Agradecimentos especiais a Kris Reddi na UCLA para a criação de reagentes e derramando géis e Erin Sanders na Universidade da Califórnia em busca de inspiração, orientação e apoio e revisão do manuscrito. Gostaria também de agradecer a Giancarlo Costaguta e S. Gregório Payne para o fornecimento do DNA genômico de levedura e primers para amplificar o gene GAL3. Gostaria também de agradecer Shah Bhairav ​​para fotografar o equipamento de laboratório e reagentes utilizados para fazer figuras de 2 a 4. O financiamento para este projeto foi fornecido pelo HHMI (HHMI Grant No. 52006944).

<ol>
	<li>Albert, J., Fenyo, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+sensitive,+and+specific+detection+of+human+immunodeficiency+virus+type+1+in+clinical+specimens+by+polymerase+chain+reaction+with+nested+primers.">Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers.</a> J. Clin. Microbiol. 28, 1560-1564 (1990).</li><li>Baskaran, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uniform+amplification+of+a+mixture+of+deoxyribonucleic+acids+with+varying+GC+content.">Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content.</a> Genome Res. 6, 633-638 (1996).</li><li>Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+buffer+optimization+with+uniform+temperature+regimen+to+facilitate+automation.">PCR buffer optimization with uniform temperature regimen to facilitate automation.</a> PCR Methods Appl. 2, 234-240 (1993).</li><li>Borer, P. N., Dengler, B., Tinoco, I., Uhlenbeck, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stability+of+ribonucleic+acid+double-stranded+helices.">Stability of ribonucleic acid double-stranded helices.</a> J. Mol. Biol. 86, 843-853 (1974).</li><li>Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+DNA+duplex+stability+from+the+base+sequence.">Predicting DNA duplex stability from the base sequence.</a> Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).</li><li>Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prevention+of+pre-PCR+mis-priming+and+primer+dimerization+improves+low-copy-number+amplifications.">Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications.</a> Nucleic Acids Res. 20, 1717-1723 (1992).</li><li>Coleman, W. B., Tsongalis, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Diagnostics for the clinical laboration. , (2005).</li><li>D'Aquila, R. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maximizing+sensitivity+and+specificity+of+PCR+by+pre-amplification+heating.">Maximizing sensitivity and specificity of PCR by pre-amplification heating.</a> Nucleic Acids Res. 19, 3749 (1991).</li><li>Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+concepts+for+PCR+primer+design.">General concepts for PCR primer design.</a> PCR Methods Appl. 3, S30-S37 (1993).</li><li>Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term='Touchdown'+PCR+to+circumvent+spurious+priming+during+gene+amplification.">'Touchdown' PCR to circumvent spurious priming during gene amplification.</a> Nucleic Acids Res. 19, 4008 (1991).</li><li>Erlich, H. A., Gelfand, D., Sninsky, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+the+polymerase+chain+reaction.">Recent advances in the polymerase chain reaction.</a> Science. 252, 1643-1651 (1991).</li><li>Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-amplification+of+GC-rich+regions:+'slowdown+PCR.">PCR-amplification of GC-rich regions: 'slowdown PCR.</a> Nat. Protoc. 3, 1312-1317 (2008).</li><li>Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+amplification+with+PCR+of+a+refractory+segment+of+genomic+DNA.">Specific amplification with PCR of a refractory segment of genomic DNA.</a> Nucleic Acids Res. 16, 11844 (1988).</li><li>Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+improves+the+PCR+amplification+of+GC-rich+DNA+sequences.">Betaine improves the PCR amplification of GC-rich DNA sequences.</a> Nucleic Acids Res. 25, 3957-3958 (1997).</li><li>Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> PCR Protocols: A guide to methods and applications. , (1990).</li><li>King, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Molecular Biology. 630, (2010).</li><li>Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+polynucleotides.+XCVI.+Repair+replications+of+short+synthetic+DNA's+as+catalyzed+by+DNA+polymerases.">Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases.</a> J. Mol. Biol. 56, 341-361 (1971).</li><li>Korbie, D. J., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Touchdown+PCR+for+increased+specificity+and+sensitivity+in+PCR+amplification.">Touchdown PCR for increased specificity and sensitivity in PCR amplification.</a> Nat. Protoc. 3, 1452-1456 (2008).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+DNA+by+PCR:+standard+procedures+and+optimization.">Enzymatic amplification of DNA by PCR: standard procedures and optimization.</a> Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).</li><li>Kramer, M. F., Coen, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction.">The polymerase chain reaction.</a> Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).</li><li>Kreader, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relief+of+amplification+inhibition+in+PCR+with+bovine+serum+albumin+or+T4+gene+32+protein.">Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein.</a> Appl. Environ. Microbiol. 62, 1102-1106 (1996).</li><li>Kwok, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+human+immunodeficiency+virus+sequences+by+using+in+vitro+enzymatic+amplification+and+oligomer+cleavage+detection.">Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection.</a> J. Virol. 61, 1690-1694 (1987).</li><li>McConlogue, L., Brow, M. A., Innis, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure-independent+DNA+amplification+by+PCR+using+7-deaza-2'-deoxyguanosine.">Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine.</a> Nucleic Acids Res. 16, 9869 (1988).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+unusual+origin+of+the+polymerase+chain+reaction.">The unusual origin of the polymerase chain reaction.</a> Sci. Am. 262, 56-65 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Target+amplification+for+DNA+analysis+by+the+polymerase+chain+reaction.">Target amplification for DNA analysis by the polymerase chain reaction.</a> Ann. Biol. Clin. (Paris). 48, 579-582 (1990).</li><li>Mullis, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+polymerase+chain+reaction+in+an+anemic+mode:+how+to+avoid+cold+oligodeoxyribonuclear+fusion).">The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion).</a> PCR Methods Appl. 1, 1-4 (1991).</li><li>Mullis, K. B., Faloona, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+synthesis+of+DNA+in+vitro+via+a+polymerase-catalyzed+chain+reaction.">Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction.</a> Methods Enzymol. 155, 335-350 (1987).</li><li>Paabo, S., Gifford, J. A., Wilson, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+sequences+from+a+7000-year+old+brain.">Mitochondrial DNA sequences from a 7000-year old brain.</a> Nucleic Acids Res. 16, 9775-9787 (1988).</li><li>Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Betaine+can+eliminate+the+base+pair+composition+dependence+of+DNA+melting.">Betaine can eliminate the base pair composition dependence of DNA melting.</a> Biochemistry. 32, 137-144 (1993).</li><li>Roux, K. H., Hecker, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+optimization+using+touchdown+and+stepdown+PCR.">One-step optimization using touchdown and stepdown PCR.</a> Methods Mol. Biol. 67, 39-45 (1997).</li><li>Rychlik, W., Spencer, W. J., Rhoads, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+the+annealing+temperature+for+DNA+amplification+in+vitro.">Optimization of the annealing temperature for DNA amplification in vitro.</a> Nucleic Acids Res. 18, 6409-6412 (1990).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer-directed+enzymatic+amplification+of+DNA+with+a+thermostable+DNA+polymerase.">Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.</a> Science. 239, 487-491 (1988).</li><li>Saiki, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+amplification+of+beta-globin+genomic+sequences+and+restriction+site+analysis+for+diagnosis+of+sickle+cell+anemia.">Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia.</a> Science. 230, 1350-1354 (1985).</li><li>Sambrook, J. A. R., David, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Cloning A Laboratory Manual. 2, (2001).</li><li>Sarkar, G., Kapelner, S., Sommer, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formamide+can+dramatically+improve+the+specificity+of+PCR.">Formamide can dramatically improve the specificity of PCR.</a> Nucleic Acids Res. 18, 7465 (1990).</li><li>Smit, V. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KRAS+codon+12+mutations+occur+very+frequently+in+pancreatic+adenocarcinomas.">KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas.</a> Nucleic Acids Res. 16, 7773-7782 (1988).</li><li>Wilson, I. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+and+facilitation+of+nucleic+acid+amplification.">Inhibition and facilitation of nucleic acid amplification.</a> Appl. Environ. Microbiol. 63, 3741-3751 (1997).</li><li>Wu, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Enzymology. 218, (1993).</li></ol>

Não tenho nada para revelar.

PCR tornou-se uma ferramenta indispensável no arsenal da ciência biológica. PCR alterou o curso da ciência permitindo biólogos para se obter o poder sobre genomas, e fazer genes híbridos com novas funções, permitindo específico e preciso testes clínicos, ganhando percepções do genoma e diversidade, bem como genes simplesmente de clonagem para a análise bioquímica adicional. Aplicação PCR é limitado apenas pela imaginação do cientista que exerce o seu poder. Há muitos livros e artigos que descrevem novos usos especializados de PCR, e muitos mais serão desenvolvidas durante a próxima geração da ciência biológica. No entanto, independentemente das abordagens previstas, o quadro fundamental continua o mesmo. PCR, em toda a sua grandeza, é uma aplicação in vitro para gerar grandes quantidades de um segmento específico de ADN. Projetando um experimento PCR requer pensamento e paciência. Os resultados mostrados na Figura 3 exemplificam um do ch grandeallenges ao projetar uma estratégia de otimização para a PCR. Isto é, como um parâmetro de PCR é alterado, ele pode ter impacto outro. Como um exemplo, se a PCR inicial foi realizada à temperatura de sub-óptima de recozimento (58 ° C) com um óptimo 2 + Mg concentração de 2,0 mM, então o resultado seria produzir um esfregaço como visto na Figura 3c. Uma tentativa para resolver o esfregaço pode envolver a criação de condições de PCR com reacções contendo 2,0 mM de MgCl2 e ajustando a temperatura de recozimento de 61 ° C. No entanto, como pode ser visto na Figura 3a, isto não produz qualquer produto. Por conseguinte, é aconselhável para titular os reagentes, em vez de adicionar uma concentração para uma reacção única, quando a resolução de resultados falsos. Além disso, os ajustes mais comuns que são necessários para a optimização de um experimento PCR são para alterar a concentração de Mg 2 + e para corrigir as temperaturas de recozimento. No entanto, se essas mudanças não minimizar ou anular os resultados aberrantes, a titulação de additives e / ou alterando os protocolos de ciclismo condição, como descrito nas Tabelas 2-6 pode aliviar o problema. Se tudo mais falhar, redesenhar os primers e tente, tente novamente.

<table border="1"><tbody><tr><td> Nome do reagente </td><td> Companhia </td><td> Número de catálogo </td><td> Comentários </td></tr><tr><td> Taq Polymeras </td><td> Sigma </td><td> D4545-25UN </td><td></td></tr><tr><td> dNTPs </td><td> Qiagen </td><td> 201225 </td><td></td></tr><tr><td> 0,2 ml de Parede Fina Tubos PCR tubos </td><td> Bio Rad </td><td> 223-9469 </td><td></td></tr><tr><td> 0,2 ml tampas de tubos de Parede Fina </td><td> Bio Rad </td><td> 223-9472 </td><td></td></tr><tr><td> TE Buffer: </td><td></td><td></td><td></td></tr><tr><td> EDTA sal dissódico dihidratado </td><td> Sigma </td><td> E5134 </td><td></td></tr><tr><td> Trizma-HCl </td><td> Sigma </td><td> T-3253 </td><td></td></tr><tr><td> Primer Phage personalizado </td><td> Invitrogen </td><td colspan="2"> 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG </td></tr><tr><td> Primer Phage personalizado </td><td> Invitrogen </td><td colspan="2"> 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT </td></tr><tr><td> Primer fermento personalizado </td><td> Integrated DNA Technologies </td><td colspan="2"> SacI-Gal3 (-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG </td></tr><tr><td> Primer fermento personalizado </td><td> Integrated DNA Technologies </td><td colspan="2"> Gal3 (1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG </td></tr><tr><td> Termociclador </td><td> Bio Rad </td><td> 170-9703 </td><td> My Cycler </td></tr><tr><td> Agarose </td><td> ISC BioExpress </td><td> E-3120-500 </td><td></td></tr><tr><td> A electroforese em gel </td><td> Hoeffer Scientific Instruments </td><td> Modelo HE33 </td><td></td></tr><tr><td> 1 Ladder DNA kb </td><td> New England Biolabs </td><td> N3232S </td><td></td></tr><tr><td> Bio Rad Power Pack </td><td> Bio Rad </td><td> 164-5050 </td><td> PowerPac básico </td></tr><tr><td> Gel Doc sistema </td><td> Fotodyne Incorporated </td><td colspan="2"> FOTO / Analista Investigador Workstation FX </td></tr></tbody></table>

polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies

Nas ciências biológicas tem havido avanços tecnológicos que elevaram a disciplina em épocas de ouro da descoberta. Por exemplo, o campo da microbiologia foi transformada com o advento de microscópio Anton van Leeuwenhoek, que permitiu que os cientistas visualizar procariotas, pela primeira vez. O desenvolvimento da reação em cadeia da polimerase (PCR) é uma dessas inovações que mudaram o curso da ciência molecular com o seu impacto abrangendo subdisciplinas incontáveis ​​na biologia. O processo teórico foi descrito por Keppe e colaboradores em 1971, no entanto, era mais de 14 anos até que o procedimento de PCR completa foi descrito e aplicado experimentalmente por Kary Mullis, enquanto ao Cetus Corporation, em 1985. Automatização e refinamento desta técnica progrediu com a introdução de uma polimerase de ADN termicamente estável a partir do Thermus aquaticus bactéria, consequentemente, o nome da polimerase de DNA Taq. A PCR é um powetécnica de amplificação rful que pode gerar um grande suprimento de um segmento específico de ADN (ie, um fragmento amplificado) a partir de apenas uma pequena quantidade de material de partida (isto é, o modelo de DNA ou sequência alvo). Embora simples e geralmente sem problemas, existem armadilhas que dificultam a reação produzindo resultados falsos. Quando PCR falhar pode levar a muitos produtos não específicos de ADN de tamanhos variados que aparecem como uma escada ou mancha de bandas no gel de agarose. Às vezes produtos não formam em tudo. Outro problema potencial ocorre quando as mutações são intencionalmente introduzido nos amplicons, resultando em uma população heterogénea de produtos de PCR. Falhas de PCR pode se tornar frustrante a menos paciência e resolução de problemas cuidado são utilizados para classificar e resolver o problema (s). Este protocolo descreve os princípios básicos de PCR, fornece uma metodologia que irá resultar em amplificação de sequências de a maioria dos alvos, e apresenta estratégias para optimizar uma reacção. Ao seguir este guia de PCR, students deve ser capaz de: <ul><li> Configure reações e condições ciclos térmicos para um experimento de PCR convencional </li><li> Compreender a função dos componentes de reação diversas e seu efeito global sobre um experimento de PCR </li><li> Projetar e otimizar um experimento de PCR para qualquer modelo de DNA </li><li> Solucionar problemas de experiências fracassadas de PCR </li></ul>

Watch this Scientific Journal Video about Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies at JoVE.com

Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

PCR emergiu como uma técnica comum em muitos laboratórios de biologia molecular. Desde aqui está um guia rápido para vários protocolos convencionais de PCR. Porque cada reacção é uma experiência única, as condições óptimas necessárias para gerar um produto variar. Compreender as variáveis ​​em uma reação vai aumentar muito a eficiência de resolução de problemas, aumentando assim a chance de obter o resultado desejado.

Reação em Cadeia da Polimerase: Protocolo Basic Plus Estratégias de solução de problemas e otimização

In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of ...

polymerase-chain-reaction-basic-protocol-plus-troubleshooting

Research

JoVE Journal

Biology

401.8K visualizações.  University of California, Los Angeles. PCR emergiu como uma técnica comum em muitos laboratórios de biologia molecular. Desde aqui está um guia rápido para vários protocolos convencionais de PCR. Porque cada reacção é uma experiência única, as condições óptimas necessárias para gerar um produto variar. Compreender as variáveis ​​em uma reação vai aumentar muito a eficiência de resolução de problemas, aumentando assim a chance de obter o resultado desejado.

Vídeo: Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies

Optimization of the Ugi Reaction Using Parallel Synthesis and Automated Liquid Handling

The optimization of a Ugi reaction involving the mixing of furfurylamine, benzaldehyde, boc-glycine and t-butylisocyanide is described. Triplicate runs of 48 parallel experiments are reported, varying concentration, solvent and the excess of some of the reagents. The isolation of the product was achieved by a simple filtration and wash procedure. The highest yield obtained was 66% from 0.4 M methanol with 1.2 eq. of imine. This is significantly above the 49% yield obtained from the initial reaction under equimolar concentration at 0.4 M in methanol. Methanol solutions with reagent concentrations of 0.4M or 0.2M gave superior yields while all solvent systems at 0.07M performed poorly. At 0.2M, methanol and ethanol/methanol (60/40) mixtures were statistically equally good while THF/methanol (60/40) was poor and acetonitrile/methanol (60/40) was intermediate. Good reproducibility of the precipitate yields was obtained in these replicate experiments, allowing for subtle interaction effects to be positively identified.

The Ugi reaction has proved to be a convenient way to quickly create diverse libraries of compounds. It involves the reaction of an amine, an aldehyde, a carboxylic acid and an isonitrile typically in methanol at room temperature. In this video, we utilize a 48-slot Mettler-Toledo MiniBlock equipped with filtration tubes and a Mettler-Toledo MiniMapper automated liquid handler was used to deliver the reagents and solvent. The parameters of interest were the concentration, the solvent composition and the excess of some of the reagents.

Otimização da Reação UGI Usando Síntese Paralela e manipulação de líquidos Automated

The optimization of a Ugi reaction involving the mixing of furfurylamine, benzaldehyde, boc-glycine and t-butylisocyanide is described.  Triplicate runs ...

Biologia

Elevated Plus Maze for Mice

Although the mouse genome is now completely sequenced, the functions of most of the genes expressed in the brain are not known. The influence of a given gene on a specific behavior can be determined by behavioral analysis of mutant mice. If a target gene is expressed in the brain, behavioral phenotype of the mutant mice could elucidate the genetic mechanism of normal behaviors. The elevated plus maze test is one of the most widely used tests for measuring anxiety-like behavior. The test is based on the natural aversion of mice for open and elevated areas, as well as on their natural spontaneous exploratory behavior in novel environments. The apparatus consists of open arms and closed arms, crossed in the middle perpendicularly to each other, and a center area. Mice are given access to all of the arms and are allowed to move freely between them. The number of entries into the open arms and the time spent in the open arms are used as indices of open space-induced anxiety in mice. Unfortunately, the procedural differences that exist between laboratories make it difficult to duplicate and compare results among laboratories. Here, we present a detailed movie demonstrating our protocol for the elevated plus maze test. In our laboratory, we have assessed more than 90 strains of mutant mice using the protocol shown in the movie. These data will be disclosed as a part of a public database that we are now constructing.
Visualization of the protocol will promote better understanding of the details of the entire experimental procedure, allowing for standardization of the protocols used in different laboratories and comparisons of the behavioral phenotypes of various strains of mutant mice assessed using this test. 


The elevated plus maze test is one of the most widely used tests for measuring anxiety-like behavior in mice. Here, we present a movie showing the detailed procedures for conducting the test.

Labirinto elevado para Ratos

Although the mouse genome is now completely sequenced, the functions of most of the genes expressed in the brain are not known. The influence of a given ...

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

Small animal Magnetic Resonance (MR) research has emerged as an important element of modern biomedical research due to its non-invasive nature and the richness of biological information it provides. MR does not require any ionizing radiation and can noninvasively provide higher resolution and better signal-to-noise ratio in comparison to other tomographic or spectroscopic modalities. In this protocol, we will focus on small animal MR imaging and MR spectroscopy (MRI/MRS) to noninvasively acquire relaxation weighted 1H images of mouse and to obtain 31P spectra of mouse muscle. This work does not attempt to cover every aspect of small animal MRI/MRS but rather introduces basic procedures of mouse MRI/MRS experiments. The main goal of this work is to inform researchers of the basic procedures for in vivo MR experiments on small animals. The goal is to provide a better understanding of basic experimental procedures to allow researchers new to the MR field to better plan for non-MR components of their studies so that both MR and non-MR procedures are seamlessly integrated.

Noninvasive In Vivo Small Animal MRI and MRS: Basic Experimental Procedures

This work describes basic procedures of noninvasive small animal MRI and MRS in vivo.

Não invasivo In Vivo Pequenos Animais MRI e MRS: Basic procedimentos experimentais

Small animal Magnetic Resonance (MR) research has emerged as an important element of modern biomedical research due to its non-invasive nature and the ...

Multiplexed Fluorometric ImmunoAssay Testing Methodology and Troubleshooting

To ensure the quality of animal models used in biomedical research we have developed a number of diagnostic testing strategies and methods to determine if animals have been exposed to adventitious infectious agents (viruses, mycoplasma, and other fastidious microorganisms). Infections of immunocompetent animals are generally transient, yet serum antibody responses to infection often can be detected within days to weeks and persist throughout the life of the host. Serology is the primary diagnostic methodology by which laboratory animals are monitored. Historically the indirect enzyme-linked immunosorbent assay (ELISA) has been the main screening method for serosurveillance. The ELISA is performed as a singleplex, in which one microbial antigen-antibody reaction is measured per well. In comparison the MFIA is performed as a multiplexed assay. Since the microspheres come in 100 distinct color sets, as many as 100 different assays can be performed simultaneously in a single microplate well. This innovation decreases the amount of serum, reagents and disposables required for routine testing while increasing the amount of information obtained from a single test well. In addition, we are able to incorporate multiple internal control beads to verify sample and system suitability and thereby assure the accuracy of results. These include tissue control and IgG anti-test serum species immunoglobulin (&alpha;Ig) coated bead sets to evaluate sample suitability. As in the ELISA and IFA, the tissue control detects non-specific binding of serum immunoglobulin. The &alpha;Ig control (Serum control) confirms that serum has been added and contains a sufficient immunoglobulin concentration while the IgG control bead (System Suitability control), coated with serum species immunoglobulin, demonstrates that the labeled reagents and Luminex reader are functioning properly.

Using Luminex Corporation&#x2019;s xMAP microsphere technology, we have developed the Multiplexed Fluorometric ImmunoAssay (MFIA) for serosurveillance of various laboratory animal species. The MFIA is a suspension microarray where antigen, tissue control or immunoglobulins are covalently linked to color-coded polystyrene microspheres. The MFIA testing method as well as various troubleshooting topics is addressed.

Multiplexados Metodologia de Testes de imunoensaio fluorimétrico e solução de problemas

To ensure the quality of animal models used in biomedical research we have developed a number of diagnostic testing strategies and methods to determine if ...

Basic Caenorhabditis elegans Methods: Synchronization and Observation

Research into the molecular and developmental biology of the nematode Caenorhabditis elegans was begun in the early seventies by Sydney Brenner and it has since been used extensively as a model organism 1. C. elegans possesses key attributes such as simplicity, transparency and short life cycle that have made it a suitable experimental system for fundamental biological studies for many years 2. Discoveries in this nematode have broad implications because many cellular and molecular processes that control animal development are evolutionary conserved 3.
C. elegans life cycle goes through an embryonic stage and four larval stages before animals reach adulthood. Development can take 2 to 4 days depending on the temperature. In each of the stages several characteristic traits can be observed. The knowledge of its complete cell lineage 4,5 together with the deep annotation of its genome turn this nematode into a great model in fields as diverse as the neurobiology 6, aging 7,8, stem cell biology 9 and germ line biology 10. 
An additional feature that makes C. elegans an attractive model to work with is the possibility of obtaining populations of worms synchronized at a specific stage through a relatively easy protocol. The ease of maintaining and propagating this nematode added to the possibility of synchronization provide a powerful tool to obtain large amounts of worms, which can be used for a wide variety of small or high-throughput experiments such as RNAi screens, microarrays, massive sequencing, immunoblot or in situ hybridization, among others. 
Because of its transparency, C. elegans structures can be distinguished under the microscope using Differential Interference Contrast microscopy, also known as Nomarski microscopy. The use of a fluorescent DNA binder, DAPI (4',6-diamidino-2-phenylindole), for instance, can lead to the specific identification and localization of individual cells, as well as subcellular structures/defects associated to them.

Basic Caenorhabditis elegans Methods: Synchronization and Observation

The easiness of maintaining and propagating the nematode C. elegans make it a nice model organism to work with. The possibility of synchronizing worms allows the work with a significant amount of subjects at the same developmental stage, what facilitates the study of one particular process in many animals.

Básico<em&gt; Caenorhabditis elegans</em&gt; Métodos: Sincronização e observação

Research into the molecular and developmental biology of the nematode Caenorhabditis elegans was begun in the early seventies by Sydney Brenner and it has ...

A Guide to Modern Quantitative Fluorescent Western Blotting with Troubleshooting Strategies

The late 1970s saw the first publicly reported use of the western blot, a technique for assessing the presence and relative abundance of specific proteins within complex biological samples. Since then, western blotting methodology has become a common component of the molecular biologists experimental repertoire. A cursory search of PubMed using the term &#8220;western blot&#8221; suggests that in excess of two hundred and twenty thousand published manuscripts have made use of this technique by the year 2014. Importantly, the last ten years have seen technical imaging advances coupled with the development of sensitive fluorescent labels which have improved sensitivity and yielded even greater ranges of linear detection. The result is a now truly Quantifiable Fluorescence based Western Blot (QFWB) that allows biologists to carry out comparative expression analysis with greater sensitivity and accuracy than ever before. Many &#8220;optimized&#8221; western blotting methodologies exist and are utilized in different laboratories. These often prove difficult to implement due to the requirement of subtle but undocumented procedural amendments. This protocol provides a comprehensive description of an established and robust QFWB method, complete with troubleshooting strategies.

The advancement of western blotting using fluorescence has allowed detection of subtle changes in protein expression enabling quantitative analyses. Here we describe a robust methodology for detection of a range of proteins across a variety of species and tissue types. A strategy to overcome common technical problems is also provided.

A Guide to Modern quantitativa fluorescente Western Blotting com estratégias de resolução de problemas

The late 1970s saw the first publicly reported use of the western blot, a technique for assessing the presence and relative abundance of specific proteins ...

Subcloning Plus Insertion (SPI) - A Novel Recombineering Method for the Rapid Construction of Gene Targeting Vectors

Gene targeting refers to the precise modification of a genetic locus using homologous recombination. The generation of novel cell lines and transgenic mouse models using this method necessitates the construction of a &#8216;targeting&#8217; vector, which contains homologous DNA sequences to the target gene, and has for many years been a limiting step in the process. Vector construction can be performed in vivo in Escherichia coli cells using homologous recombination mediated by phage recombinases using a technique termed recombineering. Recombineering is the preferred technique to subclone the long homology sequences (>4kb) and various targeting elements including selection markers that are required to mediate efficient allelic exchange between a targeting vector and its cognate genomic locus. Typical recombineering protocols follow an iterative scheme of step-wise integration of the targeting elements and require intermediate purification and transformation steps. Here, we present a novel recombineering methodology of vector assembly using a multiplex approach. Plasmid gap repair is performed by the simultaneous capture of genomic sequence from mouse Bacterial Artificial Chromosome libraries and the insertion of dual bacterial and mammalian selection markers. This subcloning plus insertion method is highly efficient and yields a majority of correct recombinants. We present data for the construction of different types of conditional gene knockout, or knock-in, vectors and BAC reporter vectors that have been constructed using this method. SPI vector construction greatly extends the repertoire of the recombineering toolbox and provides a simple, rapid and cost-effective method of constructing these highly complex vectors.

Subcloning Plus Insertion SPI - A Novel Recombineering Method for the Rapid Construction of Gene Targeting Vectors

Gene targeting methodologies can be used to generate transgenic mice with knockout, knock-in and tagged alleles. Here, we describe an improved method of recombineering in E. coli, that we term &#8216;subcloning plus insertion&#8217;, which can be used to generate custom gene targeting vectors rapidly.

Subclonagem Além disso Inserção (SPI) - Um Método recombineering Novel para a construção rápida de Gene Segmentação Vetores

Gene targeting refers to the precise modification of a genetic locus using homologous recombination. The generation of novel cell lines and transgenic ...

A Rapid Automated Protocol for Muscle Fiber Population Analysis in Rat Muscle Cross Sections Using Myosin Heavy Chain Immunohistochemistry

Quantification of muscle fiber populations provides a deeper insight into the effects of disease, trauma, and various other influences on skeletal muscle composition. Various time-consuming methods have traditionally been used to study fiber populations in many fields of research. However, recently developed immunohistochemical methods based on myosin heavy chain protein expression provide a quick alternative to identify multiple fiber types in a single section. Here, we present a rapid, reliable and reproducible protocol for improved staining quality, allowing automatic acquisition of whole cross sections and automatic quantification of fiber populations with ImageJ. For this purpose, embedded skeletal muscles are cut in cross sections, stained using myosin heavy chains antibodies with secondary fluorescent antibodies and DAPI for cell nuclei staining. Whole cross sections are then scanned automatically using a slide scanner to obtain high-resolution composite pictures of the entire specimen. Fiber population analyses are subsequently performed to quantify slow, intermediate and fast fibers using an automated macro for ImageJ. We have previously shown that this method can identify fiber populations reliably to a degree of &#177;4%. In addition, this method reduces inter-user variability and time per analyses significantly using the open source platform ImageJ.

Here, we present a protocol for rapid muscle fiber analyses, which allows improved staining quality, and thereby automatic acquisition and quantification of fiber populations using the freely available software ImageJ.

Um Protocolo Automatizado Rápido para Muscle Fiber Análise População em músculo secções transversais Usando Cadeia miosina pesada Imunohistoquímica

Quantification of muscle fiber populations provides a deeper insight into the effects of disease, trauma, and various other influences on skeletal muscle ...

Procedure and Key Optimization Strategies for an Automated Capillary Electrophoretic-based Immunoassay Method

New technologies that utilize capillary-based immunoassays promise faster and more quantitative protein assessment compared to traditional immunoassays. However, similar to other antibody-based protein assays, optimization of capillary-based immunoassay parameters, such as protein concentration, antibody dilution, and exposure time is an important prerequisite to the generation of meaningful and reliable data. Measurements must fall within the linear range of the assay where changes in signal are directly proportional to changes in lysate concentration. The process of choosing appropriate lysate concentrations, antibody dilutions, and exposure times in the human bronchial epithelial cell line, BEAS-2B, is demonstrated here. Assay linearity is shown over a range of whole cell extract protein concentrations with p53 and &#945;-tubulin antibodies. An example of signal burnout is seen at the highest concentrations with long exposure times, and an &#945;-tubulin antibody dilution curve is shown demonstrating saturation. In addition, example experimental results are reported for doxorubicin-treated cells using optimized parameters.

A capillary-based immunoassay using a commercial platform to measure target proteins from total protein preparations is demonstrated. In addition, assay parameters of exposure time, protein concentration, and antibody dilution are optimized for a cell culture model system.

Procedimento e estratégias de otimização de chave para um método automatizado capilar imunoensaio eletroforética com base em

New technologies that utilize capillary-based immunoassays promise faster and more quantitative protein assessment compared to traditional immunoassays. ...

Strategies for Optimization of Cryogenic Electron Tomography Data Acquisition

Cryogenic electron tomography (cryoET) is a powerful method to study the 3D structure of biological samples in a close-to-native state. Current state-of-the-art cryoET combined with subtomogram averaging analysis enables the high-resolution structural determination of macromolecular complexes that are present in multiple copies within tomographic reconstructions. Tomographic experiments usually require a vast amount of tilt series to be acquired by means of high-end transmission electron microscopes with important operational running-costs. Although the throughput and reliability of automated data acquisition routines have constantly improved over the recent years, the process of selecting regions of interest at which a tilt series will be acquired cannot be easily automated and it still relies on the user's manual input. Therefore, the set-up of a large-scale data collection session is a time-consuming procedure that can considerably reduce the remaining microscope time available for tilt series acquisition. Here, the protocol describes the recently developed implementations based on the SerialEM package and the PyEM software that significantly improve the time-efficiency of grid screening and large-scale tilt series data collection. The presented protocol illustrates how to use SerialEM scripting functionalities to fully automate grid mapping, grid square mapping, and tilt series acquisition. Furthermore, the protocol describes how to use PyEM to select additional acquisition targets in off-line mode after automated data collection is initiated. To illustrate this protocol, its application in the context of high-end data collection of Sars-Cov-2 tilt series is described. The presented pipeline is particularly suited to maximizing the time-efficiency of tomography experiments that require a careful selection of acquisition targets and at the same time a large amount of tilt series to be collected.

The increasing demand for large-scale data collection in cryogenic electron tomography requires high-throughput image acquisition routines. Described here is a protocol that implements the recent developments of advanced acquisition strategies aimed at maximizing the time-efficiency and throughput of tomographic data collection.