This work was supported by National Institutes of Health (NIH) Grants CA127231 and The Damon Runyon Foundation Clinical Investigator Award (CI 1502) (to S.M). We would like to thank Professor Zdenek Dvorak from Palacky University Olomouc, Czech Republic for his helpful insights into discussing portability of this technique to their institution and standardization of protocol.

1. Construction of PXR and SRC-1 Fusions in Yeast Vectors
<ol>
	<li>PCR amplification of Human PXR LBD (107-434 amino acids) and Human SRC-1 full length (1-1401 amino acids).
	<ol>
		<li>Use pSG5-hPXR plasmid8 as PXR LBD template, use pCMX-SRC1 plasmid as SRC-1 templates.</li>
		<li>Thaw PCR SuperMix, DNA templates and primers (see Materials), keep them on ice.</li>
		<li>Add 0.25 &#956;g/&#956;l DNA template 1 &#956;l, 10 mM primer pairs 2 &#956;l each, PCR SuperMix 45 &#956;l and add H2O to bring total volume to 50 &#956;l.</li>
		<li>Set PCR at one cycle of 94 &#176;C for 2 min, 20 cycles of 94 &#176;C for 30 sec, 55 &#176;C for 30 sec&#160;and 72 &#176;C for 2 min, then one cycle of 72 &#176;C for 10 min&#160;for extension. Check PCR products by running on 1% agarose gel.</li>
	</ol>
	</li>
	<li>PCR products cloning into Y2H vectors.
	<ol>
		<li>Purify PCR products from 1% agarose gel. Digest PXR, LBD, PCR, and Y2H vector pSH2-1 with BamHI and SalI; digest SRC-1 PCR and Y2H vector pGADNOT with Not&#921; and Sal&#921;. To do this, add 1 &#956;g DNA , 3 &#956;l 10x reaction buffer, 1 &#956;l restriction enzymes, and finally H2O to bring total volume to 30 &#956;l.</li>
		<li>Put digestion samples in 37 &#176;C water bath for 1 hr. Check digestion by running on 1% agarose gel.</li>
		<li>Purify digestion samples from 1% agarose gel, ligate digested PCR products and Y2H vectors and transform to DH5&#945; competent cells.</li>
		<li>Pick the colonies and isolate the plasmid DNA.</li>
	</ol>
	</li>
	<li>Identify pSH2-1-PXR plasmid DNA by BamHI/SalI digestion, identify pGADNOT-SRC-1 plasmid DNA by NotI/SalI digestion. Verify all positive plasmid DNA by sequencing.</li>
</ol>
2. Yeast Two-hybrid Assays
<ol>
	<li>Inoculate the yeast strain into 5 ml YPAD and incubate over night by constant agitation (220 rpm at 30 &#176;C). Note: The Saccharomyces cerevisiae strain was CTY10-5d (MATa ade2 trp1-901 leu2-3,112 his3-200 ga l4-gal80- URA3::lexA-lacZ) that contains an integrated GAL1-lacZ gene with lexA operator10. To obtain viable yeast cells resistant to ketoconazole, but those that did not carry transporter alterations as a cause of azole resistance18-20, novel strains of CTY10-5d yeast were obtained by first deleting ERG3 ( erg3&#916;)and then introducing additional deletion in ERG11 ( erg3&#916;/erg11&#916;) genes by homologous recombination. The construction details have been described in a previously published manuscript6 .</li>
	<li>The next day (in the morning), inoculate yeast (1:20) in 5 ml YAPD and incubate to obtain an OD600&#160;~0.2 by constant agitation (220 rpm at 30 &#176;C).</li>
	<li>Pellet the cells at 2,000 rpm in a microcentrifuge for 2 min and discard the supernatant. Then wash the pellet twice with autoclaved water and once with 0.1 M LiAc.</li>
	<li>After the final wash, discard supernatant and add the following reagents to the cell pellet: 240 &#956;l PEG 3500 50% w/v, 36 &#956;l 1 M LiAc, 50 &#956;l 2 mg/ml boiled salmon sperm ssDNA, H2O 34 &#956;l. Vortex to mix, add 1 &#956;g pSH-PXR and 1 &#956;g pGADNOT-SRC-1 DNA and mix.</li>
	<li>Transfer the mix to polystyrene round-bottom tube, agitate the transformation, mix (220 rpm at 30 &#176;C) for 30 min. Move the tube to 42 &#176;C water bath and incubate for an additional 30 min.</li>
	<li>Centrifuge the tube at 2,000 rpm for 2 min and remove the supernatant. Wash pellet once with autoclaved water.</li>
	<li>Pipette 100 &#956;l sterile water into the tube, re-suspend the cells by gentle finger tapping and pipetting, then plate onto plates of -His/-Leu Dropout Medium (Formulation per One Liter -His/-Leu Dropout Medium: 20 g dextrose, 1.7 g YNB, 0.67 g CSM-His/-Leu, 5 g ammonium sulfate, 1.5% agar) and incubate at 30 &#176;C for 3-4 days to isolate transformants.</li>
</ol>
3. X-gal Filter Assay
<ol>
	<li>Cut nitrocellulose membrane to the size of part of a Petri dish. Label the nitrocellulose membrane to mark the orientation.</li>
	<li>Place premarked nitrocellulose membrane on yeast colonies, make sure that the membrane is in contact with the surface of the plate medium.</li>
	<li>Remove the membrane, place it colony side up on a 3 mm filter paper, and place the membrane and the filter paper at -80 &#176;C for 15 min.</li>
	<li>Make X-gal solution. Add 50 &#956;l 20 mg/ml X-gal and 15 &#956;l &#946;-mercaptoethanol to 5 ml of Z-buffer (1 L buffer contains 16.1 g Na2HPO47H2O, 5.5 g NaH2PO4 H2O, 0.75 g KCl , 0.25 g MgSO4&#8226;7H2O) . If Z Buffer was kept at 4 &#176;C, bring it to room temperature before adding these reagents.</li>
	<li>Place two circles of 3 mm filter paper in a Petri dish and soak them with 5 ml X-gal solution. Drain excess buffer from the Petri dish and place the nitrocellulose membrane with the colony side up.</li>
	<li>Close the lid, ensure that the membrane is making complete contact with the filter paper and it is completely wet. Wrap the Petri dish in foil and incubate at 37 &#176;C for 30 min to overnight.</li>
</ol>
4. Liquid &#946;-gal Assay
<ol>
	<li>Grow Yeast in -His/-Leu Dropout liquid medium to OD600 0.7.</li>
	<li>Transfer 1 ml medium into a 1.5 ml microcentrifuge tube and centrifuge at 3,000 rpm for 2 min. Discard the supernatant.</li>
	<li>Add 1 ml of Z Buffer to resuspend the pellet, centrifuge at 3,000 rpm again for 2 min. Discard the supernatant.</li>
	<li>Add 150 &#956;l of Z Buffer with 2ME to resuspend the cell pellet, mix then add 50 &#956;l chloroform and 20 &#956;l 0.1% SDS. Vigorously vortex the sample for 15 sec.</li>
	<li>Add 700 &#956;l of ONPG Solution (1 mg/ml in Z buffer). Set the timer, incubate at 30 &#176;C long enough to allow the yellow colour to develop and note total reaction time.</li>
	<li>Add 500 &#956;l of 1 M Na2CO3 to stop the reaction and determine the absorbance at 420 nm. The blank is 700 &#956;l ONPG solution plus 500 &#956;l 1 M Na2CO3.</li>
</ol>
Calculate Miller Units as follows: Miller Units = (&#197;420*1,000)/(&#197;600*min*ml)
&#197;420: absorbance units at 420 nanometers; &#197;600: absorbance units at 600 nanometers; min: the reaction time in minutes;&#160;ml: the reaction volume in ml

<ol>
	<li>Kliewer, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+orphan+nuclear+receptor+activated+by+pregnanes+defines+a+novel+steroid+signaling+pathway.">An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway.</a> Cell. 92 (1), 73-82 (1998).</li><li>Blumberg, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=a+novel+steroid+and+xenobiotic-sensing+nuclear+receptor.">a novel steroid and xenobiotic-sensing nuclear receptor.</a> Genes Dev. 12 (20), 3195-3205 (1998).</li><li>Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elucidating+the+'Jekyll+and+Hyde'+Nature+of+PXR:+The+Case+for+Discovering+Antagonists.">Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists.</a> Pharm. Res. 26 (8), 1807-1815 (2009).</li><li>Pondugula, S. R., Mani, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pregnane+xenobiotic+receptor+in+cancer+pathogenesis+and+therapeutic+response.">Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response.</a> Cancer Lett. 328 (1), 1-9 (2013).</li><li>Mani, S., Dou, V., Redinbo, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PXR+antagonists+and+implications+for+drug+metabolism.">PXR antagonists and implications for drug metabolism.</a> Drug Metab. Rev. 45 (1), 60-72 (2013).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+Yeast-Based+Strategy+Unveils+Antagonist+Binding+Regions+on+the+Nuclear+Xenobiotic+Receptor+PXR.">Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR.</a> J. Biol. Chem. 288 (19), 13655-13668 (2013).</li><li>Hollenberg, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+new+family+of+tissue-specific+basic+helix-loop-helix+proteins+with+a+two-hybrid+system.">Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system.</a> Mol. Cell. Biol. 15 (7), 3813-3822 (1995).</li><li>Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+Ras+interacts+directly+with+the+serine/threonine+kinase+Raf.">Mammalian Ras interacts directly with the serine/threonine kinase Raf.</a> Cell. 74 (1), 205-214 (1993).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+phytoestrogen+coumestrol+is+a+naturally+occurring+antagonist+of+the+human+pregnane+X+receptor.">The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor.</a> Mol. Endocrinol. 22 (4), 838-857 (2008).</li><li>Kalpana, G. V., Goff, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+homomeric+interactions+of+human+immunodeficiency+virus+type+1+integrase+using+the+yeast+two-hybrid+system.">Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system.</a> Proc. Natl. Acad. Sci. U.S.A. 90 (22), 10593-10597 (1993).</li><li>Hamdi, A., Colas, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Yeast+two-hybrid+methods+and+their+applications+in+drug+discovery.">Yeast two-hybrid methods and their applications in drug discovery.</a> TiPS. 33 (2), 109-118 (2012).</li><li>Battesti, A., Bouveret, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bacterial+two-hybrid+system+based+on+adenylate+cyclase+reconstitution+in+Escherichia+coli.">The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli.</a> Methods. 58 (4), 325-334 (2012).</li><li>Caufield, J. H., Sakhawalkar, N., Uetz, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comparison+and+optimization+of+yeast+two-hybrid+systems.">A comparison and optimization of yeast two-hybrid systems.</a> Methods. 58 (4), 317-324 (2012).</li><li>Albers, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Automated+yeast+two-hybrid+screening+for+nuclear+receptor-interacting+proteins.">Automated yeast two-hybrid screening for nuclear receptor-interacting proteins.</a> Mol. Cell Proteomics. 4 (2), 205-213 (2005).</li><li>Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Putative+role+of+the+orphan+nuclear+receptor+SXR+(steroid+and+xenobiotic+receptor)+in+the+mechanism+of+CYP3A4+inhibition+by+xenobiotics.">Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics.</a> J. Biol. Chem. 277 (36), 32453-32458 (2002).</li><li>Huang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+drug+metabolism+by+blocking+the+activation+of+nuclear+receptors+by+ketoconazole.">Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole.</a> Oncogene. 26 (2), 258-268 (2007).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activated+pregnenolone+X-+receptor+is+a+target+for+ketoconazole+and+Its+analogs.">Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs.</a> Clin. Cancer Res. 13 (8), 2488-2495 (2007).</li><li>Ghannoum, M. A., Rice, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antifungal+agents:+mode+of+action,+mechanisms+of+resistance,+and+correlation+of+these+mechanisms+with+bacterial+resistance.">Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance.</a> Clin. Microbiol. Rev. 12 (4), 501-517 (1999).</li><li>Kaur, R., Bachhawat, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+yeast+multidrug+resistance+pump,+Pdr5p,+confers+reduced+drug+resistance+in+erg+mutants+of+Saccharomyces+cerevisiae.">The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae.</a> Microbiology. 145, 809-818 (1999).</li><li>White, T. C., Marr, K. A., Bowden, R. A., cellular, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical,+cellular,+and+molecular+factors+that+contribute+to+antifungal+drug+resistance.">Clinical, cellular, and molecular factors that contribute to antifungal drug resistance.</a> Clin. Microbiol. Rev. 11 (2), 382-402 (1998).</li><li>Serebriiskii, I. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+peptides,+proteins,+and+drugs+that+selectively+interact+with+protein+targets.">Detection of peptides, proteins, and drugs that selectively interact with protein targets.</a> Genome Res. 12, 1785-1791 (2002).</li><li>Yang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+role+for+PELP1+in+nonandrogenic+activation+of+the+androgen+receptor+in+prostate+cancer.">Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer.</a> Mol Endocrinol. 26 (4), 550-561 (2012).</li><li>Zhan, Y. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+orphan+nuclear+receptor+Nur77+regulates+LKB1+localization+and+activates+AMPK.">The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK.</a> Nat Chem Biol. 8 (11), 897-904 (2012).</li></ol>

No conflicts of interest declared.

In our modified Y2H assay, we have identified important residues for ketoconazole interactions on PXR6. Since SRC-1 is a coactivator (and was cloned into the pGADNot vector), we also tested whether SRC-1 could activate lacZ expression when cloned into the pSH vector system and whether this would change the activation profile and/or affect the leakiness of the yeast two-hybrid assay. Using our redesigned plasmids we performed two-hybrid assays in erg3&#916;/erg11&#916; yeast. As before, we sho...

A levedura de dois híbridos (Y2H) ensaio é utilizado para descobrir as interacções proteína-proteína e, mais recentemente, para a descoberta de novas moléculas pequenas que perturbem complexos proteína-proteína de interacção 7, 8, 9, 10, 11. No entanto, as abordagens convencionais deste ensaio, usado para a descoberta de medicamentos ou &quot;hits&quot;, não permitem a detecção de resíduos de interação de compostos químicos alostéricos dentro superfícies proteína-proteína, que, quando alterados ainda interagir e permitir o interrogatório dos resíduos alterados 11 . Com efeito, um tal método (s), se possível desenvolver, permitiria um sistema de levedura tratável para avaliação de alto rendimento de resíduos de interacção alostéricos críticos para a interacção proteína-proteína ruptura. No contexto da descoberta da droga, a maneira mais direta de estabelecer a interação de compostos com proteínas envolveria determinação estrutural (por exemplo, cristalização do complexo proteína-inibidor). Estes métodos são cumbersome, utilizar os recursos elaborados e não é tecnicamente viável a realização de estudos estruturais em cada proteína. Sistemas de rastreio de drogas genética tratável foram estabelecidas em bactérias 1, 2 e outros sistemas modelo como mamíferos de dois híbridos. No entanto, esses sistemas precisam de otimização e sistemas alternativos como Y2H ainda são os mais testados na descoberta de medicamentos. Há limitações que incluem pouca sensibilidade e confiabilidade das interações usando métodos singulares 13, no entanto, um ensaio Y2H único pode ser modificada para responder a perguntas específicas sobre resíduos de interação. No campo da investigação de receptores nucleares, Y2H foi usado para definir as proteínas que interagem 14, no entanto, estas interacções proteína raramente foram utilizados para definir a natureza, em que os ligandos / antagonistas do receptor interajam com complexos proteicos nucleares. Assim, o nosso laboratório concentrado esforços na definição de um método, especialmente para as proteínas receptoras que não sejamprontamente passíveis de proteômica métodos baseados, que desenterrar novela ligante / antagonista interagindo resíduos utilizando uma plataforma baseada Y2H descoberta inversa. Com base em nossa constatação anterior que o cetoconazol interrompe PXR e seu ativador SRC-1, foi desenvolvido um novo sistema de reverter Y2H que nos permitirá definir e interrogar cetoconazol interagir resíduos em PXR 6. O nosso método baseia-se nas propriedades da proteína GAL4 de levedura, que consiste em domínios separáveis ​​responsáveis ​​pela activação de ligação a ADN e transcricional. A proteína PXR LBD é expressa como uma fusão com o domínio de ligação de LexA de ADN (DNA-BD), enquanto que as de comprimento total de co-activadores de SRC-1 (coactivator do receptor de esteróides 1) as proteínas são expressas como fusões com o domínio de activação de GAL4 (AD ). Interacção entre PXR e SRC-1 As proteínas de fusão conduz à activação da transcrição de GAL4, sítios de ligação que contêm genes repórter β-Lac Z, que é integrado no genom levedurae. Cetoconazol, um antagonista de PXR, interrompe PXR e SRC-1 interacção 15, 16, 17 e que pode detectar a interacção de PXR e SRC-1 na presença ou ausência de cetoconazol após coloração colónias em filtros para a actividade de X-gal. O princípio de Y2H é ilustrada na Figura 1 e o procedimento experimental é resumido na Figura 2.

<table border="1">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Yeast Strain CTY10-5d erg3&#916;/erg11&#916;</td>
			<td>Our lab</td>
			<td></td>
			<td>CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3&#916;/erg11&#916;) genes6 .</td>
		</tr>
		<tr>
			<td>YPD Growth Medium</td>
			<td>BD Biosciences</td>
			<td>630409</td>
			<td></td>
		</tr>
		<tr>
			<td>Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate</td>
			<td>BD Biosciences</td>
			<td>233520</td>
			<td></td>
		</tr>
		<tr>
			<td>Bacto Agar</td>
			<td>BD Biosciences</td>
			<td>214010</td>
			<td></td>
		</tr>
		<tr>
			<td>CSM-His/-Leu Complete Supplement Mixture</td>
			<td>MP Biomedicals</td>
			<td>4250-412</td>
			<td></td>
		</tr>
		<tr>
			<td>ONPG (o-Nitrophenyl &#914;-D- Galactopyranoside).</td>
			<td>Sigma-Aldrich</td>
			<td>N1127</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Sigma-Aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>Luria Broth (LB)</td>
			<td>Sigma-Aldrich</td>
			<td>L3022</td>
			<td></td>
		</tr>
		<tr>
			<td>X-Gal</td>
			<td>Fisher</td>
			<td>BP-1615</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicated Salmon Sperm DNA boiled (10 mg/ml)</td>
			<td>Life Technology</td>
			<td>156-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Acros Organics</td>
			<td>61177</td>
			<td></td>
		</tr>
		<tr>
			<td>Ketoconazole</td>
			<td>Sigma-Aldrich</td>
			<td>K1003</td>
			<td></td>
		</tr>
		<tr>
			<td>N,N-Dimethylformamide</td>
			<td>Acros Organics</td>
			<td>326871000</td>
			<td></td>
		</tr>
		<tr>
			<td>Lithium Acetate</td>
			<td>Sigma-Aldrich</td>
			<td>L4158</td>
			<td></td>
		</tr>
		<tr>
			<td>50% PEG-3350 solution, filter-sterilized</td>
			<td>Sigma-Aldrich</td>
			<td>P-3640</td>
			<td></td>
		</tr>
		<tr>
			<td>Nitrocellulose Membrane</td>
			<td>Whatman</td>
			<td>10402091</td>
			<td></td>
		</tr>
		<tr>
			<td>10 cm Petri Dish</td>
			<td>Fisher</td>
			<td>875712</td>
			<td></td>
		</tr>
		<tr>
		</tr>
	</tbody>
</table>

<table border="1">
	<tbody>
		<tr>
			<td>5&#39;-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD forward primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-AGAGTCGACTCAGCTA CCTGTGATGCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD reverse primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 forward primer for pGADNOT</td>
		</tr>
		<tr>
			<td>5&#39;-GCGGTCGACTTATTCAGTCA GTAGCTG -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 reverse primer for pGADNOT</td>
		</tr>
		<tr>
			<td>Platinum PCR Supermix</td>
			<td>Invitrogen</td>
			<td>11306-016</td>
			<td></td>
		</tr>
		<tr>
			<td>BamHI</td>
			<td>our lab</td>
			<td>R0136</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI</td>
			<td>our lab</td>
			<td>R0138</td>
			<td></td>
		</tr>
		<tr>
			<td>NotI</td>
			<td>our lab</td>
			<td>R0189</td>
			<td></td>
		</tr>
	</tbody>
</table>

reverse yeast two-hybrid system to identify mammalian nuclear receptor residues that interact with ligands and/or antagonists

Como um regulador fundamental no metabolismo de drogas e inflamação, Pregnane X Receptor (PXR), desempenha um papel importante na patofisiologia da doença ligando metabolismo e inflamação (por exemplo, a esteatose hepática) 1,2. Tem havido muito progresso na identificação de ligantes agonistas para PXR, no entanto, há descrições limitadas de antagonistas droga-como e seus sítios de ligação PXR 3,4,5. Uma barreira crítica tem sido a incapacidade de purificar de forma eficiente a proteína de comprimento completo para estudos estruturais com antagonistas, apesar do facto de PXR foi clonado e caracterizado em 1998. O nosso laboratório desenvolveu uma nova levedura de alto rendimento com base ensaio de dois híbridos para definir um antagonista, de cetoconazol, os resíduos de ligação em PXR 6. O nosso método envolve a criação de bibliotecas de mutações que seriam resgatar o efeito das mutações individuais em FA-2 superfície de PXR o esperado para interagir com cetoconazol. Resgate ou &quot;ganho de função&quot; secomutações nd pode ser feita de tal forma que conclusões a respeito da interação genética de cetoconazol e do resíduo (s) de superfície em PXR são viáveis. Assim, foi desenvolvido um alto rendimento de dois híbridos tela levedura de mutantes PXR interagindo com sua coactivator, SRC-1. Usando esta abordagem, em que a levedura foi modificado para acomodar o estudo da droga antifúngica, cetoconazol, conseguimos demonstrar mutações específicas em PXR enriquecidas em clones incapazes de se ligar ao cetoconazol. Pela lógica inversa, podemos concluir que os resíduos originais são resíduos diretos de interação com cetoconazol. Este ensaio representa um romance, ensaio genético tratável para a tela por sítios de ligação do antagonista do receptor nuclear em superfícies. Este ensaio pode ser aplicado a qualquer medicamento, independentemente do seu potencial citotóxico de levedura, bem como a proteína (s) celular, que não pode ser estudado usando biologia estrutural padrão ou métodos proteomic base. Armadilhas potenciais incluem interpretação de dados (métodos complementares útil), reliance em método único Y2H, experiência em lidar com fermento ou levedura realizando ensaios de dois híbridos e otimização do ensaio.

We performed an assay to see if we could detect a colorimetric readout of the association of PXR and steroid receptor coactivator-1 (SRC-1). Since yeast has significant sterol production, it has previously been shown that lacZ expression in yeast can be induced without the need for additional exogenous ligand. We found that lacZ expression (blue colonies) is also induced in the yeast strain transformed with PXR and SRC-1; however, there is no induction of LacZ expression (white colonies) in yeast transformed with empty v...

Watch this Scientific Journal Video about Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists at JoVE.com

Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists

Ketoconazole binds to and antagonizes Pregnane X Receptor (PXR) activation. Yeast high throughput screens of PXR mutants define a unique region for ketoconazole binding. This yeast-based genetic method discovers novel nuclear receptor interactions with ligands that associate with surface binding sites.

Reverter levedura Sistema de dois híbridos para identificar mamíferos Receptor Nuclear Resíduos que interagem com ligantes e / ou antagonistas

As a critical regulator of drug metabolism and inflammation, Pregnane X Receptor (PXR), plays an important role in disease pathophysiology linking ...

reverse-yeast-two-hybrid-system-to-identify-mammalian-nuclear

Research

JoVE Journal

Biology

12.7K visualizações.  Albert Einstein College of Medicine. Ketoconazole binds to and antagonizes Pregnane X Receptor (PXR) activation. Yeast high throughput screens of PXR mutants define a unique region for ketoconazole binding. This yeast-based genetic method discovers novel nuclear receptor interactions with ligands that associate with surface binding sites.

Vídeo: Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists

Proteomics to Identify Proteins Interacting with P2X2 Ligand-Gated Cation Channels

Ligand-gated ion channels underlie synaptic communication in the nervous system1. In mammals there are three families of ligand-gated channels: the cys loop, the glutamate-gated and the P2X receptor channels2. In each case binding of transmitter leads to the opening of a pore through which ions flow down their electrochemical gradients. Many ligand-gated channels are also permeable to calcium ions3, 4, which have downstream signaling roles5 (e.g. gene regulation) that may exceed the duration of channel opening. Thus ligand-gated channels can signal over broad time scales ranging from a few milliseconds to days. Given these important roles it is necessary to understand how ligand-gated ion channels themselves are regulated by proteins, and how these proteins may tune signaling. Recent studies suggest that many, if not all, channels may be part of protein signaling complexes6. In this article we explain how to identify the proteins that bind to the C-terminal aspects of the P2X2 receptor cytosolic domain.
P2X receptors are ATP-gated cation channels and consist of seven subunits (P2X1-P2X7). P2X receptors are widely expressed in the brain, where they mediate excitatory synaptic transmission and presynaptic facilitation of neurotransmitter release7. P2X receptors are found in excitable and non-excitable cells and mediate key roles in neuronal signaling, inflammation and cardiovascular function8. P2X2 receptors are abundant in the nervous system9 and are the focus of this study. Each P2X subunit is thought to possess two membrane spanning segments (TM1 &amp; TM2) separated by an extracellular region7 and intracellular N and C termini (Fig 1a)7. P2X subunits10 (P2X1-P2X7) show 30-50% sequence homology at the amino acid level11. P2X receptors contain only three subunits, which is the simplest stoichiometry among ionotropic receptors. The P2X2 C-terminus consists of 120 amino acids (Fig 1b) and contains several protein docking consensus sites, supporting the hypothesis that P2X2 receptor may be part of signaling complexes. However, although several functions have been attributed to the C-terminus of P2X2 receptors9 no study has described the molecular partners that couple to the intracellular side of this protein via the full length C-terminus. In this methods paper we describe a proteomic approach to identify the proteins which interact with the full length C-terminus of P2X2 receptors.

We describe a simple protocol to identify brain proteins that bind to the full length C terminus of ATP-gated P2X2 receptors. The extension and systematic application of this approach to all P2X receptors is expected to lead to a better understanding of P2X receptor signaling.

Proteômica para identificar proteínas Interagindo com P2X2 Canais Ligand-Gated Cation

Ligand-gated ion channels underlie synaptic communication in the nervous system1. In mammals there are three families of ligand-gated channels: the cys ...

Biologia

Split-Ubiquitin Based Membrane Yeast Two-Hybrid (MYTH) System: A Powerful Tool For Identifying Protein-Protein Interactions

The fundamental biological and clinical importance of integral membrane proteins prompted the development of a yeast-based system for the high-throughput identification of protein-protein interactions (PPI) for full-length transmembrane proteins. To this end, our lab developed the split-ubiquitin based Membrane Yeast Two-Hybrid (MYTH) system. This technology allows for the sensitive detection of transient and stable protein interactions using Saccharomyces cerevisiae as a host organism. MYTH takes advantage of the observation that ubiquitin can be separated into two stable moieties: the C-terminal half of yeast ubiquitin (Cub) and the N-terminal half of the ubiquitin moiety (Nub). In MYTH, this principle is adapted for use as a 'sensor' of protein-protein interactions. Briefly, the integral membrane bait protein is fused to Cub which is linked to an artificial transcription factor. Prey proteins, either in individual or library format, are fused to the Nub moiety. Protein interaction between the bait and prey leads to reconstitution of the ubiquitin moieties, forming a full-length 'pseudo-ubiquitin' molecule. This molecule is in turn recognized by cytosolic deubiquitinating enzymes, resulting in cleavage of the transcription factor, and subsequent induction of reporter gene expression. The system is highly adaptable, and is particularly well-suited to high-throughput screening. It has been successfully employed to investigate interactions using integral membrane proteins from both yeast and other organisms.

Split-Ubiquitin Based Membrane Yeast Two-Hybrid MYTH System: A Powerful Tool For Identifying Protein-Protein Interactions

MYTH allows the sensitive detection of transient and stable interactions between proteins that are expressed in the model organism Saccharomyces cerevisiae. It has been successfully applied to study exogenous and yeast integral membrane proteins in order to identify their interacting partners in a high throughput manner.

Split-Ubiquitina Yeast Membrana Baseado Two-Hybrid (MITO) do sistema: uma ferramenta poderosa para identificação de interações proteína-proteína

The fundamental biological and clinical importance of integral membrane proteins prompted the development of a yeast-based system for the high-throughput ...

Analysis of mRNA Nuclear Export Kinetics in Mammalian Cells by Microinjection

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although the nuclear export of mRNA has been studied extensively in Xenopus oocytes1 and genetically tractable organisms such as yeast2 and the Drosophila derived S2 cell line3, few studies had been conducted in mammalian cells. Furthermore the kinetics of mRNA export in mammalian somatic cells could only be inferred indirectly4,5. In order to measure the nuclear export kinetics of mRNA in mammalian tissue culture cells, we have developed an assay that employs the power of microinjection coupled with fluorescent in situ hybridization (FISH). These assays have been used to demonstrate that in mammalian cells, the majority of mRNAs are exported in a splicing dependent manner6,7, or in manner that requires specific RNA sequences such as the signal sequence coding region (SSCR) 6. In this assay, cells are microinjected with either in vitro synthesized mRNA or plasmid DNA containing the gene of interest. The microinjected cells are incubated for various time points then fixed and the sub-cellular localization of RNA is assessed using FISH. In contrast to transfection, where transcription occurs several hours after the addition of nucleic acids, microinjection of DNA or mRNA allows for rapid expression and allows for the generation of precise kinetic data.

Here we describe an assay that employs the power of microinjection coupled with fluorescent in situ hybridization in order to accurately measure the nuclear export kinetics of mRNA in mammalian somatic cells.

Análise de Cinética mRNA Nuclear Exportação em células de mamíferos por microinjeção

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although ...

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

C. elegans has proven to be a valuable model system for the discovery and functional characterization of many genes and gene pathways1. More sophisticated tools and resources for studies in this system are facilitating continued discovery of genes with more subtle phenotypes or roles. 
Here we present a generalized protocol we adapted for identifying C. elegans genes with postembryonic phenotypes of interest using RNAi2. This procedure is easily modified to assay the phenotype of choice, whether by light or fluorescence optics on a dissecting or compound microscope. This screening protocol capitalizes on the physical assets of the organism and molecular tools the C. elegans research community has produced. As an example, we demonstrate the use of an integrated transgene that expresses a fluorescent product in an RNAi screen to identify genes required for the normal localization of this product in late stage larvae and adults. First, we used a commercially available genomic RNAi library with full-length cDNA inserts. This library facilitates the rapid identification of multiple candidates by RNAi reduction of the candidate gene product. Second, we generated an integrated transgene that expresses our fluorecently tagged protein of interest in an RNAi-sensitive background. Third, by exposing hatched animals to RNAi, this screen permits identification of gene products that have a vital embryonic role that would otherwise mask a post-embryonic role in regulating the protein of interest. Lastly, this screen uses a compound microscope equipped for single cell resolution.

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

We describe a sensitized method to identify postembryonic regulators of protein expression and localization in C. elegans using an RNAi-based genomic screen and an integrated transgene that expresses a functional, fluorescently tagged protein.

RNAi de triagem para identificar fenótipos pós-embrionário em C. elegans</em

C. elegans has proven to be a valuable model system for the discovery and functional characterization of many genes and gene pathways1. More sophisticated ...

Modified Yeast-Two-Hybrid System to Identify Proteins Interacting with the Growth Factor Progranulin

Progranulin (PGRN), also known as granulin epithelin precursor (GEP), is a 593-amino-acid autocrine growth factor. PGRN is known to play a critical role in a variety of physiologic and disease processes, including early embryogenesis, wound healing 1, inflammation 2, 3, and host defense 4. PGRN also functions as a neurotrophic factor 5, and mutations in the PGRN gene resulting in partial loss of the PGRN protein cause frontotemporal dementia 6, 7. Our recent studies have led to the isolation of PGRN as an important regulator of cartilage development and degradation 8-11. Although PGRN, discovered nearly two decades ago, plays crucial roles in multiple physiological and pathological conditions, efforts to exploit the actions of PGRN and understand the mechanisms involved have been significantly hampered by our inability to identify its binding receptor(s). To address this issue, we developed a modified yeast two-hybrid (MY2H) approach based on the most commonly used GAL4 based 2-hybrid system. Compared with the conventional yeast two-hybrid screen, MY2H dramatically shortens the screen process and reduces the number of false positive clones. In addition, this approach is reproducible and reliable, and we have successfully employed this system in isolating the binding proteins of various baits, including ion channel 12, extracellular matrix protein 10, 13, and growth factor14. In this paper, we describe this MY2H experimental procedure in detail using PGRN as an example that led to the identification of TNFR2 as the first known PGRN-associated receptor 14, 15.

We have modified the conventional yeast two-hybrid screening, an effective genetic tool in identifying protein interaction. This modification markedly shortens the process, reduces the workload, and most importantly, reduces the number of false positives. In addition, this approach is reproducible and reliable.

Modificado Sistema Yeast-Two-Hybrid para identificar proteínas Interagindo com o Fator de Crescimento progranulina

Progranulin (PGRN), also known as granulin epithelin precursor (GEP), is a 593-amino-acid autocrine growth factor. PGRN is known to play a critical role ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

Screening siRNA identificar Ubiquitin e ubiquitina-como reguladores do sistema de caminhos biológicos em células de mamíferos cultivadas

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...

Detecting Estrogenic Ligands in Personal Care Products using a Yeast Estrogen Screen Optimized for the Undergraduate Teaching Laboratory

The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine disruption. Estrogenic ligands include both natural and manmade &#34;Environmental Estrogens&#34; (EEs) found in many consumer goods including Personal Care Products (PCPs), plastics, pesticides, and foods. EEs disrupt hormone signaling in humans and other animals, potentially reducing fertility and increasing disease risk. Despite the importance of EEs and other Endocrine Disrupting Chemicals (EDCs) to public health, endocrine disruption is not typically included in undergraduate curricula. This shortcoming is partly due to a lack of relevant laboratory activities that illustrate the principles involved while also being accessible to undergraduate students. This article presents an optimized YES for quantifying ligands in personal care products that bind estrogen receptors alpha (ER&#945;) and/or beta (ER&#946;). The method incorporates one of the two colorimetric substrates (ortho-nitrophenyl-&#946;-D-galactopyranoside (ONPG) or chlorophenol red-&#946;-D-galactopyranoside (CPRG)) that are cleaved by &#946;-galactosidase, a 6-day refrigerated incubation step to facilitate use in undergraduate laboratory courses, an automated application for LacZ calculations, and R code for the associated 4-parameter logistic regression analysis. The protocol has been designed to allow undergraduate students to develop and conduct experiments in which they screen products of their choosing for estrogen mimics. In the process, they learn about endocrine disruption, cell culture, receptor binding, enzyme activity, genetic engineering, statistics, and experimental design. Simultaneously, they also practice fundamental and broadly applicable laboratory skills, such as: calculating concentrations; making solutions; demonstrating sterile technique; serially diluting standards; constructing and interpolating standard curves; identifying variables and controls; collecting, organizing, and analyzing data; constructing and interpreting graphs; and using common laboratory equipment such as micropipettors and spectrophotometers. Thus, implementing this assay encourages students to engage in inquiry-based learning while exploring emerging issues in environmental science and health.

This article presents an optimized yeast estrogen screen for quantifying ligands in Personal Care Products (PCPs) that bind estrogen receptors alpha (ER&#945;) and/or beta (ER&#946;). The method incorporates two colorimetric substrate options, a six-day refrigerated incubation for use in undergraduate courses, and statistical tools for data analysis.

Detecção de ligantes estrogênicos em produtos de cuidados pessoal usando uma tela de estrogênio de levedura otimizada para o laboratório de ensino de graduação

The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine ...

A Flow Cytometry-based Assay to Identify Compounds That Disrupt Binding of Fluorescently-labeled CXC Chemokine Ligand 12 to CXC Chemokine Receptor 4

Pharmacological targeting of G protein-coupled receptors (GPCRs) is of great importance to human health, as dysfunctional GPCR-mediated signaling contributes to the progression of many diseases. The ligand/receptor pair CXC chemokine ligand 12 (CXCL12)/CXC chemokine receptor 4 (CXCR4) has raised significant clinical interest, for instance as a potential target for the treatment of cancer and inflammatory diseases. Small molecules as well as therapeutic antibodies that specifically target CXCR4 and inhibit the receptor&#39;s function are therefore considered to be valuable pharmacological tools. Here, a flow cytometry-based cellular assay that allows identification of compounds (e.g., small molecules) that abrogate CXCL12 binding to CXCR4, is described. Essentially, the assay relies on the competition for receptor binding between a fixed amount of fluorescently labeled CXCL12, the natural chemokine agonist for CXCR4, and unlabeled compounds. Hence, the undesirable use of radioactively labeled probes is avoided in this assay. In addition, living cells are used as the source of receptor (CXCR4) instead of cell membrane preparations. This allows easy adaptation of the assay to a plate format, which increases the throughput. This assay has been shown to be a valuable generic drug discovery assay to identify CXCR4-targeting compounds. The protocol can likely be adapted to other GPCRs, at least if fluorescently labeled ligands are available or can be generated. Prior knowledge concerning the intracellular signaling pathways that are induced upon activation of these GPCRs, is not required.

A flow cytometry-based cellular binding assay is described that is primarily used as a screening tool to identify compounds that inhibit the binding of a fluorescently labeled CXC chemokine ligand 12 (CXCL12) to the CXC chemokine receptor 4 (CXCR4).

Um ensaio de baseados em citometria de fluxo para identificar compostos que interrompem a ligação do ligante de Chemokine fluorescente-etiquetadas CXC 12 a CXC Chemokine Receptor 4

Pharmacological targeting of G protein-coupled receptors (GPCRs) is of great importance to human health, as dysfunctional GPCR-mediated signaling ...

Examination of Mitotic and Meiotic Fission Yeast Nuclear Dynamics by Fluorescence Live-cell Microscopy

Live-cell imaging is a microscopy technique used to examine cell and protein dynamics in living cells. This imaging method is not toxic, generally does not interfere with cell physiology, and requires minimal experimental handling. The low levels of technical interference enable researchers to study cells across multiple cycles of mitosis and to observe meiosis from beginning to end. Using fluorescent tags such as Green Fluorescent Protein (GFP) and Red Fluorescent Protein (RFP), researchers can analyze different factors whose functions are important for processes like transcription, DNA replication, cohesion, and segregation. Coupled with data analysis using Fiji (a free, optimized ImageJ version), live-cell imaging offers various ways of assessing protein movement, localization, stability, and timing, as well as nuclear dynamics and chromosome segregation. However, as is the case with other microscopy methods, live-cell imaging is limited by the intrinsic properties of light, which put a limit to the resolution power at high magnifications, and is also sensitive to photobleaching or phototoxicity at high wavelength frequencies. However, with some care, investigators can bypass these physical limitations by carefully choosing the right conditions, strains, and fluorescent markers to allow for the appropriate visualization of mitotic and meiotic events.

Here, we present live-cell imaging which is a non-toxic microscopy method that allows researchers to study protein behavior and nuclear dynamics in living fission yeast cells during mitosis and meiosis.

Examinação da dinâmica nuclear do fermento mitotic e Meiotic da fissão pela microscopia viva-pilha da fluorescência

Live-cell imaging is a microscopy technique used to examine cell and protein dynamics in living cells. This imaging method is not toxic, generally does ...

A Two-Step Strategy that Combines Epigenetic Modification and Biomechanical Cues to Generate Mammalian Pluripotent Cells

Cell phenotype can be reversed or modified with different methods, with advantages and limitations that are specific for each technique. Here we describe a new strategy that combines the use of chemical epigenetic erasing with mechanosensing-related cues, to generate mammalian pluripotent cells. Two main steps are required. In the first step, adult mature (terminally differentiated) cells are exposed to the epigenetic eraser 5-aza-cytidine to drive them into a pluripotent state. This part of the protocol was developed, based on the increasing understanding of the epigenetic mechanisms controlling cell fate and differentiation, and involves the use of the epigenetic modifier to erase cell differentiated state and then drive into a transient high plasticity window.
In the second step, erased cells are encapsulated in polytetrafluoroethylene (PTFE) micro-bioreactors, also known as Liquid Marbles, to promote 3D cell rearrangement to extend and stably maintain the acquired high plasticity. PTFE is a non-reactive hydrophobic synthetic compound and its use permits the creation of a cellular microenvironment, which cannot be achieved in traditional 2D culture systems. This system encourages and boosts the maintenance of pluripotency though bio-mechanosensing-related cues.
The technical procedures described here are simple strategies to allow for the induction and maintenance of a high plasticity state in adult somatic cells. The protocol allowed the derivation of high plasticity cells in all mammalian species tested. Since it does not involve the use of gene transfection and is free of viral vectors, it may represent a notable technological advance for translational medicine applications. Furthermore, the micro-bioreactor system provides a notable advancement in stem cell organoid technology by in vitro re-creating a specific micro-environment that allows for the long-term culture of high plasticity cells, namely as ESCs, iPSCs, epigenetically erased cells and MSCs.

We here present a method that combines the use of chemical epigenetic erasing with mechanosensing-related cues to efficiently generate mammalian pluripotent cells, without the need of gene transfection or retroviral vectors. This strategy is, therefore, promising for translational medicine and represents a notable advancement in stem cell organoid technology.

Uma estratégia de duas etapas que combina modificação epigenética e sinais biomecânicos para gerar células pluripotentes mamíferas

Cell phenotype can be reversed or modified with different methods, with advantages and limitations that are specific for each technique. Here we describe ...