasic dihydrate</td>
			<td>Sangon Biotech</td>
			<td>200-675-3</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>Guangzhou Chemistry</td>
			<td>IB11-AR-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>Tissue-Tek O.T.C. Compound</td>
			<td>SAKURA</td>
			<td>SAKURA.4583</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>DINGGUO</td>
			<td>9002-93-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Xylene</td>
			<td>Guangzhou Chemistry</td>
			<td>128686-03-3</td>
			<td></td>
		</tr>
		<tr>
			<td>RT-PCR &#38; qRT-PCR</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Sigma</td>
			<td>9012-36-6</td>
			<td></td>
		</tr>
		<tr>
			<td>Alcohol</td>
			<td>Guangzhou Chemistry</td>
			<td>64-17-5</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>Guangzhou Chemistry</td>
			<td>865-49-6</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium Bromide</td>
			<td>Sangon Biotech</td>
			<td>214-984-6</td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropyl Alcohol</td>
			<td>Guangzhou Chemistry</td>
			<td>67-63-0</td>
			<td></td>
		</tr>
		<tr>
			<td>LightCycler 480 SYBR Green I Master Mix</td>
			<td>Roche</td>
			<td>488735200H</td>
			<td></td>
		</tr>
		<tr>
			<td>ReverTra Ace qPCR RT Master Mix</td>
			<td>TOYOBO</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Taq DNA Polymerase</td>
			<td>TAKARA</td>
			<td>R10T1</td>
			<td></td>
		</tr>
		<tr>
			<td>Goldview (nucleic acid stain)</td>
			<td>BioSharp</td>
			<td>BS357A</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol</td>
			<td>Magen</td>
			<td>R4801-02</td>
			<td></td>
		</tr>
		<tr>
			<td>Vector Construction &#38; Cell Transfection</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Agar</td>
			<td>OXID</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Sigma</td>
			<td>69-52-3</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloramphenicol</td>
			<td>Sigma</td>
			<td>56-75-7</td>
			<td></td>
		</tr>
		<tr>
			<td>Endotoxin-free Plasmid Extraction Kit</td>
			<td>Thermo</td>
			<td>A36227</td>
			<td></td>
		</tr>
		<tr>
			<td>Kanamycin</td>
			<td>Sigma</td>
			<td>25389-94-0</td>
			<td></td>
		</tr>
		<tr>
			<td>Lipo3000 Plasmid Transfection Kit</td>
			<td>Thermo</td>
			<td>L3000015</td>
			<td></td>
		</tr>
		<tr>
			<td>LR Reaction Kit</td>
			<td>Thermo</td>
			<td>11791019</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmid Extraction Kit</td>
			<td>TIANGEN</td>
			<td>DP103</td>
			<td></td>
		</tr>
		<tr>
			<td>Trans5&#945; Chemically Competent Cell</td>
			<td>TRANSGEN</td>
			<td>CD201-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Trytone</td>
			<td>OXID</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Yeast Extract</td>
			<td>OXID</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Primers and Sequence</td>
			<td>Company</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: AQP5 
			Sequence: 
			F: CATGAACCCAGCCCGATCTT 
			R: CTTCTGCTCCCATCCCATCC</td>
			<td>Synbio Tech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: &#946;-actin 
			Sequence: 
			F: AGATCAAGATCATTGCTCCTCCT 
			R: AGATCAAGATCATTGCTCCTCCT</td>
			<td>Synbio Tech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: Epcam 
			Sequence: 
			F: CATTTGCTCCAAACTGGCGT 
			R: TGTCCTTGTCGGTTCTTCGG</td>
			<td>Synbio Tech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: Krt5 
			Sequence: 
			F: AGCAATGGCGTTCTGGAGG 
			R: GCTGAAGGTCAGGTAGAGCC</td>
			<td>Synbio Tech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: Krt14 
			Sequence: 
			F: CGGACCAAGTTTGAGACGGA 
			R: GCCACCTCCTCGTGGTTC</td>
			<td>Synbio Tech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: Krt19 
			Sequence: 
			F: TCTTTGAAAAACACTGAACCCTG 
			R: TGGCTCCTCAGGGCAGTAAT</td>
			<td>Synbio Tech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: Ltf 
			Sequence: 
			F: CACATGCTGTCGTATCCCGA 
			R: CGATGCCCTGATGGACGA</td>
			<td>Synbio Tech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: Nestin 
			Sequence: 
			F: GGGGCTACAGGAGTGGAAAC 
			R: GACCTCTAGGGTTCCCGTCT</td>
			<td>Synbio Tech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primer: P63 
			Sequence: 
			F: TCCTATCACGGGAAGGCAGA 
			R: GTACCATCGCCGTTCTTTGC</td>
			<td>Synbio Tech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Vector</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pLX302 lentivirus no-load vector</td>
			<td>Addgene</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pENRTY-mCherry</td>
			<td>Xiaofeng Qin laboratory, Sun Yat-sen University</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

three-dimensional, serum-free culture system for lacrimal gland stem cells

Lacrimal gland (LG) stem cell-based therapy is a promising strategy for lacrimal gland diseases. However, the lack of a reliable, serum-free culture method to obtain a sufficient number of LG stem cells (LGSCs) is one obstacle for further research and application. The three-dimensional (3D), serum-free culture method for adult mouse LGSCs is well established and shown here. The LGSCs could be continuously passaged and induced to differentiate to acinar or ductal-like cells.
For the LGSC primary culture, the LGs from 6-8-week-old mice were digested with dispase, collagenase I, and trypsin-EDTA. A total of 1 &#215; 104 single cells were seeded into 80 &#181;L of matrix gel-lacrimal gland stem cell medium (LGSCM) matrix in each well of a 24-well plate, precoated with 20 &#181;L of matrix gel-LGSCM matrix. The mix was solidified after incubation for 20 min at 37 &#176;C, and 600 &#181;L of LGSCM added.
For LGSC maintenance, LGSCs cultured for 7 days were disaggregated into single cells by dispase and trypsin-EDTA. The single cells were implanted and cultured according to the method used in the LGSC primary culture. LGSCs could be passaged over 40 times and continuously express stem/progenitor cell markers Krt14, Krt5, P63, and nestin. LGSCs cultured in LGSCM have self-renewal capacity and can differentiate into acinar or ductal-like cells in vitro and in vivo.

Establish 3D, serum-free culture system 
In this study, LGSCM containing EGF, Wnt3A, FGF10, and Y-27632 for mouse LGSCs was developed, and LGSCs were successfully isolated and cultured by a 3D culture method (Figure 1A). A successful 3D, serum-free culture system of LGSCs from C57BL/6 mice, NOD/ShiLtJ mice, BALB/c mice, and ROSA26mT/mG mice has been established using this method16. For a male mouse, 1.5-2 &#215; 106 cells we...

Watch this Scientific Journal Video about Three-Dimensional, Serum-Free Culture System for Lacrimal Gland Stem Cells at JoVE.com

Three-Dimensional, Serum-Free Culture System for Lacrimal Gland Stem Cells

The three-dimensional, serum-free culture method for adult lacrimal gland (LG) stem cells is well established for the induction of LG organoid formation and differentiation into acinar or ductal-like cells.

Lacrimal gland (LG) stem cell-based therapy is a promising strategy for lacrimal gland diseases. However, the lack of a reliable, serum-free culture ...

three-dimensional-serum-free-culture-system-for-lacrimal-gland-stem

Research

JoVE Journal

Biology

2.3K Views.  Sun Yat-sen University. The three-dimensional, serum-free culture method for adult lacrimal gland (LG) stem cells is well established for the induction of LG organoid formation and differentiation into acinar or ductal-like cells.

Video: Three-Dimensional, Serum-Free Culture System for Lacrimal Gland Stem Cells

Chip-based Three-dimensional Cell Culture in Perfused Micro-bioreactors

We have developed a chip-based cell culture system for the three-dimensional cultivation of cells. The chip is typically manufactured from non-biodegradable polymers, e.g., polycarbonate or polymethyl methacrylate by micro injection molding, micro hot embossing or micro thermoforming. But, it can also be manufactured from bio-degradable polymers. Its overall dimensions are 0.7 1 x 20 x 20 x 0.7 1 mm (h x w x l). The main features of the chips used are either a grid of up to 1156 cubic micro-containers (cf-chip) each the size of 120-300 x 300 x 300 &mu; (h x w x l) or round recesses with diameters of 300 &mu; and a depth of 300 &mu; (r-chip). The scaffold can house 10 Mio. cells in a three-dimensional configuration. For an optimal nutrient and gas supply, the chip is inserted in a bioreactor housing. The bioreactor is part of a closed steril circulation loop that, in the simplest configuration, is additionaly comprised of a roller pump and a medium reservoir with a gas supply. The bioreactor can be run in perfusion, superfusion, or even a mixed operation mode. We have successfully cultivated cell lines as well as primary cells over periods of several weeks. For rat primary liver cells we could show a preservation of organotypic functions for more than 2 weeks. For hepatocellular carcinoma cell lines we could show the induction of liver specific genes not or only slightly expressed in standard monolayer culture. The system might also be useful as a stem cell cultivation system since first differentiation experiments with stem cell lines were promising.

We describe a chip-based platform for the three-dimensional cultivation of cells in micro-bioreactors. One chip can house up to 10 Mio. cells that can be cultivated under precisely defined conditions with regard to fluid flow, oxygen tension etc. in a sterile, closed circulation loop.

We have developed a chip-based cell culture system for the three-dimensional cultivation of cells. The chip is typically manufactured from ...

Microfabrication of Chip-sized Scaffolds for Three-dimensional Cell cultivation

Using microfabrication technologies is a prerequisite to create scaffolds of reproducible geometry and constant quality for three-dimensional cell cultivation. These technologies offer a wide spectrum of advantages not only for manufacturing but also for different applications. The size and shape of formed cell clusters can be influenced by the exact and reproducible architecture of the microfabricated scaffold and, therefore, the diffusion path length of nutrients and gases can be controlled.1 This is unquestionably a useful tool to prevent apoptosis and necrosis of cells due to an insufficient nutrient and gas supply or removal of cellular metabolites.
Our polymer chip, called CellChip, has the outer dimensions of 2 x 2 cm with a central microstructured area. This area is subdivided into an array of up to 1156 microcontainers with a typical dimension of 300 m edge length for the cubic design (cp- or cf-chip) or of 300 m diameter and depth for the round design (r-chip).2
So far, hot embossing or micro injection moulding (in combination with subsequent laborious machining of the parts) was used for the fabrication of the microstructured chips. Basically, micro injection moulding is one of the only polymer based replication techniques that, up to now, is capable for mass production of polymer microstructures.3 However, both techniques have certain unwanted limitations due to the processing of a viscous polymer melt with the generation of very thin walls or integrated through holes. In case of the CellChip, thin bottom layers are necessary to perforate the polymer and provide small pores of defined size to supply cells with culture medium e.g. by microfluidic perfusion of the containers.
In order to overcome these limitations and to reduce the manufacturing costs we have developed a new microtechnical approach on the basis of a down-scaled thermoforming process. For the manufacturing of highly porous and thin walled polymer chips, we use a combination of heavy ion irradiation, microthermoforming and track etching. In this so called "SMART" process (Substrate Modification And Replication by Thermoforming) thin polymer films are irradiated with energetic heavy projectiles of several hundred MeV introducing so-called "latent tracks" Subsequently, the film in a rubber elastic state is formed into three dimensional parts without modifying or annealing the tracks. After the forming process, selective chemical etching finally converts the tracks into cylindrical pores of adjustable diameter.

We present two processes for the microfabrication of porous polymer chips for three-dimensional cell cultivation. The first one is hot embossing combined with a solvent vapour welding process. The second one uses a recently developed microthermoforming process combined with ion track technology leading to a significant simplification of manufacture.

Using microfabrication technologies is a prerequisite to create scaffolds of reproducible geometry and constant quality for three-dimensional cell ...

Preparation of Pooled Human Platelet Lysate (pHPL) as an Efficient Supplement for Animal Serum-Free Human Stem Cell Cultures

Platelet derived growth factors have been shown to stimulate cell proliferation efficiently in vivo1,2 and in vitro. This effect has been reported for mesenchymal stromal cells (MSCs), fibroblasts and endothelial colony-forming cells with platelets activated by thrombin3-5 or lysed by freeze/thaw cycles6-14 before the platelet releasate is added to the cell culture medium. The trophic effect of platelet derived growth factors has already been tested in several trials for tissue engineering and regenerative therapy.1,15-17 Varying efficiency is considered to be at least in part due to individually divergent concentrations of growth factors18,19 and a current lack of standardized protocols for platelet preparation.15,16 This protocol presents a practicable procedure to generate a pool of human platelet lysate (pHPL) derived from routinely produced platelet rich plasma (PRP) of forty to fifty single blood donations. By several freeze/thaw cycles the platelet membranes are damaged and growth factors are efficiently released into the plasma. Finally, the platelet fragments are removed by centrifugation to avoid extensive aggregate formation and deplete potential antigens. The implementation of pHPL into standard culture protocols represents a promising tool for further development of cell therapeutics propagated in an animal protein-free system.

Preparation of Pooled Human Platelet Lysate pHPL as an Efficient Supplement for Animal Serum-Free Human Stem Cell Cultures

Human platelet lysate is a rich source of growth factors and a potent supplement in cell culture. This protocol presents the process of preparing a large pool of human platelet lysate by starting from platelet rich plasma, performing several freeze-thaw cycles and depleting the platelet fragments.

Platelet derived growth factors have been shown to stimulate cell proliferation efficiently in vivo1,2 and in vitro. This effect has been reported for ...

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells (MSCs) and Endothelial Colony Forming Progenitor Cells (ECFCs)

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal stem cells, MSCs) and endothelial colony forming progenitor cells (ECFCs). Both cell types are key players in maintaining the integrity of tissue and are probably also involved in regenerative processes and tumor formation.
To study their biology and function in a comparative manner it is important to have both cells types available from the same donor. It may also be beneficial for regenerative purposes to derive MSCs and ECFCs from the same tissue.
Because cellular therapeutics should eventually find their way from bench to bedside we established a new method to isolate and further expand progenitor cells without the use of animal protein. Pooled human platelet lysate (pHPL) replaced fetal bovine serum in all steps of our protocol to completely avoid contact of the cells to xenogeneic proteins.
This video demonstrates a methodology for the isolation and expansion of progenitor cells from one umbilical cord.
All materials and procedures will be described.

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells MSCs and Endothelial Colony Forming Progenitor Cells ECFCs

This protocol describes the isolation and subsequent expansion of mesenchymal stromal cells and endothelial colony forming cells without the use of animal serum to generate autologous pairs for experimental transplantation purposes.

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal ...

Isolation of Mammary Epithelial Cells from Three-dimensional Mixed-cell Spheroid Co-culture

While enormous efforts have gone into identifying signaling pathways and molecules involved in normal and malignant cell behaviors1-2, much of this work has been done using classical two-dimensional cell culture models, which allow for easy cell manipulation. It has become clear that intracellular signaling pathways are affected by extracellular forces, including dimensionality and cell surface tension3-4. Multiple approaches have been taken to develop three-dimensional models that more accurately represent biologic tissue architecture3. While these models incorporate multi-dimensionality and architectural stresses, study of the consequent effects on cells is less facile than in two-dimensional tissue culture due to the limitations of the models and the difficulty in extracting cells for subsequent analysis.
The important role of the microenvironment around tumors in tumorigenesis and tumor behavior is becoming increasingly recognized4. Tumor stroma is composed of multiple cell types and extracellular molecules. During tumor development there are bidirectional signals between tumor cells and stromal cells5. Although some factors participating in tumor-stroma co-evolution have been identified, there is still a need to develop simple techniques to systematically identify and study the full array of these signals6. Fibroblasts are the most abundant cell type in normal or tumor-associated stromal tissues, and contribute to deposition and maintenance of basement membrane and paracrine growth factors7.
Many groups have used three dimensional culture systems to study the role of fibroblasts on various cellular functions, including tumor response to therapies, recruitment of immune cells, signaling molecules, proliferation, apoptosis, angiogenesis, and invasion8-15. We have optimized a simple method for assessing the effects of mammary fibroblasts on mammary epithelial cells using a commercially available extracellular matrix model to create three-dimensional cultures of mixed cell populations (co-cultures)16-22. With continued co-culture the cells form spheroids with the fibroblasts clustering in the interior and the epithelial cells largely on the exterior of the spheroids and forming multi-cellular projections into the matrix. Manipulation of the fibroblasts that leads to altered epithelial cell invasiveness can be readily quantified by changes in numbers and length of epithelial projections23. Furthermore, we have devised a method for isolating epithelial cells out of three-dimensional co-culture that facilitates analysis of the effects of fibroblast exposure on epithelial behavior. We have found that the effects of co-culture persist for weeks after epithelial cell isolation, permitting ample time to perform multiple assays. This method is adaptable to cells of varying malignant potential and requires no specialized equipment. This technique allows for rapid evaluation of in vitro cell models under multiple conditions, and the corresponding results can be compared to in vivo animal tissue models as well as human tissue samples.

A simple method is described for analyzing effects of tissue fibroblasts on associated epithelial cells. The combination of this method and three-dimensional tissue culture can facilitate analysis of cells after isolation from 3D. The technique is applicable to cells of varying malignant potential, allowing systematic study of effects of tumor-associated stroma on tumor cells.

While enormous efforts have gone into identifying signaling pathways and molecules involved in normal and malignant cell behaviors1-2, much of this work ...

Mouse Embryonic Development in a Serum-free Whole Embryo Culture System

Mid-gestation stage mouse embryos were cultured utilizing a serum-free culture medium prepared from commercially available stem cell media supplements in an oxygenated rolling bottle culture system. Mouse embryos at E10.5 were carefully isolated from the uterus with intact yolk sac and in a process involving precise surgical maneuver the embryos were gently exteriorized from the yolk sac while maintaining the vascular continuity of the embryo with the yolk sac. Compared to embryos prepared with intact yolk sac or with the yolk sac removed, these embryos exhibited superior survival rate and developmental progression when cultured under similar conditions. We show that these mouse embryos, when cultured in a defined medium in an atmosphere of 95% O2 / 5% CO2 in a rolling bottle culture apparatus at 37 &#176;&#8203;C for 16-40 hr, exhibit morphological growth and development comparable to the embryos developing in utero. We believe this method will be useful for investigators needing to utilize whole embryo culture to study signaling interactions important in embryonic organogenesis.

Serum utilized in embryo cultures contains unknown components that can affect the outcome of experiments especially in studies involving signaling interactions. Here we utilized a serum-free oxygenated culture system and show that mid-gestation mouse embryos cultured for 16-40 hr&#160;exhibit morphological development comparable to embryos developing in utero.

Mid-gestation stage mouse embryos were cultured utilizing a serum-free culture medium prepared from commercially available stem cell media supplements in ...

Mouse Fetal Whole Intestine Culture System for Ex Vivo Manipulation of Signaling Pathways and Three-dimensional Live Imaging of Villus Development

Most morphogenetic processes in the fetal intestine have been inferred from thin sections of fixed tissues, providing snapshots of changes over developmental stages. Three-dimensional information from thin serial sections can be challenging to interpret because of the difficulty of reconstructing serial sections perfectly and maintaining proper orientation of the tissue over serial sections. Recent findings by Grosse et al., 2011 highlight the importance of three- dimensional information in understanding morphogenesis of the developing villi of the intestine1. Three-dimensional reconstruction of singly labeled intestinal cells demonstrated that the majority of the intestinal epithelial cells contact both the apical and basal surfaces. Furthermore, three-dimensional reconstruction of the actin cytoskeleton at the apical surface of the epithelium demonstrated that the intestinal lumen is continuous and that secondary lumens are an artifact of sectioning. Those two points, along with the demonstration of interkinetic nuclear migration in the intestinal epithelium, defined the developing intestinal epithelium as a pseudostratified epithelium and not stratified as previously thought1. The ability to observe the epithelium three-dimensionally was seminal to demonstrating this point and redefining epithelial morphogenesis in the fetal intestine. With the evolution of multi-photon imaging technology and three-dimensional reconstruction software, the ability to visualize intact, developing organs is rapidly improving. Two-photon excitation allows less damaging penetration deeper into tissues with high resolution. Two-photon imaging and 3D reconstruction of the whole fetal mouse intestines in Walton et al., 2012 helped to define the pattern of villus outgrowth2. Here we describe a whole organ culture system that allows ex vivo development of villi and extensions of that culture system to allow the intestines to be three-dimensionally imaged during their development.

Mouse Fetal Whole Intestine Culture System for Ex Vivo Manipulation of Signaling Pathways and Three-dimensional Live Imaging of Villus Development

Improved imaging technology is allowing three-dimensional imaging of organs during development. Here we describe a whole organ culture system that allows live imaging of the developing villi in the fetal mouse intestine.

Most morphogenetic processes in the fetal intestine have been inferred from thin sections of fixed tissues, providing snapshots of changes over ...

Non-enzymatic, Serum-free Tissue Culture of Pre-invasive Breast Lesions for Spontaneous Generation of Mammospheres

Breast ductal carcinoma in situ (DCIS), by definition, is proliferation of neoplastic epithelial cells within the confines of the breast duct, without breaching the collagenous basement membrane. While DCIS is a non-obligate precursor to invasive breast cancers, the molecular mechanisms and cell populations that permit progression to invasive cancer are not fully known. To determine if progenitor cells capable of invasion existed within the DCIS cell population, we developed a methodology for collecting and culturing sterile human breast tissue at the time of surgery, without enzymatic disruption of tissue.
Sterile breast tissue containing ductal segments is harvested from surgically excised breast tissue following routine pathological examination. Tissue containing DCIS is placed in nutrient rich, antibiotic-containing, serum free medium, and transported to the tissue culture laboratory. The breast tissue is further dissected to isolate the calcified areas. Multiple breast tissue pieces (organoids) are placed in a minimal volume of serum free medium in a flask with a removable lid and cultured in a humidified CO2 incubator. Epithelial and fibroblast cell populations emerge from the organoid after 10 - 14 days. Mammospheres spontaneously form on and around the epithelial cell monolayer. Specific cell populations can be harvested directly from the flask without disrupting neighboring cells. Our non-enzymatic tissue culture system reliably reveals cytogenetically abnormal, invasive progenitor cells from fresh human DCIS lesions.

Primary cell culture using intact tissue organoids provides a model system that mimics the multi-cellular in vivo microenvironment. We developed a serum-free primary breast epithelium tissue culture model that perpetuates mixed cell culture lineages and exhibits differentiated morphology, without enzymatic tissue disruption. Breast organoids remain viable for &#62;6 months.

Breast ductal carcinoma in situ (DCIS), by definition, is proliferation of neoplastic epithelial cells within the confines of the breast duct, without ...

Manipulating the Murine Lacrimal Gland

The lacrimal gland (LG) secretes aqueous tears necessary for maintaining the structure and function of the cornea, a transparent tissue essential for vision. In the human a single LG resides in the orbit above the lateral end of each eye delivering tears to the ocular surface through 3 - 5 ducts. The mouse has three pairs of major ocular glands, the most studied of which is the exorbital lacrimal gland (LG) located anterior and ventral to the ear. Similar to other glandular organs, the LG develops through the process of epithelial branching morphogenesis in which a single epithelial bud within a condensed mesenchyme undergoes multiple rounds of bud and duct formation to form an intricate interconnected network of secretory acini and ducts. This elaborate process has been well documented in many other epithelial organs such as the pancreas and salivary gland. However, the LG has been much less explored and the mechanisms controlling morphogenesis are poorly understood. We suspect that this under-representation as a model system is a consequence of the difficulties associated with finding, dissecting and culturing the LG. Thus, here we describe dissection techniques for harvesting embryonic and post-natal LG and methods for ex vivo culture of the tissue.

The lacrimal gland (LG) is a branching organ that produces the aqueous components of tears necessary for maintaining vision and ocular health. Here we describe murine LG dissection and ex vivo culture techniques to decipher signaling pathways involved in LG development.

The lacrimal gland (LG) secretes aqueous tears necessary for maintaining the structure and function of the cornea, a transparent tissue essential for ...

FRET Imaging in Three-dimensional Hydrogels

Imaging of F&#246;rster resonance energy transfer (FRET)&#160;is a powerful tool for examining cell biology in real-time. Studies utilizing FRET commonly employ two-dimensional (2D) culture, which does not mimic the three-dimensional (3D) cellular microenvironment. A method to perform quenched emission FRET imaging using conventional widefield epifluorescence microscopy of cells within a 3D hydrogel environment is presented. Here an analysis method for ratiometric FRET probes that yields linear ratios over the probe activation range is described. Measurement of intracellular cyclic adenosine monophosphate (cAMP) levels is demonstrated in chondrocytes under forskolin stimulation using a probe for EPAC1 activation (ICUE1) and the ability to detect differences in cAMP signaling dependent on hydrogel material type, herein a photocrosslinking hydrogel (PC-gel, polyethylene glycol dimethacrylate) and a thermoresponsive hydrogel (TR-gel). Compared with 2D FRET methods, this method requires little additional work. Laboratories already utilizing FRET imaging in 2D can easily adopt this method to perform cellular studies in a 3D microenvironment. It can further be applied to high throughput drug screening in engineered 3D microtissues. Additionally, it is compatible with other forms of FRET imaging, such as anisotropy measurement and fluorescence lifetime imaging (FLIM), and with advanced microscopy platforms using confocal, pulsed, or modulated illumination.

F&#246;rster resonance energy transfer (FRET) imaging is a powerful tool for real-time cell biology studies. Here a method for FRET imaging cells in physiologic three-dimensional (3D) hydrogel microenvironments using conventional epifluorescence microscopy is presented. An analysis for ratiometric FRET probes that yields linear ratios over the activation range is described.

Imaging of F&#246;rster resonance energy transfer (FRET)&#160;is a powerful tool for examining cell biology in real-time. Studies utilizing FRET commonly ...