Este trabalho foi financiado pelo Departamento de Genética, Desenvolvimento e Biologia Celular e Iowa State University e pelo NIH concessão EY024941 (WJ) .dr. Jeffrey Essner fornecida comentários sobre o manuscrito.

Todos os procedimentos com animais estavam de acordo com as orientações dos Institutos Nacionais de Saúde e foram aprovados pelo Comitê Institucional de Animal Care and Use em Iowa State University e da Universidade de Maryland. 1. TALEN projeto <ol><li> Entrada desejada sequência alvo para um site de design TALEN. (Por exemplo: <a href="https://tale-nt.cac.cornell.edu/node/add/talen">https://tale-nt.cac.cornell.edu/node/add/talen</a> ). Entrada escolhida comprimentos de matriz espaçador / repetição. <ol><li> Copie a sequência genómica na caixa chamada &quot;seqüência&quot;. </li><li> Dentro da aba &quot;fornecer personalizado Spacer / RVD Comprimentos&quot;, selecione o comprimento do espaçador e comprimento da matriz. Nota: comprimentos de espaçador de 15 pares de bases e repetir comprimentos de matriz de 15-17 de trabalho bem e fazer a montagem menos complexo. </li></ol></li><li> Escolha um par TALEN. pares TALEN concebidos em torno de um local de enzima de restrição único para permitir a genotipagem por digestão com enzimas de restriçãoum produto de PCR. </li><li> Projeto primers para amplificar a região genômica em torno do local alvo TALEN usando um site como Primer3 30-32. Quando a genotipagem com uma enzima de restrição, de concepção iniciadores para amplificar uma região que contém o local de enzima de restrição de uma única vez. Recomenda-se que esta região é amplificado e sequenciado antes da construção TALEN para identificar quaisquer polimorfismos presentes na A. mexicanus população laboratório para ser usado para microinjecção. </li></ol> 2. Montagem TALEN (modificado a partir do Protocolo TALEN Kit) 33,34 Para obter detalhes adicionais e solução de problemas, consulte o protocolo 34. <ol><li> Preparar e sequenciar os plasmídeos necessários a partir do kit de TALEN de acordo com as instruções do fabricante. </li><li> Configure o # 1 Reacções para as reacções A e B. Incluir repetir-variáveis ​​diresidues (RVDS) 1-10 eo pFUS_A destino vector na Reacção A. Incluir RVDS 11- (N-1) e the destino vector pFUS_B (N-1) na Reacção B, em que N é o número total de RVDS na TALEN. <ol><li> Adicionar a cada reacção: 1 uL de cada um dos plasmídeos contendo cada RVD (100 ng / ul), o vector de destino (100 ng / uL), 1 ul Bsa I da enzima de restrição, 1 ul de Albumina de Soro Bovino (BSA) (2 mg / ml ), 1 ul de ligase, 2 ul de tampão ligase 10x e X ul de água para um volume total de 20 ul. Por exemplo, ver Tabela 1. Nota: Meio reacções também podem ser usados. </li><li> Coloque reacções num termociclador e executar o ciclo: 10x (37 ° C / 5 min + 16 ° C / 10 min) + 50 ° C / 5 min + 80 ° C / 5 min. </li></ol></li><li> Incubam-se as reacções com a nuclease. Para cada reacção de adicionar 1 ul de ATP 25 mM e 1 uL de nuclease. Incubar as reacções a 37 ° C durante 1 h. </li><li> Transformar reações. <ol><li> Transformação com 2,5 ul de cada reacção em 25 ul de células competentes quimicamente. Nota: caseiro c competenteells pode ser usado. No entanto, as células com competência baixa pode resultar em falta de colónias. <ol><li> Misture 2,5 ul da reacção com 25 ul de células competentes quimicamente. Incubar em gelo durante cinco min. Incubam-se as células durante 30 segundos a 42 ° C. </li><li> Colocar os tubos em gelo durante 2 min. Adicionar 125 mL de Super Optimal caldo com repressão catabólica (SOC). Agitar os tubos a 37 ° C durante 1 h. </li></ol></li><li> Placa de 100 ul das células transformadas em placas de LB com espectinomicina (50 ug / ml), X-gal e isopropilo β-D-1-tiogalactopiranósido (IPTG). Cresça O / N a 37 ° C. </li></ol></li><li> Escolha 2-3 colónias brancas para cada reacção e verificar pela colônia PCR usando primers pCR8_F1 e pCR8_R1 (Tabela 2). <ol><li> Faça uma mistura mestre dos reagentes. Por exemplo, ver Tabela 3. </li><li> Escolha uma colônia e manchá-lo no fundo de um tubo PCR, e depois colocar os restos da colônia em 2 ml LB com espectinomicina(50 ug / ml). Colocar 15 ul da mistura principal para dentro do tubo com a colónia. </li><li> Executar o seguinte programa de PCR (Tabela 4) </li><li> Verifique a PCR (executado de todo o volume) num gel de agarose a 1,5% por electroforese. Os clones correctos terão uma banda com o tamanho esperado, bem como uma mancha e uma escada de bandas. Para um exemplo de o esfregaço adequado, consulte 34,33. </li><li> Cresça 2 ml de culturas dos clones correctos em meio LB O / N a 37 ° C numa incubadora com agitação. </li></ol></li><li> Miniprep os plasmídeos de acordo com as instruções do fabricante. </li><li> Sequência de verificar sequência TALEN com pCR8_F1 e pCR8_R1. Siga métodos previamente descritos 35. </li><li> Utilizando os clones correctos verificados por sequenciação, definir-se a reacção # 2 (TALEN kit), que irá colocar os RVDS a partir dos vectores A e B e a RVD final para o vector de destino. <ol><li> Prepare a mistura de reacção 2 (Tabela 5). Nota: Hareacções LF pode ser usado. </li><li> Coloque as reacções num termociclador e executar o seguinte programa: 37 ° C / 10 min + 16 ° C / 15 min + 37 ° C / 15 min + 80 ° C / 5 min. </li></ol></li><li> Transformar reações. <ol><li> Transformação com 2,5 ul de cada reacção em 25 ul de células competentes quimicamente. <ol><li> Misture 2,5 ul da reacção com 25 ul de células competentes quimicamente. Incubar em gelo durante 5 min. Choque térmico das células durante 30 segundos a 42 ° C. </li><li> Colocar os tubos em gelo. Adicionar 125 ul de SOC. Colocar os tubos em um incubador com agitação a 37 ° C durante 1 h. </li></ol></li><li> Placa de 100 ul das células transformadas em placas de LB com ampicilina (100 ug / ml), X-gal e IPTG. Crescer O / N a 37 ° C. </li></ol></li><li> Escolha 1-3 colónias brancas para cada reacção e verificar pela colônia PCR usando primers TAL_F1 e TAL_R2 (Tabela 2). <ol><li> Adicione uma solução do mastermix polimerase, e iniciadores como águadescrita na Tabela 3. Escolher uma colónia e esfregaço-o no fundo de um tubo de PCR, e em seguida colocar os restos da colónia em 2 ml de LB com ampicilina (100 ug / ml). Colocar 15 ul da solução no tubo com a colónia. </li><li> Executar o programa de PCR (Tabela 6). </li><li> Verifique a PCR num gel de agarose a 1,5% por electroforese. Os clones correctos terão um manchas e uma escada de bandas. Para um exemplo de o esfregaço adequado, consulte 34,33. </li><li> Cresça 2 ml de culturas dos clones correctos em meio LB O / N a 37 ° C numa incubadora com agitação. </li></ol></li><li> Miniprep os plasmídeos de acordo com as instruções do fabricante. </li><li> Sequência de verificar sequência TALEN com TAL_F1 e TAL_R2 seguindo os métodos descritos anteriormente 35. </li></ol> 3. A transcrição de ARNm TALENS <ol><li> Digerir 4 ug do modelo verificou-sequência com 2 ul Sac I durante 2 horas a 37 ° C. </li&gt; <li> Executar 2 ul do plasmídeo Sac I digerido num gel de agarose a 1,5% por electroforese. Os plasmídeos que são correctamente digeridos irá exibir uma única banda. </li><li> Purifica-se o plasmídeo restante Sac I digerido seguindo o protocolo do kit de purificação de PCR. Lavar duas vezes com a solução de lavagem antes da eluição. Eluir em 30 mL de água livre de nuclease. </li><li> Siga o protocolo padrão para a produção de mRNA T3. <ol><li> Configurar meias reações usando 0,5 mg de modelo linearizado (preparado acima). Incubar a 37 ° C durante 2 h. </li><li> Adicionar 0,5 ul de ADNase (incluído no estojo) e incubar a 37 ° C durante 15 min. </li></ol></li><li> Purifica-se o ARNm, seguindo as instruções do fabricante. Eluir em 30 de água livre de nuclease ul. </li><li> Executar um gel de agarose a 1,5% por electroforese para verificar o ARNm. <ol><li> Limpar o aparelho de gel com um produto para eliminar a contaminação com RNase e preparar um gel de 1,2%. </li><li> Mix 1 mRNA ul + 4 &amp;# 181; l livre de nuclease de água + 5 jul glioxil carga de corante. Incubar as amostras a 50 ° C durante 30 min. Centrifugar os tubos de forma breve e colocar no gelo antes de executar o gel. </li></ol></li><li> Verifique a concentração, utilizando um método de quantificação de concentrações de ácidos nucleicos e armazenar o ARN em alíquotas a -80 ° C. Escolha um tamanho de alíquota de tal forma que o RNA não está congelado / descongelado mais de uma vez. Nota: As concentrações de 500-1000 ng / nl são tipicamente obtidas. ARN com uma concentração mais baixa pode ser usado, desde que a integridade de ARN é mantida (como avaliado por uma banda em vez de um esfregaço no gel). </li></ol> 4. Inject Astyanax mexicanus embriões com mRNA TALEN <ol><li> Prepare Ferramentas para injecção. <ol><li> Verter em placas de injecção por vazamento de 1,2% de agarose em peixes de água (água condicionada com bicarbonato de sódio e sal do mar para um pH de 7,4 e condutividade de 700 mS) numa placa de Petri. Coloque um molde (pedaço de plástico com as projeções para fazer poços para peixesovos) no interior do prato. Retirar o molde quando a agarose endureceu e armazenar a 4 ° C. Para mais detalhes sobre o molde ver 36. </li><li> Puxar agulhas para injecção, utilizando um extractor de agulha de acordo com as instruções do fabricante. Nota: comprimento da agulha adequada é importante para injectáveis. Agulhas que estão muito tempo vai ser muito flexível para injectáveis. O protocolo para as agulhas que puxam irá variar com o equipamento usado para puxar agulhas. Um exemplo de uma agulha apropriada é mostrado na Figura 1. Para o nosso equipamento, que puxar agulhas que são 5-6 cm de comprimento, e tem um diâmetro externo na ponta de cerca de 0,011 milímetros quando quebrado. No entanto, as agulhas devem ser calibrados (passo 4.3.4) para determinar a largura de abertura. Um programa de exemplo para puxar as agulhas podem ser encontrados na Tabela 7. </li><li> Prepare pipetas de vidro para transferência de embriões por quebrar a pipeta de modo que a abertura é grande o suficiente para um ovo para passar. Inflamar o final quebrado atéele não é mais acentuado. Nota: É importante o uso de pipetas de vidro e taças de vidro quando se trabalha com A. mexicanus ovos embriões e como eles são pegajoso e irá aderir ao plástico. </li></ol></li><li> Recolha 1 de células Stage ovos. <ol><li> Raça A. mexicanus seguindo protocolos convencionais 37. Nota: Por exemplo, se os peixes são mantidos em um 14 luz: ciclo escuro 10 e usando o tempo Zeitgerber (ZT) com ZT0 como luzes acesas e ZT14 como luzes apagadas, a desova de peixes de superfície entre ZT15 e ZT19. época de reprodução exata deve ser determinada para cada laboratório individual. </li><li> Induzir a desova por superalimentação de peixe por 3-4 dias antes do acasalamento e colocando peixe em água doce. Elevar a temperatura ° F 2. Nota: Nossa temperatura inicial da água é de aproximadamente 74 ° F. </li><li> Recolher os ovos de peixes de superfície no escuro, verificando a cada 15 min para obter ovos na fase 1 célula. Centenas de ovos pode ser obtido a partir de um único par de peixes de superfície. </li><li> coletarovos em tigelas de vidro para impedir que adere a superfícies de plástico e tipo, para isolar os embriões na fase de uma célula antes da injecção por meio da observação de ovos sob o microscópio e recolhendo ovos que são de uma única célula. Mantenha os ovos em água doce sistema (água do tanque em que os peixes adultos estão alojados, que foi tratada para pH e condutividade). </li></ol></li><li> Injetar mRNA TALEN. <ol><li> Injectar diferentes quantidades de ARNm total (quantidades iguais de cada TALEN no par) para determinar a concentração óptima para a injecção como toxicidade e eficiência variar por TALEN par. Comece por injecção de concentrações de ARNm total que são 400-800 pg. Dilui-se e combinar ARNm para as concentrações desejadas para a injecção de 1,5 nl. </li><li> Carga diluída ARNm na parte de trás da agulha e colocar a agulha uma micro-injector. </li><li> Quebrar a agulha com a pinça. </li><li> Calibrar a agulha. Por exemplo, ejectar 10 vezes e recolher a queda, resultando em um micro capilar. Para 10 100 x 1,0 descartável81; l, 32 milímetros micro capilar, a gota deve preencher o micro capilar até 0,5 mm para 1,5 nl / 1 injecção. Ajuste o tempo de injeção e pressão conforme necessário. </li><li> Insira a agulha na única célula e injetar o mRNA. Injectar o ARNm directamente para dentro da célula, não na gema. </li><li> Coletar embriões injetados em taças de vidro. Manter os embriões em 23-25 ​​° C. Remover embriões mortos (embriões que se tornam nublado e de forma irregular) regularmente para os primeiros dias após a injecção. Um número recorde de embriões mortos e deformados de controle (não injectada) e as placas injetado. Nota: O aumento da concentração de mRNA pode levar ao aumento da toxicidade e deformidade / morte de embriões. Assim, a toxicidade contra eficiência devem ser equilibradas para determinar a melhor concentração de ARNm para injectar. </li></ol></li></ol> 5. Fenótipo Peixe Fundador e avaliar a eficiência TALEN <ol><li> Sacrificar embriões acordo com o protocolo animais institucional. Nota: Nós eutanásiaembriões de arrefecimento rápido em gelo. </li><li> Coletar embriões em 0,8 ul de PCR tubos tira utilizando uma pipeta de transferência. Nota: A genotipagem pode ser realizada em embriões ou conjuntos de embriões individuais. </li><li> Extrair DNA. <ol><li> Coloque embriões em 100 ul de hidróxido de sódio 50 mM (NaOH) e incubar a 95 ° C durante 30 min, depois arrefece-se a 4 ° C. </li><li> Adicionar 1/10 volume de (10 ul) de Tris-HCl 1 M pH 8. </li></ol></li><li> Realizar uma PCR para a região utilizando os primers desenhados no passo 1.3 (ver Tabelas 8 e 9 para os protocolos de amostra). Para os embriões individuais 1 uL de ADN é suficiente para a reacção de PCR. </li><li> Digerir o produto de PCR resultante, com a enzima de restrição apropriada e correr um gel de agarose a 1,5% por electroforese. <ol><li> Por exemplo, para a genotipagem do locus albinismo oculocutâneo 2 (OCA2) em embriões injectados digerir o produto de RCP, utilizando o enzima de restrição Bsr I por adição de 0.5 Ul de Bsr I directamente a 12,5 uL da reacção de PCR concluída, incubando a 65 ° C durante 2 h. Executar o não digerido e o produto digerido num gel. Bandas resistente a enzimas de restrição (ou seja, as bandas que não digerem) indicam que as mutações induzidas TALEN estão presentes (Figura 2). </li></ol></li><li> (Opcional) Calcular a taxa de mutação percentagem por determinação da percentagem de produto não cortado através da análise de imagens de geles em Fiji 38 usando a ferramenta de análise em gel para calcular o valor de intensidade de cada banda 29, como descrito anteriormente. </li><li> Determinar a sequência de alelos mutantes de clonagem TA por a banda mutante resistente purificado em gel de enzima de restrição e sequenciação de clones. <ol><li> Gel purificar a enzima de restrição banda mutante resistente seguindo as instruções do fabricante. TA clonar a banda seguindo as instruções do fabricante. Escolha colónias e crescer em 1,5 ml de LB O / N a 37 ° C em uma agitaçãoincubadora. </li><li> culturas Miniprep seguindo as instruções do fabricante. Envia o DNA para sequenciamento. </li><li> Usando um programa como o macaco, alinhar as sequências mutantes para a sequência do tipo selvagem. <ol><li> Copiar e colar as duas seqüências em arquivos de macaco. Escolha a opção &quot;Alinhar duas sequências de&quot; ferramenta a partir do menu &quot;Ferramentas&quot;. </li><li> Especificar as duas sequências de ADN usando os menus suspensos. Nota: o complemento reverso da sequência clonada pode precisar de ser utilizado, dependendo do sentido da PCR foi para o vector de clonagem. Se as sequências não se alinham, repita os passos de marcar a caixa &quot;Rev-Com&quot; na caixa &quot;DNA Align&quot;. </li></ol></li></ol></li><li> Avaliar peixes fundador de fenótipos na fase adequada e utilizando métodos adequados para o fenótipo esperado 29 (Por exemplo, a Figura 3). Os métodos de fenotipagem será com base no fenótipo esperado para o gene alvo pelo investigador utilizando a PROTOCol. </li></ol> 6. Tela de transmissão germinal Nota: A. mexicanus atingem a maturidade sexual aos 4-8 meses. <ol><li> Cruzar um peixe fundador sexualmente maduros para o tipo de peixe selvagem. </li><li> Embriões de tela ou peixes adultos usando métodos em passos 5.1-5.7 (Figura 4). Para peixes adultos, um pedaço da cauda pode ser cortada seguinte anesthetization. <ol><li> Anestesiar peixe peixes por submersão numa solução de tricaina (éster etílico do ácido 3-aminobenzóico) para reduzir o stress durante recorte aleta. Seguindo recorte fin, permitir que os peixes para se recuperar em água doce. Peixe recuperar rapidamente; observar até que tenham recuperado (estão nadando normalmente). </li></ol></li></ol>

The authors have nothing to disclose.

Grandes avanços foram feitos nos últimos anos para a compreensão da base genética da evolução dos traços. Embora os genes candidatos subjacentes a evolução de um número de características tem sido identificado, manteve-se um desafio para testar estes genes in vivo, devido à falta de rastreabilidade genética de espécies evolutivamente mais interessantes. Aqui nós relatamos um método para edição genoma em A. mexicanus, espécie usada para estudar a evolução de animais das cavernas. Mapeamento genético estuda 1,21,23 e gene candidato se aproxima 19,40 identificaram um número de genes candidatos para a evolução de traços em forma de caverna de A. mexicanus. A recente publicação do genoma cavefish 41 fornece uma poderosa ferramenta adicional para identificar genes candidatos para a evolução de traços rupestres. Testando a função de muitos destes genes candidatos requer técnicas para reduzir a expressão do gene. A única opção atual para estudoção reduzida expressão do gene em A. mexicanus é através da utilização de morfolinos. No entanto, silenciamento de genes morfolino é transitório, limitado a alguns dias após a fertilização, e não é útil para estudar os traços em animais adultos, tais como diferenças de comportamento entre caverna adulto e peixes de superfície, como escolaridade 17, hiperfagia 19 e atração vibração comportamento 42. Geração de perda de alelos funcionais de genes, tais como aqueles que podem ser feitas usando TALENS, será crítico para testar o papel dos genes candidatos para essas características. Foram desenvolvidos métodos para a fácil montagem de pares TALEN 33 e o protocolo detalhado para este método está disponível 34. Este protocolo foi optimizado para utilização zebrafish por Bedell et al. 7, usando um vetor destino final diferente, pT3Ts-goldyTALEN (pT3TS-GT). Este vector permite a transcrição de ARNm TALEN para injecção em embriões de peixe-zebra unicelulares.Temos utilizado este método de montagem modificada, explicou em detalhes aqui, para montar e transcrever TALENS para injeção em A. mexicanus. Descobrimos que, quando injetado em unicelular superfície A. embriões mexicanus, conforme descrito neste protocolo, pode sofrer mutação A. genes mexicanus 29. Para futuras pesquisas sobre genes candidatos não descritas neste protocolo, as sequências podem ser encontrados no genoma cavefish 41 e usados ​​para identificar locais alvo TALEN. Crítica para injeções de sucesso é TALEN mRNA de alta qualidade. Deste modo, a verificação de qualidade de ARN, executando uma pequena quantidade de ARN num gel, antes da injecção é importante (Passo 3.6). Outras precauções para manter a integridade do RNA, tais como o congelamento de alíquotas para evitar o derretimento freeze (passo 3.7), e manter condições estéreis, utilizando tubos e dicas de água limpa e livre de RNase durante injeções (passo 4), devem ser tomadas. Um passo crítico adicional para a criação de peixes injetado élimpeza de embriões mortos após a injeção, como embriões mortos pode afetar rapidamente a qualidade da água. Assim, nós removemos embriões mortos na manhã seguinte injeções, e periodicamente durante os próximos dias, após as injecções de manter embriões vivos saudáveis ​​(Passo 4.3.6). TALEN mutagênese em mexicanus Astyanax pode ser altamente eficiente; No entanto, a eficiência varia dependendo do par TALEN injectados 29. As concentrações aumentadas de mRNA pode levar ao aumento da toxicidade e deformidade e morte de embriões injetados. Assim, a toxicidade contra eficiência deve ser testado e equilibrada para determinar a concentração óptima de mRNA para injectar. Para pares TALEN altamente eficientes, fenótipos podem ser avaliadas em peixes fundador injetado. Por exemplo, a injecção de TALENS OCA2 segmentação resultou em manchas albinos em peixes de superfície 29 (Figura 3). Para outros traços ou genes, no entanto, a avaliação dos fenótipos em peixes fundador pode ser um desafio devidopara sutilmente do fenótipo ou baixa eficiência do par TALEN injetado. Assim, para muitas aplicações, será desejável para gerar mutações da linha germinativa no gene de interesse para a análise da função de um gene candidato num animal não-mosaico. Obtenção de transmissão da linha germinativa de mutações induzidas por TALEN em A. mexicanus é possível 29 (Figura 4). Assim, esta técnica pode ser aplicada para avaliar outros genes candidatos. Algumas limitações para realizar manipulações genéticas em mexicanus Astyanax existe neste momento. Superfície e raça cavefish no escuro, no final da noite. Em laboratório, onde não é possível inverter o ciclo escuro de luz, os investigadores devem vir em tarde da noite para efectuar injecções, uma vez que é crítico para injectar imediatamente após a desova. Além disso, é importante recolher embriões de peixes de superfície no escuro, como luz afectarão a desova. Outras técnicas, em particuLar o sistema / Cas CRISPR (revisto em 43), existe para edição genoma e será provavelmente aplicável a A. mexicanus. Com efeito, os protocolos para guia de conjunto de ARN que existe são rápida e fácil 44 e o protocolo relatado aqui podem ser modificados para CRISPR injecção / CAS. Além disso, novas aplicações para a edição genoma estão sendo rapidamente desenvolvidos, e muitos deles podem ser úteis para A. pesquisadores mexicanus. Por exemplo, no peixe-zebra mutações precisas foram feitas num gene de interesse por coinjecting TALENS com uma única cadeia de oligo contendo uma mutação 7. Esta técnica pode ser útil para avaliar o papel dos alelos caverna na geração de fenótipos caverna, como o papel de uma mutação missense em determinados alelos caverna de MC4R em diferenças no metabolismo observadas entre cavefish e superfície dos peixes 19. TALENS também foram usadas para gerar alelos de genes através de recombinação homóloga que expressam marcadores fluorescentes in padrões semelhantes ao loci endógenos 45. Estes métodos podem ser utilizados em A. mexicanus para avaliar subconjuntos de células ou a expressão de genes candidatos. O sistema / Cas CRISPR tem sido usado em peixes-zebra para obter específica de tecido do gene knockout 46. Estas técnicas, aplicadas a A. mexicanus, poderia ser útil para avaliar a base genética de processos tais como a perda do olho em cavefish. A lente tem um papel crítico no processo da perda ocular em cavefish 47 e o sistema / Cas CRISPR específico de tecido pode ser usado para avaliar o papel de genes candidatos para a perda do olho, especificamente na lente versus outros tecidos do olho. Estas e outras técnicas de edição de genoma pode ser utilizado em A. mexicanus em estudos futuros para responder a questões críticas sobre a evolução de traços rupestres.

A compreensão da base genética da evolução característica é uma meta pesquisa crítica dos biólogos evolutivos. Um progresso considerável foi feito na identificação de loci subjacentes à evolução dos traços e identificar genes candidatos dentro destes loci (por exemplo 1-3). No entanto, funcionalmente testar o papel destes genes manteve-se como um desafio muitos organismos utilizados para o estudo da evolução de traços não são actualmente tratável geneticamente. O advento das tecnologias de edição genoma aumentou significativamente a manipulabilidade genética de uma larga gama de organismos. Transcrição nucleases-activadores como efectoras (TALENS) e agrupados regularmente interespaçadas palindrï¿½icas repetições curtas (CRISPR) foram usadas para gerar mutações pontuais em genes em vários organismos (por exemplo, 4-11). Essas ferramentas, aplicados a um sistema evolutivamente relevantes, têm o potencial de revolucionar a forma como os biólogos evolucionistas estudar a base genética da evolução. Astyanax mexicanus é uma espécie de peixe que existe em duas formas: a. (Peixe de superfície) forma de superfície-moradia rio e múltiplas formas cavernícolas (cavefish) A. mexicanus cavefish evoluíram a partir de ancestrais peixes de superfície (revisto em 12). Populações de cavefish desenvolveram uma série de características, incluindo a perda dos olhos, diminuição ou perda da pigmentação, aumento do número de papilas gustativas e neuromasts cranianos e alterações no comportamento, como a perda do comportamento de escolaridade, aumento da agressividade, mudanças na alimentação postura e hiperfagia 13 -19. Cavefish e peixes de superfície são interférteis e experimentos de mapeamento genético foram realizados para identificar genes loci e candidatos para características caverna 1,20-26. Alguns genes candidatos foram testados para um papel funcional em contribuir para traços caverna em cultura de células 1,19, em organismos modelo de outras espécies de 21 ou pela superexpressão 27 ou knockdown transitória ucantar morpholinos 28 em A. mexicanus. No entanto, cada um destes métodos tem limitações. A capacidade para gerar alelos mutantes desses genes em A. mexicanus é fundamental para a compreensão de sua função na evolução da cavefish. Assim, A. mexicanus é um organismo candidato ideal para a aplicação de tecnologias de edição genoma. Aqui destacamos um método para edição genoma em A. mexicanus usando TALENS. Este método pode ser utilizado para avaliar mosaico injectado peixe fundador para fenótipos e para o isolamento de linhas de peixes com mutações estáveis ​​em 29 genes de interesse.

<table border="0" cellpadding="0" cellspacing="0" width="573">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Equipment</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Thermocycler</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Injection station</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Gel apparatus</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Needle puller</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Nanodrop</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Supplies</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Note: As far as we know, supplies from different companies can be used unless otherwise indicated</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Golden Gate TALEN and TAL Effector Kit 2.0</td>
			<td style="width:71px;">Addgene</td>
			<td style="width:119px;">Kit #1000000024</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Fisher BioReagents LB Agar, Miller (Granulated)</td>
			<td style="width:71px;">Fisher</td>
			<td style="width:119px;">BP9724-500</td>
			<td></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Fisher BioReagents Microbiology Media: LB Broth, Miller</td>
			<td style="width:71px;">Fisher</td>
			<td style="width:119px;">BP1426-500</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Teknova TET-15 in 50% EtOH</td>
			<td style="width:71px;">Teknova (ordered through Fisher)</td>
			<td style="width:119px;">50-843-314</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Spectinomycin Dihydrochloride, Fisher BioReagents</td>
			<td style="width:71px;">Fisher</td>
			<td style="width:119px;">BP2957-1</td>
			<td></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Super Ampicillin (1000x solution)</td>
			<td style="width:71px;">DNA Technologies</td>
			<td style="width:119px;">6060-1</td>
			<td></td>
		</tr>
		<tr height="147">
			<td height="147" style="height:147px;width:216px;">ThermoScientific X-Gal Solution, ready-to-use</td>
			<td style="width:71px;">Thermo Sci Fermentas Inc (Ordered through Fisher)</td>
			<td style="width:119px;">FERR0941</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">IPTG, Fisher BioReagents</td>
			<td style="width:71px;">Fisher</td>
			<td style="width:119px;">BP1620-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Petri dishes</td>
			<td style="width:71px;">Fisher</td>
			<td style="width:119px;">08-757-13</td>
			<td></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">BsaI</td>
			<td style="width:71px;">New England Biolabs (ordered through Fisher)</td>
			<td style="width:119px;">50-812-203</td>
			<td>Use BsaI, not BsaI-HF (as described in the Golden Gate TALEN and TAL Effector Kit protocol)</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">BSA</td>
			<td style="width:71px;">New England Biolabs</td>
			<td style="width:119px;">provided with restriction enzymes</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">10x T4 ligase buffer</td>
			<td style="width:71px;">Promega (ordered through Fisher)</td>
			<td style="width:119px;">PR-C1263</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">GoTaq Green Master mix</td>
			<td style="width:71px;">Promega (ordered through Fisher)</td>
			<td style="width:119px;">PRM7123</td>
			<td>Other Taq can be used, but the reaction should be adjusted accordingly</td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">Quick ligation kit</td>
			<td style="width:71px;">New England Biolabs (ordered through Fisher)</td>
			<td style="width:119px;">50-811-728</td>
			<td>We use Quick Ligase for all TALEN assembly reactions</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">One Shot TOP10 Chemically Competent E.coli</td>
			<td style="width:71px;">Invitrogen</td>
			<td style="width:119px;">C4040-06</td>
			<td>Other chemically competent cells or homemade competent cells can be used</td>
		</tr>
		<tr height="147">
			<td height="147" style="height:147px;width:216px;">Esp 3I</td>
			<td style="width:71px;">Thermo Sci Fermentas Inc (Ordered through Fisher)</td>
			<td style="width:119px;">FERER0451</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Plasmid-Safe ATP-dependent DNase</td>
			<td style="width:71px;">Epicentre (Ordered through Fisher)</td>
			<td style="width:119px;">NC9046399</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:71px;">Qiagen</td>
			<td align="right" style="width:119px;">27106</td>
			<td>The Qiagen kit should be used for the initial plasmid preparation (as described in the Golden Gate TALEN and TAL Effector Kit protocol)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">QIAquick PCR Purification Kit</td>
			<td style="width:71px;">Qiagen</td>
			<td align="right" style="width:119px;">28104</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">GeneMate LE Quick Dissolve Agaraose</td>
			<td style="width:71px;">BioExpress</td>
			<td style="width:119px;">E-3119-125</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Sac I</td>
			<td style="width:71px;">Promega (Ordered through Fisher)</td>
			<td style="width:119px;">PR-R6061</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">mMESSAGE mMACHINE T3 Transcription kit</td>
			<td style="width:71px;">Ambion</td>
			<td style="width:119px;">AM1348M</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Rneasy MinElute Cleanup Kit</td>
			<td style="width:71px;">Qiagen</td>
			<td align="right" style="width:119px;">74204</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;">NorthernMax-Gly Sample Loading Dye&#160;</td>
			<td style="width:71px;">Ambion (ordered through Fisher)</td>
			<td style="width:119px;">AM8551</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Eliminase</td>
			<td style="width:71px;">Decon (ordered through Fisher)</td>
			<td style="width:119px;">04-355-32</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Fisherbrand Disposable Soda-Lime Glass Pasteur Pipets</td>
			<td style="width:71px;">Fisher</td>
			<td style="width:119px;">13-678-6B</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Standard Glass Capillaries</td>
			<td style="width:71px;">World Precision Instruments</td>
			<td style="width:119px;">1B100-4</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Microcaps</td>
			<td style="width:71px;">Drummond Scientific Company</td>
			<td style="width:119px;">1-000-0010</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Eppendorf Femtotips Microloader Tips for Femtojet Microinjector</td>
			<td style="width:71px;">Eppendorf (ordered through Fisher)</td>
			<td style="width:119px;">E5242956003</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium hydroxide</td>
			<td style="width:71px;">Fisher</td>
			<td style="width:119px;">S318-500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris base</td>
			<td style="width:71px;">Fisher</td>
			<td style="width:119px;">BP152-1</td>
			<td></td>
		</tr>
	</tbody>
</table>

genome editing in astyanax mexicanus using transcription activator-like effector nucleases (talens)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs. Towards this end, much recent work has focused on identifying candidate genes for the evolution of traits in a variety of species. However, until recently it has been challenging to functionally validate interesting candidate genes. Recently developed tools for genetic engineering make it possible to manipulate specific genes in a wide range of organisms. Application of this technology in evolutionarily relevant organisms will allow for unprecedented insight into the role of candidate genes in evolution. Astyanax mexicanus (A. mexicanus) is a species of fish with both surface-dwelling and cave-dwelling forms. Multiple independent lines of cave-dwelling forms have evolved from ancestral surface fish, which are interfertile with one another and with surface fish, allowing elucidation of the genetic basis of cave traits. A. mexicanus has been used for a number of evolutionary studies, including linkage analysis to identify candidate genes responsible for a number of traits. Thus, A. mexicanus is an ideal system for the application of genome editing to test the role of candidate genes. Here we report a method for using transcription activator-like effector nucleases (TALENs) to mutate genes in surface A. mexicanus. Genome editing using TALENs in A. mexicanus has been utilized to generate mutations in pigmentation genes. This technique can also be utilized to evaluate the role of candidate genes for a number of other traits that have evolved in cave forms of A. mexicanus.

TALEN injecções par resultar na ligação dos RVDS aos nucleótidos de ADN específicas e, assim, a dimerização dos domínios FokI, resultando em quebras de cadeia dupla 39, que podem ser reparados através da extremidade não-homóloga de união (NHEJ). NHEJ frequentemente introduz erros que resultam em inserções ou deleções (indels). Indels podem ser identificados através da amplificação da região em torno do local alvo TALEN e digestão do fragmento amplificado resultante com uma enzima de restrição que corta dentro da região espaçadora de TALEN. Os alelos sem um indel irá digerir enquanto alelos contendo indels que alteram a sequência alvo da enzima de restrição não irá digerir, produzindo uma banda resistente à enzima de restrição (Figura 2). Injecções TALEN pode provavelmente resultar em mutações genéticas bialélicos em A. mexicanus 29. Assim, alguns fenótipos podem ser avaliadas em peixes fundador. Para<html> exemplo, nós avaliamos a pigmentação em peixes de superfície injetado com TALENS OCA2 segmentação, o gene hipótese de ser responsável pelo albinismo em várias populações albinos de cavefish 1,28. Encontramos manchas albinos em peixes TALEN-injetada OCA2 não está presente em peixes não injectados 29 (Figura 3). Para muitos ensaios, é desejável dispor de linhas mutantes de peixe para avaliar os fenótipos. Peixes Fundador com alelos mutantes transmissíveis podem ser identificados por genotipagem descendência de cruzamentos de peixes fundador para peixes do tipo selvagem (Figura 4). <img alt="figura 1" src="/files/ftp_upload/54113/54113fig1.jpg" /> Figura 1. agulha para a injecção de ARNm. Fotografia de uma micropipeta antes de ser quebrado usado para injetar mRNA TALEN em embriões unicelulares._upload / 54113 / 54113fig1large.jpg &quot;target =&quot; _ blank &quot;&gt; Clique aqui para ver uma versão maior desta figura. <img alt="Figura 2" src="/files/ftp_upload/54113/54113fig2.jpg" /> Figura 2. A eficiência TALEN para OCA2. 306 pb produtos de PCR a partir de exão 9 de OCA2 em mexicanus Astyanax foram examinadas para a perda do sítio de enzima de restrição quando diferentes quantidades de ARNm TALEN foram injectados 29. O fragmento amplificado a partir de um embrião de controlo foi digerido enquanto uma porção do amplicon era resistente à digestão de restrição nas piscinas de 10 embriões injectados TALEN. Enzima de restrição digerir bandas resistentes a partir de embriões injectados com ARNm alvo TALEN OCA2 foram mostrados para conter indels 29. Note-se que concentrações crescentes de ARNm injectado resulta no aumento da eficiência TALEN (ADN mais não digerido). Lanes com &quot;-&quot; são não digerido, pistas com &quot;+&quot; são Digested com enzima de restrição. <a href="https://www.jove.com/files/ftp_upload/54113/54113fig2large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 3" src="/files/ftp_upload/54113/54113fig3.jpg" /> Figura 3. A fenotipagem peixes fundador de alterações na pigmentação. (A) O controlo não injectado superfície A. mexicanus. (B) Remendo falta melanóforos em um peixe de superfície fundador injectados com 400 pg TALEN mRNA alvo OCA2 (seta). <a href="https://www.jove.com/files/ftp_upload/54113/54113fig3large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 4" src="/files/ftp_upload/54113/54113fig4.jpg" /> Figura 4. transmissão germinal de mutatio induzida TALENns. 306 pb produtos de PCR de exon 9 do OCA2 em A. mexicanus foram examinadas para a perda do sítio de enzima de restrição em piscinas de 10 F um peixe a partir de um peixe fundador injectado. O fragmento amplificado a partir de um embrião de controlo foi digerido enquanto uma porção do amplicon era resistente à digestão de restrição nas piscinas de 10 F 1 embriões. Enzima de restrição digerir bandas resistentes a partir de F OCA2 foram mostrados para conter 1 s indels 29. Lanes com &quot;-&quot; são não digerido, pistas com &quot;+&quot; são digeridos com a enzima de restrição. <a href="https://www.jove.com/files/ftp_upload/54113/54113fig4large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> reacção A </td><td></td><td></td><td> Reactiem B </td><td></td></tr><tr><td> quantidade </td><td> reagente </td><td></td><td> quantidade </td><td> reagente </td></tr><tr><td> 4 ul </td><td> água </td><td></td><td> 10 ul </td><td> água </td></tr><tr><td> 1 ul </td><td> pFUS_A </td><td></td><td> 1 ul </td><td> pFUS_B4 </td></tr><tr><td> 1 ul </td><td> BSAI </td><td></td><td> 1 ul </td><td> BSAI </td></tr><tr><td> 1 ul </td><td> BSA </td><td></td><td> 1 ul </td><td> BSA </td></tr><tr><td> 1 ul </td><td> ligase </td><td></td><td> 1 ul </td><td> ligase </td></tr><tr><td> 2 ul </td><td colspan="2"> de tampão ligase 10X </td><td> 1 ul </td><td> de tampão ligase 10X </td></tr><tr><td> 1 ul </td><td> pNH1 </td><td></td><td> 1 ul </td><td> pNG1 </td></tr><tr><td> 1 ul </td><td> pNH2 </td><td></td><td> 1 ul </td><td> PhD2 </td></tr><tr><td> 1 ul </td><td> pNG3 </td><td></td><td> 1 ul </td><td> pNH3 </td></tr><tr><td> 1 ul </td><td> pHD4 </td><td></td><td> 1 ul </td><td> pNI4 </td></tr><tr><td> 1 ul </td><td> pHD5 </td><td></td><td></td><td></td></tr><tr><td> 1 ul </td><td> PHD6 </td><td></td><td></td><td></td></tr><tr><td> 1 ul </td><td> pNG7 </td><td></td><td></td><td></td></tr><tr><td> 1 ul </td><td> pHD8 </td><td></td><td></td><td></td></tr><tr><td> 1 ul </td><td> pNG9 </td><td></td><td></td><td></td></tr><tr><td> 1 ul </td><td> pHD10 </td><td></td><td></td><td></td></tr></tbody></table> Tabela 1. Exemplo de montagem de reacção A e B para umaTALEN contendo RVDS NH-NH-NG-HD-HD-HD-NG-HD-NG-HD-NG-HD-NH-NI-NG. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> nome do iniciador </td><td> sequência (5&#39;-3 &#39;) </td></tr><tr><td> pCR8_F1 </td><td> ttgatgcctggcagttccct </td></tr><tr><td> pCR8_R1 </td><td> cgaaccgaacaggcttatgt </td></tr><tr><td> TAL_F1 </td><td> ttggcgtcggcaaacagtgg </td></tr><tr><td> TAL_R2 </td><td> ggcgacgaggtggtcgttgg </td></tr></tbody></table> Tabela 2. Os iniciadores de PCR para o PCR de colónias, a partir de 34. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> reagente </td><td> quantidade </td></tr><tr><td> Taq mastermix, 2x </td><td> 50 ul </td></tr><tr><td> pCR8_F1 iniciador,10 uM </td><td> 4 ul </td></tr><tr><td> pCR8_R1 iniciador, 10 uM </td><td> 4 ul </td></tr><tr><td> água livre de nuclease </td><td> 42 ul </td></tr><tr><td colspan="2"> * Ajuste mistura principal se um taq diferente é usado </td></tr></tbody></table> Tabela 3. Mistura de mestre para 100 ul (15 ul / reacção) por PCR de colónias 1. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> passo </td><td> Temperatura (° C) </td><td> tempo (seg) </td></tr><tr><td> 1 </td><td> 95 </td><td> 120 </td></tr><tr><td> 2 </td><td> 95 </td><td> 30 </td></tr><tr><td> 3 </td><td> 55 </td><td> 30 </td></tr><tr><td> 4 </td><td> 72 </td><td> 105 </td></tr><tr><td> 5 </td><td colspan="2"> Vá para o passo 2 para 30 ciclos </td></tr><tr><td> 6 </td><td> 72 </td><td> 300 </td></tr></tbody></table> Programa de PCR Tabela 4. para a colônia PCR 1. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> quantidade </td><td> reagente </td><td> concentração </td></tr><tr><td> 12 ul </td><td> água </td><td></td></tr><tr><td> 1 ul </td><td> vetor A </td><td> 100 ng / ul </td></tr><tr><td> 1 ul </td><td> o vector B </td><td> 100 ng / ul </td></tr><tr><td> 1 ul </td><td> destino vetor pT3Ts-GT </td><td> 50 ng / ul </td></tr><tr><td> 1 ul </td><td> RVD final (PLR-RVD) </td><td> 100 ng / ul </td></tr><tr><td> 1 ul </td><td> Esp3I </td><td></td></tr><tr><td> 1 ul </td><td> ligase </td><td></td></tr><tr><td> 2 ul </td><td colspan="2"> de tampão ligase 10X </td></tr></tbody></table> Tabela 5. Protocolo para reações de segunda montagem. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> passo </td><td> Temperatura (° C) </td><td> tempo (seg) </td></tr><tr><td> 1 </td><td> 95 </td><td> 120 </td></tr><tr><td> 2 </td><td> 95 </td><td> 30 </td></tr><tr><td> 3 </td><td> 55 </td><td> 30 </td></tr><tr><td> 4 </td><td> 72 </td><td> 180 </td></tr><tr><td> 5 </td><td colspan="2"> Vá para o passo 2 para 30 ciclos </td></tr><tr><td> 6 </td><td> 72 </td><td> 300 </td></tr></tbody></table> Tabela programa 6. PCRpara colônia PCR 2. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> calor </td><td> 290 </td></tr><tr><td> puxar </td><td> 150 </td></tr><tr><td> velocidade </td><td> 100 </td></tr><tr><td> Tempo </td><td> 150 </td></tr><tr><td colspan="2"> Estes parâmetros são para um Flaming / Brown Micropipeta Puller Modelo P-97 usando um filamento calha </td></tr></tbody></table> Tabela 7. Exemplo de agulha puxando programa. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> reagente </td><td> quantidade </td></tr><tr><td> Taq mastermix, 2x </td><td> 12,5 ul </td></tr><tr><td> iniciador directo de genes específicos, 10 uM </td><td> 1 μeu </td></tr><tr><td> iniciador de sentido reverso específico do gene, 10 uM </td><td> 1 ul </td></tr><tr><td> água livre de nuclease </td><td> 9,5 ul </td></tr><tr><td> DNA </td><td> 1 ul </td></tr><tr><td colspan="2"> * Ajuste mistura principal se um taq diferente é usado </td></tr></tbody></table> Tabela 8. protocolo de exemplo para PCR específico do gene. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> passo </td><td> Temperatura (° C) </td><td> tempo (seg) </td></tr><tr><td> 1 </td><td> 95 </td><td> 120 </td></tr><tr><td> 2 </td><td> 95 </td><td> 30 </td></tr><tr><td> 3 </td><td> 56 </td><td> 30 </td></tr><tr><td> 4 </td><td> 72 </td><td> 60 </td></tr><tr><td> 5 </td><td colspan="2"> Vá para step 2 para 35 ciclos </td></tr><tr><td> 6 </td><td> 72 </td><td> 300 </td></tr><tr><td colspan="3"> * Ajustar a temperatura de recozimento e tempo de extensão de primers específicos e tamanho do produto PCR </td></tr></tbody></table> Tabela 9. Exemplo de programa de PCR para PCR específico do gene.

Watch this Scientific Journal Video about Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs at JoVE.com

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs

mutagénese de direccionamento de genes é agora possível em uma ampla gama de microrganismos utilizando técnicas de edição genoma. Aqui, nós demonstramos um protocolo para mutagénese gene alvo usando ativador de transcrição como nucleases efetoras (TALENS) em Astyanax mexicanus, uma espécie de peixe que inclui peixes de superfície e cavefish.

Genoma Edição na<em&gt; Mexicanus Astyanax</em&gt; Usando Transcrição Activator-like Effector nucleases (TALENS)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs.  Towards this end, much recent ...

genome-editing-astyanax-mexicanus-using-transcription-activator-like

Nanyang Technological University

Research

JoVE Journal

Biology

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs)

8.2K visualizações.  Iowa State University.  mutagénese de direccionamento de genes é agora possível em uma ampla gama de microrganismos utilizando técnicas de edição genoma. Aqui, nós demonstramos um protocolo para mutagénese gene alvo usando ativador de transcrição como nucleases efetoras (TALENS) em Astyanax mexicanus, uma espécie de peixe que inclui peixes de superfície e cavefish. 

Vídeo: Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs

Imaging Effector Memory T cells in the Ear After Induction of Adoptive DTH

Delayed type hypersensitivity (DTH) is an immune reaction in which the main players are CCR7- effector / memory T lymphocytes. Here, we demonstrate a method for inducing and recording the progress of a DTH reaction in the rat ear. This is followed by a demonstration of the preparation of rat ear tissue for two-photon imaging of the CCR7- effector / memory T cell response.
An adoptive DTH is induced by the intraperitoneal injection of GFP-labeled Ova-specific CCR7- effector / memory T cell line (Beeton, C J. Visualized Experiments, Issue 8). Cells are then allowed to equilibrate in the rat for 48 hours before challenge by injecting one ear with saline (control ear) and the other with a 1:1 mix of Ova and Ova conjugated to Texas-Red (Ova-TR) to allow visualization of resident antigen-presenting cells.
We describe a method of tissue preparation useful for imaging the motility of cells within the deep dermal layer during an immune response, in conjunction with visualization of collagen fibers by second harmonic generation. Ear tissue is cut into 5 x 5 mm squares (slightly larger is better) and mounted onto plastic cover slips using Vetbond&trade;, which are then secured using silicone grease in an imaging chamber and superfused by oxygen-bubbled tissue culture medium at 37&deg;C.

Here we demonstrate a method for inducing and recording the progress of a delayed type-hypersensitivity (DTH) reaction in the rat ear. This is followed by a demonstration of the preparation of rat ear tissue for two-photon imaging of the effector / memory T cell response.

As células de memória efetoras T imagem no ouvido após a indução de DTH Adoptive

Delayed type hypersensitivity (DTH) is an immune reaction in which the main players are CCR7- effector / memory T lymphocytes. Here, we demonstrate a ...

Biologia

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish (Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the cellular and molecular features of the epithelia, which are mainly composed of two types of cells: hair cells (HCs) and supporting cells (SCs). Here we choose to study the inner ear sensory epithelia in adult zebrafish not only because the epithelial structures are highly conserved in all vertebrates studied, but also because the adult zebrafish is able to regenerate HCs, an ability that mammals lose shortly after birth. We use the inner ear of adult zebrafish as a model system to study the mechanisms of inner ear HC regeneration in adult vertebrates that could be helpful for clinical therapy of hearing/balance deficits in human as a result of HC loss.
Here we demonstrate how to do gross and fine dissections of inner ear sensory epithelia in adult zebrafish. The gross dissection removes the tissues surrounding the inner ear and is helpful for preparing tissue sections, which allows us to examine the detailed structure of the sensory epithelia. The fine dissection cleans up the non-sensory-epithelial tissues of each individual epithelium and enables us to examine the heterogeneity of the whole epithelium easily in whole-mount epithelial samples.

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish Danio rerio

The inner ear sensory epithelium of adult zebrafish is a good model system for understanding the mechanisms of hair cell regeneration in adult vertebrates. This protocol demonstrates the fine dissection of the epithelia, through which we can get tissue samples for studying the regenerative events at cellular and subcellular levels.

Dissecação bruta e Multa de Ouvido Interno Epitélio sensorial em adultos Zebrafish ( Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the ...

Detection of Signaling Effector-Complexes Downstream of BMP4 Using in situ PLA, a Proximity Ligation Assay

BMPs are responsible for a wide range of developmental and biological effects. BMP receptors activate (phosphorylate) the Smad1/5/8 effectors, which then, form a complex with Smad4 and translocate to the nucleus where they function as transcription factors to initiate BMP specific downstream effects 1. Traditional immuno-fluorescence techniques with antibodies against phospho-Smad peptides exhibit low sensitivity, high background and offer gross quantification as they rely on intensity of the antibody signal particularly if this is photosensitive fluorescent. In addition, phospho-Smads may not all be in complex with Smad4 and engaged in active transcription.
In situ PLA is a technology capable of detecting protein interactions with high specificity and sensitivity 2-4. This new technology couples antibody recognition with the amplification of DNA surrogate of the protein. It generates a localized, discrete signal in a form of spots revealing the exact position of the recognition event. The number of signals can be counted and compared providing a measurement. We applied in situ PLA, using the Duolink kit, with a combination of antibodies that allows the detection of the BMP signaling effectors phospho-Smad1/5/8 and Smad4 only when these are in proximity i.e. in a complex, which occurs only with signaling activation. This allowed for the first time, the visualization and measurement of endogenous BMP signaling with high specificity and sensitivity in a time course experiment under BMP4 stimulation.

Detection of Signaling Effector-Complexes Downstream of BMP4 Using in situ PLA, a Proximity Ligation Assay

Here we show how to use Proximity Ligation Assay (PLA), with a combination of antibodies to visualize Bone Morphogenetic Protein (BMP) signaling in fixed cells. This technique allowed us to follow the nuclear accumulation of endogenous BMP activated effector-complexes and quantify their levels over time under BMP4 stimulation.

Detecção de Sinalização de Efeitos Complexos Downstream de BMP4 Usando In situ PLA, um Ensaio Ligadura Proximidade

BMPs are responsible for a wide range of developmental and biological effects. BMP receptors activate (phosphorylate) the Smad1/5/8 effectors, which then, ...

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

Genome-wide tela de Metas de miRNA Usando a missão Biblioteca ID Alvo

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Genome Editing with CompoZr Custom Zinc Finger Nucleases (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such as chemical-based mutagenesis or random integration of DNA sequences confer indiscriminate genetic changes in an overall inefficient manner and require incorporation of undesirable synthetic sequences or use of aberrant culture conditions, potentially confusing biological study. By contrast, transient ZFN expression in a cell can facilitate precise, heritable gene editing in a highly efficient manner without the need for administration of chemicals or integration of synthetic transgenes.
Zinc finger nucleases (ZFNs) are enzymes which bind and cut distinct sequences of double-stranded DNA (dsDNA). A functional CompoZr ZFN unit consists of two individual monomeric proteins that bind a DNA "half-site" of approximately 15-18 nucleotides (see Figure 1). When two ZFN monomers "home" to their adjacent target sites the DNA-cleavage domains dimerize and create a double-strand break (DSB) in the DNA.1 Introduction of ZFN-mediated DSBs in the genome lays a foundation for highly efficient genome editing. Imperfect repair of DSBs in a cell via the non-homologous end-joining (NHEJ) DNA repair pathway can result in small insertions and deletions (indels). Creation of indels within the gene coding sequence of a cell can result in frameshift and subsequent functional knockout of a gene locus at high efficiency.2 While this protocol describes the use of ZFNs to create a gene knockout, integration of transgenes may also be conducted via homology-directed repair at the ZFN cut site.
The CompoZr Custom ZFN Service represents a systematic, comprehensive, and well-characterized approach to targeted gene editing for the scientific community with ZFN technology. Sigma scientists work closely with investigators to 1) perform due diligence analysis including analysis of relevant gene structure, biology, and model system pursuant to the project goals, 2) apply this knowledge to develop a sound targeting strategy, 3) then design, build, and functionally validate ZFNs for activity in a relevant cell line. The investigator receives positive control genomic DNA and primers, and ready-to-use ZFN reagents supplied in both plasmid DNA and in-vitro transcribed mRNA format. These reagents may then be delivered for transient expression in the investigator&#x2019;s cell line or cell type of choice. Samples are then tested for gene editing at the locus of interest by standard molecular biology techniques including PCR amplification, enzymatic digest, and electrophoresis. After positive signal for gene editing is detected in the initial population, cells are single-cell cloned and genotyped for identification of mutant clones/alleles.

Genome Editing with CompoZr Custom Zinc Finger Nucleases ZFNs

The CompoZr Custom Zinc-Finger Nuclease (ZFN) Service enables precise genome editing in any organism or cell line at any locus defined by the user. This article describes the process for the design, manufacture, validation and implementation of the CompoZr Custom ZFN Service.

Genoma Edição com CompoZr personalizados Nucleases dedo de zinco (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such ...

Chromatin Interaction Analysis with Paired-End Tag Sequencing (ChIA-PET) for Mapping Chromatin Interactions and Understanding Transcription Regulation

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such architectures are not random and involve interactions between gene promoters and regulatory elements 13. The binding of transcription factors to specific regulatory sequences brings about a network of transcription regulation and coordination 1, 14. 
Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) was developed to identify these higher-order chromatin structures 5,6. Cells are fixed and interacting loci are captured by covalent DNA-protein cross-links. To minimize non-specific noise and reduce complexity, as well as to increase the specificity of the chromatin interaction analysis, chromatin immunoprecipitation (ChIP) is used against specific protein factors to enrich chromatin fragments of interest before proximity ligation. Ligation involving half-linkers subsequently forms covalent links between pairs of DNA fragments tethered together within individual chromatin complexes. The flanking MmeI restriction enzyme sites in the half-linkers allow extraction of paired end tag-linker-tag constructs (PETs) upon MmeI digestion. As the half-linkers are biotinylated, these PET constructs are purified using streptavidin-magnetic beads. The purified PETs are ligated with next-generation sequencing adaptors and a catalog of interacting fragments is generated via next-generation sequencers such as the Illumina Genome Analyzer. Mapping and bioinformatics analysis is then performed to identify ChIP-enriched binding sites and ChIP-enriched chromatin interactions 8. 
We have produced a video to demonstrate critical aspects of the ChIA-PET protocol, especially the preparation of ChIP as the quality of ChIP plays a major role in the outcome of a ChIA-PET library. As the protocols are very long, only the critical steps are shown in the video.

Chromatin Interaction Analysis with Paired-End Tag Sequencing ChIA-PET for Mapping Chromatin Interactions and Understanding Transcription Regulation

Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) is a method for de novo detection of chromatin interactions, for better understanding of transcriptional control.

Cromatina Análise de Interação com Emparelhados Fim-Tag Sequencing (Chia-PET) para mapeamento Interações cromatina e Compreensão regulação da transcrição

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such ...

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present methods for the development of assays to query potentially clinically significant nonsynonymous changes using in vivo complementation in zebrafish. Zebrafish (Danio rerio) are a useful animal system due to their experimental tractability; embryos are transparent to enable facile viewing, undergo rapid development ex vivo, and can be genetically manipulated.1 These aspects have allowed for significant advances in the analysis of embryogenesis, molecular processes, and morphogenetic signaling. Taken together, the advantages of this vertebrate model make zebrafish highly amenable to modeling the developmental defects in pediatric disease, and in some cases, adult-onset disorders. Because the zebrafish genome is highly conserved with that of humans (~70% orthologous), it is possible to recapitulate human disease states in zebrafish. This is accomplished either through the injection of mutant human mRNA to induce dominant negative or gain of function alleles, or utilization of morpholino (MO) antisense oligonucleotides to suppress genes to mimic loss of function variants. Through complementation of MO-induced phenotypes with capped human mRNA, our approach enables the interpretation of the deleterious effect of mutations on human protein sequence based on the ability of mutant mRNA to rescue a measurable, physiologically relevant phenotype. Modeling of the human disease alleles occurs through microinjection of zebrafish embryos with MO and/or human mRNA at the 1-4 cell stage, and phenotyping up to seven days post fertilization (dpf). This general strategy can be extended to a wide range of disease phenotypes, as demonstrated in the following protocol. We present our established models for morphogenetic signaling, craniofacial, cardiac, vascular integrity, renal function, and skeletal muscle disorder phenotypes, as well as others.

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present a systematic approach for developing physiologically relevant, sensitive and specific in vivo assays for interpreting variation in human pathology. Transient genetic manipulation via microinjection of WT and mutant human mRNA and morpholino (MO) antisense oligonucleotides harness the tractability of the developing zebrafish embryo to rapidly assay pathogenic mutations, especially, but not exclusively, in the context of human developmental disorders.

In Vivo Modelagem do Morbid Genoma Humano utilizando Danio rerio

Here,  we present methods for the development of assays to query potentially clinically  significant nonsynonymous changes using in  vivo complementation ...

Mouse Genome Engineering Using Designer Nucleases

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well as for modeling human diseases and testing therapeutic strategies. Recent advances in the use of designer nucleases such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system for site-specific genome engineering open the possibility to perform rapid targeted genome modification in virtually any laboratory species without the need to rely on embryonic stem (ES) cell technology. A genome editing experiment typically starts with identification of designer nuclease target sites within a gene of interest followed by construction of custom DNA-binding domains to direct nuclease activity to the investigator-defined genomic locus. Designer nuclease plasmids are in vitro transcribed to generate mRNA for microinjection of fertilized mouse oocytes. Here, we provide a protocol for achieving targeted genome modification by direct injection of TALEN mRNA into fertilized mouse oocytes.

Designer nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) can be used to modify the genome of mouse preimplantation embryos by triggering both the nonhomologous end joining (NHEJ) and homologous recombination (HR) pathways. These advances enable the rapid generation of mice with precise genetic modifications.

Rato Genoma Engenharia Usando Nucleases Designer

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well ...

Functional Imaging of Viral Transcription Factories Using 3D Fluorescence Microscopy

It is well known that spatial and temporal regulation of genes is an integral part of governing proper gene expression. Consequently, it is invaluable to understand where and when transcription is taking place within nuclear space and to visualize the relationship between episomes infected within the same cell's nucleus. Here, both immunofluorescence (IFA) and RNA-FISH have been combinedto identify actively transcribing Kaposi's sarcoma-associated herpesvirus (KSHV) episomes. By staining KSHV latency-associated nuclear antigen (LANA), it is possible to locate where viral episomes exist within the nucleus. In addition, by designing RNA-FISH probes to target the intron region of a viral gene, which is expressed only during productive infection, nascent RNA transcripts can be located. Using this combination of molecular probes, it is possible to visualize the assembly of large viral transcription factories and analyze the spatial regulation of viral gene expression during KSHV reactivation. By including anti-RNA polymerase II antibody staining, one can also visualize the association between RNA polymerase II (RNAPII) aggregation and KSHV transcription during reactivation.

Viral transcriptional factories are discrete structures that are enriched with cellular RNA polymerase II to increase viral gene transcription during reactivation. Here, a method to locate sites of actively transcribing viral chromatin in 3D nuclear space by a combination of immunofluorescence staining and in situ RNA hybridization is described.

Imagem latente funcional das fábricas de transcrição Viral usando microscopia de fluorescência 3D

It is well known that spatial and temporal regulation of genes is an integral part of governing proper gene expression. Consequently, it is invaluable to ...

Gamete Collection and In Vitro Fertilization of Astyanax mexicanus

Astyanax mexicanus is emerging as a model organism for a variety of research fields in biological science. Part of the recent success of this teleost fish species is that it possesses interfertile cave and river-dwelling populations. This enables the genetic mapping of heritable traits that were fixed during adaptation to the different environments of these populations. While this species can be maintained and bred in the lab, it is challenging to both obtain embryos during the daytime and create hybrid embryos between strains. In vitro fertilization (IVF) has been used with a variety of different model organisms to successfully and repeatedly breed animals in the lab. In this protocol, we show how, by acclimatizing A. mexicanus to different light cycles coupled with changes in water temperature, we can shift breeding cycles to a chosen time of the day. Subsequently, we show how to identify suitable parental fish, collect healthy gametes from males and females, and produce viable offspring using IVF. This enables related procedures such as the injection of genetic constructs or developmental analysis to occur during normal working hours. Furthermore, this technique can be used to create hybrids between the cave and surface-dwelling populations, and thereby enable the study of the genetic basis of phenotypic adaptations to different environments.

Gamete Collection and In Vitro Fertilization of Astyanax mexicanus

In vitro fertilization is a commonly used technique with a variety of model organisms to maintain lab populations and produce synchronized embryos for downstream applications. Here, we present a protocol that implements this technique for different populations of the Mexican tetra fish, Astyanax mexicanus.

Coleção gamete e fertilização in vitro de Astyanax mexicanus

Astyanax mexicanus is emerging as a model organism for a variety of research fields in biological science. Part of the recent success of this teleost fish ...