이 작품은 유전학, 개발 및 세포 생물학 및 아이오와 주립 대학의학과 및 NIH 보조금 EY024941 (WJ) 싱거에 의해 투자되었다. 제프리 Essner는 원고에 대한 의견을 제공했다.

모든 동물의 절차는 국립 보건원 (National Institutes of Health)의 지침에 따라이었고, 아이오와 주립 대학에서 기관 동물 관리 및 사용위원회 및 메릴랜드 대학에 의해 승인되었다. 1. TALEN 디자인 <ol><li> TALEN 디자인 웹 사이트에 입력 원하는 대상 시퀀스. (예 : <a href="https://tale-nt.cac.cornell.edu/node/add/talen">https://tale-nt.cac.cornell.edu/node/add/talen</a> ). 입력 스페이서 / 반복 배열 길이를 선택. <ol><li> &quot;순서&quot;라고 표시된 상자에 게놈 시퀀스를 복사합니다. </li><li> &quot;사용자 지정 스페이서 / RVD 길이를 제공한다&quot;탭에서 스페이서 길이와 배열의 길이를 선택합니다. 참고 : 15 염기쌍의 스페이서 길이 잘 15-17 일의 배열의 길이를 반복하고 조립이 덜 복잡합니다. </li></ol></li><li> TALEN 쌍을 선택합니다. 독특한 제한 효소 부위를 중심으로 설계 TALEN 쌍은 제한 효소에 의해 소화 유전자형이 허용PCR 산물. </li><li> 디자인 된 프라이머에는 Primer3 (30-32)과 같은 웹 사이트를 이용하여 TALEN 대상 부위 주변의 게놈 영역을 증폭한다. 제한 효소 유전자형하면 설계 프라이머 번만 제한 효소 부위를 포함하는 영역을 증폭한다. 이 지역이 증폭되고 A에 존재하는 다형성을 확인하기 TALEN 건설에 앞서 염기 서열을하는 것이 좋습니다 mexicanus 실험실 인구는 미세 주입에 사용되는. </li></ol> 합니다 (TALEN 키트 프로토콜에서 수정) 2. TALEN 조립 33, 34 자세한 내용 및 문제 해결을 위해 프로토콜 34을 참조하십시오. <ol><li> 준비하고 제조업체의 지침에 따라 TALEN 키트에서 필요한 플라스미드 시퀀스. </li><li> 반응 A와 B에 대한 1 반응이 반복 변수 diresidues (RVDS) 1-10과 반응 A의 대상 벡터 pFUS_A는 RVDS를 포함를 11- 포함 # (N-1)과 일을 설정합니다N은 TALEN에 RVDS의 총 개수이다 전자 대상 벡터 pFUS_B 반응 B의 (N-1). <ol><li> 각 반응에 추가 각 RVD (100 NG / μL), 대상 벡터 (100 NG / μL), 1 ㎕의 BSA I 제한 효소 1 ㎕의 소 혈청 알부민 (BSA) (2 ㎎ / ㎖를 함유하는 각각의 플라스미드 1 μL ) 1 μL 리가 20 μl의 총 부피에 대한 물의 μL 배 리가 버퍼 (X)의 2 μL. 예를 들어, 표 1을 참조하십시오. 주 : 하프 반응이 또한 사용될 수있다. </li><li> 열 순환기의 반응을 놓고 사이클 실행 : 10 배 (37 ° C / 5 분 + 16 ° C / 10 분) + 50 ° C / 5 분 + 80 ° C / 5 분. </li></ol></li><li> 클레아 제와 반응을 품어. 각 반응에 1 ㎕의 25 mM의 ATP 1 ㎕를 클레아를 추가합니다. 1 시간 동안 37 ℃에서 반응을 인큐베이션. </li><li> 반응을 변환. <ol><li> 화학적으로 25 μl의 유능한 세포로 각 반응의 2.5 μl를 변환. 참고 : 제 유능한 CELL을 사용할 수있다. 그러나, 낮은 능력을 가진 세포는 식민지의 부족이 발생할 수 있습니다. <ol><li> 화학적 적격 세포를 25 ㎕의 반응물의 2.5 μl를 섞는다. 다섯 분 동안 얼음에서 인큐베이션. 42 ° C에서 30 초 동안 세포를 품어. </li><li> 2 분 동안 얼음에 튜브를 놓습니다. Catabolite 억압 (SOC) 슈퍼 최적 배지 125 μl를 추가합니다. 1 시간 동안 37 ° C에서 튜브를 흔들어. </li></ol></li><li> 접시 스펙 티노 마이신 (50 μg의 / mL)로 LB 플레이트 상에 형질 전환 된 세포를 100 μL, X-gal을 이소 프로필 β-D-1- 티오 갈 락토 피 라노 시드 (IPTG). 37 ° C에서 O / N를 성장. </li></ol></li><li> 각각의 반응 2-3 흰색 식민지를 선택하고 프라이머 pCR8_F1 및 pCR8_R1 (표 2)를 사용하여 식민지 PCR에 의해 확인합니다. <ol><li> 시약의 마스터 믹스를 확인합니다. 예를 들어, 표 3 참조. </li><li> 식민지를 선택하고, PCR 튜브의 바닥으로 얼룩 다음 스펙 티노 마이신과 2 ml의 LB에 식민지의 유물을 넣어(50 μg의 / ㎖). 식민지와 튜브에 마스터 믹스 15 μl를 놓습니다. </li><li> 다음 PCR 프로그램을 실행 (표 4) </li><li> 전기 영동하여 1.5 % 아가 로스 겔에 PCR을 (전체 볼륨을 실행) 확인합니다. 올바른 클론 예상 크기에 밴드뿐만 아니라 비방과 밴드의 사다리를해야합니다. 해당 스미어의 예를 들어, 34,33 참조하십시오. </li><li> 진탕 배양기에서 37 ° C에서 LB 미디어 O / N에서 올바른 클론 2 ㎖ 문화를 성장. </li></ol></li><li> 제조업체의 지시에 따라 플라스미드 미니 프렙. </li><li> 순서 pCR8_F1 및 pCR8_R1과 TALEN 순서를 확인합니다. 앞에서 설명한 방법 (35)을 따릅니다. </li><li> 시퀀싱에 의해 확인 정확한 클론을 사용하여, 대상 벡터에 A 및 B 벡터를 최종 RVD에서 RVDS를 두어 반응 # 2 (TALEN 키트)를 설치했다. <ol><li> 반응 2 (표 5)에 대한 믹스를 준비합니다. 참고 : 하LF 반응이 사용될 수있다. </li><li> 열 순환기의 반응을 놓고 다음 프로그램 실행 : 37 ° C / 10 분 + 16 ° C / 15 분 + 37 ° C / 15 분 + 80 ° C / 5 분. </li></ol></li><li> 반응을 변환. <ol><li> 화학적으로 25 μl의 유능한 세포로 각 반응의 2.5 μl를 변환. <ol><li> 화학적 적격 세포를 25 ㎕의 반응물의 2.5 μl를 섞는다. 5 분 동안 얼음에서 인큐베이션. 열은 42 ℃에서 30 초 동안 세포를 충격. </li><li> 얼음에 튜브를 놓습니다. SOC의 125 μl를 추가합니다. 1 시간 동안 37 ℃에서 진탕 배양기에서 튜브를 놓습니다. </li></ol></li><li> 플레이트 암피실린 (100 μg의 / ㎖), X-여자와 IPTG와 LB 플레이트 상에 형질 전환 세포 100 ㎕. 37 ℃에서 O / N 성장 </li></ol></li><li> 각각의 반응 1-3 흰색 식민지를 선택하고 식민지 PCR 프라이머의 TAL_F1를 사용 TAL_R2 (표 2)에 의해 확인. <ol><li> 중합 효소 mastermix 물 및 프라이머의 용액을표 3에 설명했다. 식민지를 선택하고, PCR 튜브의 바닥으로 얼룩 다음 암피실린 (100 ㎕ / ml)이 2 ml의 LB에 식민지의 유물을 넣어. 식민지와 튜브에 용액 15 μl를 놓습니다. </li><li> PCR을 프로그램 (표 6)를 실행합니다. </li><li> 전기 영동하여 1.5 % 아가 로스 겔에 PCR을 확인합니다. 올바른 클론은 번짐 밴드의 사다리를해야합니다. 해당 스미어의 예를 들어, 34,33 참조하십시오. </li><li> 진탕 배양기에서 37 ° C에서 LB 미디어 O / N에서 올바른 클론 2 ㎖ 문화를 성장. </li></ol></li><li> 제조업체의 지시에 따라 플라스미드 미니 프렙. </li><li> 순서 TAL_F1 및 TAL_R2 앞에서 설명한 방법 (35)을 다음과 같이 TALEN 순서를 확인합니다. </li></ol> TALENs의 3 mRNA의 전사 <ol><li> 37 ° C에서 2 시간 동안 2 μL 골목 I와 순서 검증 된 템플릿의 4 μg의 다이제스트. </리&gt; <li> 전기 영동에 의해 1.5 % 아가 로스 겔에서 골목 I 소화 플라스미드 2 μL를 실행. 제대로 소화 플라스미드는 하나의 밴드가 표시됩니다. </li><li> PCR을 정제 키트 프로토콜 다음 나머지 골목 I-소화 플라스미드를 정제. 용출 전에 세척 용액으로 두 번 세척 하였다. 뉴 클레아 제 무 물 30 μL로 용출. </li><li> T3 mRNA의 생산을위한 표준 프로토콜을 따르십시오. <ol><li> 선형화 된 템플릿의 0.5 μg의를 사용하여 반 반응을 설정합니다 (위의 준비). 2 시간 동안 37 ° C에서 품어. </li><li> DNase의 (키트에 포함)의 0.5 μl를 추가하고 15 분 동안 37 ° C에서 품어. </li></ol></li><li> 제조업체의 지침에 따라 mRNA의 정화. 30 μL 클레아없는 물에 용출. </li><li> mRNA의를 확인하기 위해 전기 영동으로 1.5 % 아가 로스 젤을 실행합니다. <ol><li> 된 RNase 오염을 제거하고 1.2 % 겔을 제조 제품 겔 청소 장치. </li><li> 믹스 1 μL mRNA의 + 4# 181; 리터 클레아없는 물 + 5 ㎕를 glyoxyl 로딩 염료. 30 분 동안 50 ℃에서 샘플을 인큐베이션. 젤을 실행하기 전에 얼음에 원심 분리기 튜브 짧게과 장소. </li></ol></li><li> 핵산 농도의 정량 방법을 사용하여 농도를 검사하고 -80 ℃에서 분취 량으로 RNA를 저장한다. RNA는 / 냉동 번 이상 해동되지 않도록 나누어지는 크기를 선택합니다. 참고 : 500 ~ 1,000 NG의 농도 / NL은 일반적으로 얻을 수있다. RNA의 무결성이 유지되는 (밴드보다는 겔상의 스미어이 정한) 저급 RNA 농도를 오랫동안 사용할 수있다. </li></ol> TALEN의 mRNA 4.를 주입 아 스티 아낙 스 mexicanus 배아 <ol><li> 주입을위한 도구를 준비합니다. <ol><li> 페트리 접시에 생선 물 (중탄산 나트륨과 바다 소금의 pH 7.4와 전도성 700 μS와 에어컨 물)을 1.2 % 아가로 오스를 부어 주사 판을 따르십시오. 물고기 우물을 만들기 위해 돌기 금형 (플라스틱 조각을 배치접시 안에 계란). 4 ° C에서 아가로 오스가 강화했다 금형 및 저장소를 제거합니다. 금형에 대한 자세한 내용은 36를 참조하십시오. </li><li> 제조업체의 지침에 따라 바늘 풀러를 사용하여 주사 바늘을 빼냅니다. 참고 : 적절한 바늘 길이가 주사 중요하다. 너무 긴 바늘은 주사를 너무 유연 할 것입니다. 당기 바늘을위한 프로토콜은 바늘을 당겨하는 데 사용되는 장비에 따라 달라집니다. 적절한 바늘의 일례의 장비를 위해, 우리는 길이 5~6cm이다 바늘을 당긴다.도 1에 도시 한 고장시 약 0.011 mm의 선단부 외경을 가지고있다. 그러나 바늘은 개구 폭을 결정한다 (단계 4.3.4)를 교정해야한다. 바늘을 인상하기위한 예시적인 프로그램 표 7에서 확인할 수있다. </li><li> 달걀이 통과하는 개구부가 충분히 큰 있도록 피펫을 위반하여 배아 전송에 유리 피펫을 준비합니다. 깨진 끝날 때까지 불꽃더 이상 날카로운 없다. 참고 : A. 작업 할 때 유리 피펫과 유리 그릇을 사용하는 것이 중요합니다 mexicanus 계란과 배아는 끈적하고 플라스틱을 준수하므로. </li></ol></li><li> 1 셀 단계 계란을 수집합니다. <ol><li> 품종 A. mexicanus 표준 프로토콜 (37)을 다음과 같습니다. 참고 : 예를 들어, 물고기가 14 불을 유지하는 경우 : 10 어두운주기 및 소등로하고 ZT14 등으로 ZT0와 Zeitgerber 시간 (ZT)를 사용하여, ZT15과 ZT19 사이에 우리의 표면 물고기의 산란. 정확한 산란 시간은 각 실험실에 대해 결정해야합니다. </li><li> 이전 짝짓기 3-4 일 동안 물고기를 과식과 신선한 물에 물고기를 배치하여 산란을 유도한다. 온도 2 °의 F를 올립니다. 참고 : 우리의 초기 수온이 약 74 ° F입니다. </li><li> 1 세포 단계에서 달걀을 얻기 위해 15 분마다 확인, 어둠 속에서 표면 물고기 알을 수집합니다. 계란의 수백 표면 물고기의 한 쌍에서 얻을 수 있습니다. </li><li> 수집유리 그릇에 계란 플라스틱 표면에 부착 방지하고 정렬 현미경으로 알을 관찰하고 단일 셀입니다 계란을 수집하여 사전 주입에 1 세포 단계에서 배아를 분리 할 수​​ 있습니다. (pH와 전도도 처리 된 성인 물고기가 보관되어있는 탱크의 물) 신선한 시스템 물에 계란을 유지합니다. </li></ol></li><li> TALEN의 mRNA를 주입한다. <ol><li> 독성과 효율 TALEN 쌍마다 다를으로 주입을위한 최적의 농도를 측정하는 총 mRNA를 (상기 한 쌍의 각 TALEN 동일한 양)의 상이한 양을 주입한다. 400-800 페이지입니다 전체의 mRNA의 농도를 주입하여 시작합니다. 희석하고 1.5 NL를 분사 목적의 mRNA 농도를 결합한다. </li><li> 로드 바늘의 뒷면에의 mRNA를 희석시키고 마이크로 주사기에 바늘을 연결합니다. </li><li> 집게를 사용하여 바늘 브레이크. </li><li> 바늘을 보정합니다. 예를 들어, 10 회 배출 및 마이크로 모세관의 결과 강하를 수집합니다. 10 × 100 일회용 1.081, L 32 mm 마이크로 모세관, 드롭 1.5 NL / 1 주입 0.5 mm에 마이크로 모세관을 작성해야합니다. 필요에 따라 분사 시간 및 압력을 조정한다. </li><li> 하나의 셀에 바늘을 삽입하고 mRNA를 주입. 하지 노른자로, 셀에 직접 mRNA를 주입한다. </li><li> 유리 그릇에 주입 된 배아를 수집합니다. 23 ~ 25 ℃에서 배아를 유지합니다. 죽은 태아 정기적으로 주입 다음 처음 몇 일 동안 (흐린 및 불규칙한 모양이 될 배아)를 제거합니다. 제어 (uninjected) 및 주입 판에서 죽은 변형 배아의 기록 번호. 참고 : 증가 된 mRNA의 농도가 증가 독성과 태아의 기형 / 죽음으로 이어질 수 있습니다. 따라서, 효율성에 비해 독성은 주입의 mRNA의 최고 농도를 결정하기 위해 균형을 이루어야한다. </li></ol></li></ol> 5. 표현형의 설립자 물고기와 TALEN 효율성 평가 <ol><li> 기관 동물 프로토콜에 따라 배아를 희생. 참고 : 우리는 안락사빠른에 의한 배아 얼음에 냉각. </li><li> 전송 피펫을 사용하여 0.8 μl의 PCR 스트립 튜브로 배아를 수집합니다. 참고 : 유전자형 개별 배아 또는 태아의 풀을 수행 할 수 있습니다. </li><li> DNA의 압축을 풉니 다. <ol><li> 100 ㎕의 50 mM의 수산화 나트륨 (NaOH)와에 장소 배아는 4 ° C까지 다음 냉각, 30 분 동안 95 ° C에서 품어. </li><li> 1 M 트리스 - 염산 pH가 8 1/10 일 볼륨 (10 μL)를 추가합니다. </li></ol></li><li> 단계 1.3에서 디자인 된 프라이머를 (샘플 프로토콜에 대한 표 8 및 9 참조)를 사용하여 영역에 PCR을 수행합니다. 개별 배아를 들어 DNA 1 μL는 PCR 반응에 충분하다. </li><li> 적절한 제한 효소로 생성 된 PCR 생성물을 소화하고 전기 영동하여 1.5 % 아가 로스 겔을 실행. <ol><li> 예를 들면, 주입 된 배아의 oculocutaneous 백색증 2 (oca2) 궤적 유전형에 0을 추가하여 제한 효소 BSR I을 사용하여 PCR 생성물을 소화2 시간 동안 65 ° C에서 배양 완성 된 PCR 반응의 12.5 μL에 BSR 직접 I의 0.5 μL. 소화되지 않은 및 겔에 소화 제품을 실행합니다. 제한 효소 저항 밴드 (즉, 소화되지 않는 밴드) TALEN에 의한 돌연변이가 존재한다 (그림 2) 있음을 나타냅니다. </li></ol></li><li> (선택적) 이전 29 바와 같이 각 밴드의 강도 값을 계산하기 위해 겔 분석 도구를 사용하여 피지 38 겔의 이미지를 분석하여 미가공 생성물의 비율을 측정하여 백분율 돌연변이 비율을 계산한다. </li><li> TA는 겔 정제 제한 효소 내성 돌연변이 밴드를 복제하고 클론을 시퀀싱하여 돌연변이 대립 유전자의 순서를 결정합니다. <ol><li> 젤은 제한이 제조업체의 지침에 따라 내성 돌연변이 밴드 효소 정화. TA는 제조업체의 지침에 따라 밴드를 복제. 식민지를 선택하고 진탕에서 37 ° C에서 1.5 ml의 LB O / N에서 성장부란기. </li><li> 제조업체의 지침에 따라 미니 프렙 문화. 염기 서열의 DNA를 보냅니다. </li><li> 예컨대 APE 같은 프로그램을 이용하여 야생형 서열에 돌연변이 서열 정렬. <ol><li> 복사 및 APE 파일에 두 시퀀스를 붙여 넣습니다. &quot;도구&quot;메뉴에서 &quot;정렬 두 시퀀스&quot;도구를 선택합니다. </li><li> 드롭 다운 메뉴를 사용하여 두 개의 DNA 시퀀스를 지정합니다. 참고 : 복제 된 순서의 반대로 보완이 PCR은 클로닝 벡터에 들어갔다 방향에 따라 사용해야 할 수도 있습니다. 서열이 일치하지 않을 경우, &quot;정렬 DNA&quot;상자에서 &quot;계-COM&quot;확인란을 선택 단계를 반복합니다. </li></ol></li></ol></li><li> 적절한 단계에서 표현형 및 예상 표현형 (29)에 대한 적절한 방법 (예를 들어, 그림 3)를 사용 설립자 물고기를 평가합니다. 표현형의 방법은 protoc를 사용하여 연구원의 대상 유전자의 예상 표현형을 기반으로합니다올. </li></ol> 생식선 전송 6. 화면 참고 : A. mexicanus 4~8개월에서 성적 성숙에 도달. <ol><li> 야생형 물고기에 성적으로 성숙 설립자 물고기를 교차. </li><li> 화면 배아 또는 단계 5.1-5.7의 방법을 사용하여 성인 물고기 (그림 4). 성인 물고기 꼬리의 조각은 마취 다음 잘릴 수 있습니다. <ol><li> 핀 클리핑 동안 응력을 감소시키기 tricaine (3- 아미노 벤조산 에틸 에스테르)의 용액에 침지하여 생선 고기 마취. 핀 클리핑에 따라, 물고기가 민물에 복구 할 수 있습니다. 물고기는 빠르게 회복; 그들은 (일반적으로 수영) 회복 될 때까지 관찰합니다. </li></ol></li></ol>

The authors have nothing to disclose.

커다란 진보는 특성의 전개의 유전 적 기초를 이해 향해 최근에 이루어지고있다. 형질 다수의 진화를 기초 후보 유전자가 확인되었지만, 인해 가장 흥미로운 진화 종의 유전자 취급 용이성의 부족으로 생체 내에서 이들 유전자를 테스트 도전 남아있다. 여기에서 우리는 A의 게놈 편집하는 방법을보고 mexicanus, 종 동굴 동물의 진화를 연구하는 데 사용. 유전자지도는 1,21,23 연구와 후보 유전자 A. 동굴 형태 특성의 진화에 대한 후보 유전자의 숫자를 식별 한 19,40 접근 mexicanus. cavefish 게놈 (41)의 최근 간행물은 동굴 특성의 진화에 대한 후보 유전자를 식별하기위한 추가 강력한 도구를 제공합니다. 이들 후보 유전자의 대부분의 기능을 시험하는 유전자 발현을 감소시키는 기술이 필요하다. 연구를위한 유일한 현재 옵션A의 감소 유전자 발현을 보내고 mexicanus는 morpholinos를 사용하는 것입니다. 그러나, 모르 폴리 노 유전자 최저 몇 일 후 수정 제한, 일시적인, 및 17, 과식증 (19) 및 진동 명소 행동 (42) 학교 교육 등 성인 동굴 및 표면 물고기 사이의 행동 차이와 같은 성인 동물의 특성을 연구하는데 유용하지 않습니다. 이러한 TALENs을 사용하여 제조 될 수 것과 같은 유전자의 대립 유전자 기능의 손실의 발생은 이러한 특징에 대한 후보 유전자의 역할을 테스트하기 위해 중요하다. 방법이 TALEN 쌍 (33)의 쉬운 조립 및이 방법에 대한 자세한 프로토콜 개발 된 것은 34 사용할 수 있습니다. 이 프로토콜이 다른 최종 대상 벡터를 이용하여, 베델 등. (7) 지브라 피쉬에 최적화되었다 pT3Ts-goldyTALEN (pT3TS-GT). 이 벡터는 하나의 단세포 제브라 피쉬 배아에 주입 TALEN의 mRNA의 전사 수 있습니다.우리는 조립하고 A.으로 주입 TALENs을 전사하기 위해, 여기에 상세하게 설명이 수정 조립 방법을 사용했다 mexicanus. 우리는 발견 단세포 표면 A.에 주입 할 때 mexicanus 배아는,이 프로토콜에서 설명 된 바와 같이, 우리는 A를 돌연변이 수 mexicanus 유전자 29. 이 프로토콜에 설명되지 않은 후보 유전자에 대한 향후 연구를 들어, 시퀀스는 41 cavefish 게놈에서 발견 TALEN 목표 위치를 식별하기 위해 사용될 수있다. 성공적인 주사에 대해 긴급 높은 품질 TALEN의 mRNA이다. 그러므로, 주입 전에 겔에서 RNA의 소량을 실행하여 RNA의 품질을 체크하는 것이 중요하고 (스텝 3.6)이다. 동결 해빙를 (3.7 단계) 방지하기 위해 분취 액을 동결하고, 주사 (4 단계) 동안 깨끗한 물과 RNAse가없는 튜브 및 팁을 사용하여 무균 상태를 유지하는 등의 유지 RNA의 무결성을위한 기타주의 사항,주의해야한다. 상승 주입 물고기에 추가 중요한 단계이다죽은 배아 빠르게 수질에 영향을 미칠 수 있으므로, 사출 다음 죽은 배아 청소. 따라서, 우리는 주사를 다음 아침 죽은 태아를 제거하고 정기적으로 다음 몇 일 동안 건강하게 살아있는 배아 (단계 4.3.6)를 유지하기 위해 주사를 다음과 같습니다. 아 스티 아낙 스의 mexicanus에서 TALEN의 돌연변이는 고도로 효율적인 할 수있다; 그러나, 효율은 TALEN 쌍에 따라서 (29)를 주입 달라집니다. 증가 mRNA의 농도가 증가 독성과 기형 및 주입 된 배아의 죽음으로 이어질 수 있습니다. 따라서, 효율성에 비해 독성 시험 및 주입의 mRNA의 최적 농도를 결정하기 위해 균형을 이루어야한다. 고효율 TALEN 쌍의 경우, 표현형은 주입 설립자 물고기에서 평가 될 수있다. 예를 들어, TALENs 대상으로 oca2의 주입은 표면 물고기 29 흰둥이 패치 (그림 3) 결과. 다른 특성 또는 유전자 위해, 그러나, 설립자 물고기의 표현형의 평가로 인해 도전 할 수있다미묘하게 표현형 또는 주입 된 TALEN 쌍의 낮은 효율성이다. 따라서, 많은 응용을 위해 비 모자이크 동물에서의 후보 유전자의 역할의 분석에 관심있는 유전자의 생식 세포 돌연변이를 생성하는 것이 바람직 할 것이다. A.에서 TALEN에 의한 돌연변이의 취득 배아 전송 mexicanus 29 (그림 4) 할 수있다. 따라서,이 기술은 다른 후보 유전자를 평가하기 위해 적용될 수있다. 아 스티 아낙 스의 mexicanus에 유전자 조작을 수행하는 몇 가지 제한이 시간에 존재한다. 표면 늦은 밤 어둠 속에서 cavefish 품종. 이 산란 후 즉시 주입하는 것이 중요합니다으로 빛 어두운주기를 반전 할 수 없습니다 실험실에서 연구자들은, 주사를 수행하기 위해 밤 늦게 와서해야합니다. 빛이 산란에 영향을 미칠 것 같이 또한, 어둠 속에서 표면 물고기 배아를 수집하는 것이 중요하다. 이 특별히 다른 기술,(43에서 검토)에 CRISPR / 카스 시스템을 LAR, 게놈 편집을 위해 존재 가능성 A.에 적용됩니다 mexicanus. 사실, 가이드 RNA 조립 프로토콜은 신속하고 44 쉽게 그 존재 프로토콜은 CRISPR / 카스 주입 수정할 수 있습니다 여기에보고했다. 또한, 게놈 편집을위한 새로운 애플리케이션을 빠르게 개발되고 있으며, 이들의 대부분은 A에 대한 유용 할 수있다 mexicanus 연구원. 예컨대, 제브라 피쉬 정확한 돌연변이 돌연변이 (7)를 포함하는 단일 가닥 올리고으로 TALENs을 coinjecting하여 관심의 유전자를 만들어왔다. 이 기술은 cavefish 및 표면 물고기 (19) 사이에 관찰 신진 대사의 차이에서 MC4R의 특정 동굴 대립 유전자의 과오 돌연변이의 역할과 동굴 표현형을 생성하는 동굴 대립 유전자의 역할을 평가하는 데 유용 할 수 있습니다. TALENs 또한 형광 마커 내가 표현 상동 재조합을 통해 유전자의 대립 유전자를 생성하는 데 사용 된내인성 좌위 (45)와 유사한 n 개의 패턴입니다. 이러한 방법은 A.에 사용될 수있는 mexicanus 세포 또는 후보 유전자의 발현의 하위 집합을 평가합니다. CRISPR / CAS 시스템은 조직 특이 적 유전자 넉 아웃 (46)을 얻기 위해 제브라 사용되고있다. A. 적용이 기술, mexicanus, 이러한 cavefish의 눈 손실과 같은 프로세스의 유전 적 기초를 평가하는 데 도움이 될 수 있습니다. 렌즈 cavefish 47 시력 상실의 과정에서 중요한 역할을하고, 조직 - 특이 CRISPR / CAS 시스템은 특히 눈의 다른 조직에 비해 렌즈 안구 손실 후보 유전자의 역할을 평가하기 위해 사용될 수있다. 이들 및 다른 게놈 편집 기술은 A. 이용 될 수있다 미래 연구에 mexicanus 동굴 특성의 진화에 관한 중요한 질문에 대답합니다.

특성 진화의 유전 적 기초를 이해하는 것은 진화 생물학의 중요한 연구 목표입니다. 상당한 진전이 특성의 진화를 기본 궤적을 확인하고 (실시 예 1-3)이 유전자좌에서의 후보 유전자를 정확히 파악을했다. 그러나, 기능적으로 이들 유전자의 역할 특성의 진화 연구에 사용 된 많은 유기체 도전 유지하고 테스트하는 것은 현재 유전자 취급 용이하지 않다. 게놈 편집 기술의 출현은 크게 유기체의 광범위한 유전 조작성 증가했다. 전사 활성화 제와 같은 이펙터 클레아 (TALENs) 및 클러스터 정기적 interspaced 짧은 반복 팔린 드롬 (CRISPRs)은 (실시 예 4-11) 유기체의 여러 유전자 ​​표적 돌연변이를 생성하기 위해 사용되어왔다. 진화론 관련 시스템에 적용이 도구는, 진화 생물 학자들이 진화의 유전 적 기초를 공부하는 방법을 혁신 할 수있는 잠재력을 가지고. 아 스티 아낙 스의 mexicanus는 두 가지 형태로 존재하는 물고기의 종입니다. 강에 사는 표면 형태 (표면 생선)과 여러 동굴 주거 형태 (cavefish) A. mexicanus의 cavefish은 (12에서 검토) 표면의 물고기 조상에서 진화. cavefish의 인구는 학교 행동의 감소, 증가 침략, 자세와 과식증 (13) 먹이의 변화로 동작 입맛과 두개골 neuromasts, 변화의 수를 증가, 감소 또는 색소 침착의 손실, 눈의 손실을 포함하여 특성의 숫자를 진화 -19. Cavefish 표면 물고기 interfertile, 그리고 유전자지도 실험은 동굴 특성 1,20-26에 대한 궤적 및 후보 유전자를 식별하기 위해 수행되었다. 일부 후보 유전자가 다른 종 (21)의 모델 생물 또는 과발현 27 또는 과도 최저 U에 의해, 세포 배양 1,19에서 동굴의 특성에 기여하는 기능 역할에 대해 테스트되었습니다A.에 morpholinos 28 노래 mexicanus. 그러나, 이러한 각각의 방법은 한계가있다. A. 이러한 유전자의 돌연변이 대립 유전자를 생성 할 수있는 능력 mexicanus는 cavefish의 발전에 그 기능을 이해하는데 중요하다. 따라서, A. mexicanus는 게놈 편집 기술의 응용 프로그램에 대한 이상적인 후보 유기체이다. 여기에서 우리는 A의 게놈 편집하는 방법을 간략하게 설명 mexicanus TALENs를 사용하여. 이 방법은 표현형에 대한 관심 (29)의 유전자 안정 돌연변이 물고기의 라인을 분리하기위한 모자이크 주입 설립자 물고기를 평가하는 데 사용할 수 있습니다.

<table border="0" cellpadding="0" cellspacing="0" width="573">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Equipment</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Thermocycler</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Injection station</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Gel apparatus</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Needle puller</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Nanodrop</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Supplies</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Note: As far as we know, supplies from different companies can be used unless otherwise indicated</td>
			<td style="width:71px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Golden Gate TALEN and TAL Effector Kit 2.0</td>
			<td style="width:71px;">Addgene</td>
			<td style="width:119px;">Kit #1000000024</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Fisher BioReagents LB Agar, Miller (Granulated)</td>
			<td style="width:71px;">Fisher</td>
			<td style="width:119px;">BP9724-500</td>
			<td></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Fisher BioReagents Microbiology Media: LB Broth, Miller</td>
			<td style="width:71px;">Fisher</td>
			<td style="width:119px;">BP1426-500</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Teknova TET-15 in 50% EtOH</td>
			<td style="width:71px;">Teknova (ordered through Fisher)</td>
			<td style="width:119px;">50-843-314</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Spectinomycin Dihydrochloride, Fisher BioReagents</td>
			<td style="width:71px;">Fisher</td>
			<td style="width:119px;">BP2957-1</td>
			<td></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Super Ampicillin (1000x solution)</td>
			<td style="width:71px;">DNA Technologies</td>
			<td style="width:119px;">6060-1</td>
			<td></td>
		</tr>
		<tr height="147">
			<td height="147" style="height:147px;width:216px;">ThermoScientific X-Gal Solution, ready-to-use</td>
			<td style="width:71px;">Thermo Sci Fermentas Inc (Ordered through Fisher)</td>
			<td style="width:119px;">FERR0941</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">IPTG, Fisher BioReagents</td>
			<td style="width:71px;">Fisher</td>
			<td style="width:119px;">BP1620-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Petri dishes</td>
			<td style="width:71px;">Fisher</td>
			<td style="width:119px;">08-757-13</td>
			<td></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">BsaI</td>
			<td style="width:71px;">New England Biolabs (ordered through Fisher)</td>
			<td style="width:119px;">50-812-203</td>
			<td>Use BsaI, not BsaI-HF (as described in the Golden Gate TALEN and TAL Effector Kit protocol)</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">BSA</td>
			<td style="width:71px;">New England Biolabs</td>
			<td style="width:119px;">provided with restriction enzymes</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">10x T4 ligase buffer</td>
			<td style="width:71px;">Promega (ordered through Fisher)</td>
			<td style="width:119px;">PR-C1263</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">GoTaq Green Master mix</td>
			<td style="width:71px;">Promega (ordered through Fisher)</td>
			<td style="width:119px;">PRM7123</td>
			<td>Other Taq can be used, but the reaction should be adjusted accordingly</td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">Quick ligation kit</td>
			<td style="width:71px;">New England Biolabs (ordered through Fisher)</td>
			<td style="width:119px;">50-811-728</td>
			<td>We use Quick Ligase for all TALEN assembly reactions</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">One Shot TOP10 Chemically Competent E.coli</td>
			<td style="width:71px;">Invitrogen</td>
			<td style="width:119px;">C4040-06</td>
			<td>Other chemically competent cells or homemade competent cells can be used</td>
		</tr>
		<tr height="147">
			<td height="147" style="height:147px;width:216px;">Esp 3I</td>
			<td style="width:71px;">Thermo Sci Fermentas Inc (Ordered through Fisher)</td>
			<td style="width:119px;">FERER0451</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Plasmid-Safe ATP-dependent DNase</td>
			<td style="width:71px;">Epicentre (Ordered through Fisher)</td>
			<td style="width:119px;">NC9046399</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:71px;">Qiagen</td>
			<td align="right" style="width:119px;">27106</td>
			<td>The Qiagen kit should be used for the initial plasmid preparation (as described in the Golden Gate TALEN and TAL Effector Kit protocol)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">QIAquick PCR Purification Kit</td>
			<td style="width:71px;">Qiagen</td>
			<td align="right" style="width:119px;">28104</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">GeneMate LE Quick Dissolve Agaraose</td>
			<td style="width:71px;">BioExpress</td>
			<td style="width:119px;">E-3119-125</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Sac I</td>
			<td style="width:71px;">Promega (Ordered through Fisher)</td>
			<td style="width:119px;">PR-R6061</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">mMESSAGE mMACHINE T3 Transcription kit</td>
			<td style="width:71px;">Ambion</td>
			<td style="width:119px;">AM1348M</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Rneasy MinElute Cleanup Kit</td>
			<td style="width:71px;">Qiagen</td>
			<td align="right" style="width:119px;">74204</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;">NorthernMax-Gly Sample Loading Dye&#160;</td>
			<td style="width:71px;">Ambion (ordered through Fisher)</td>
			<td style="width:119px;">AM8551</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Eliminase</td>
			<td style="width:71px;">Decon (ordered through Fisher)</td>
			<td style="width:119px;">04-355-32</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Fisherbrand Disposable Soda-Lime Glass Pasteur Pipets</td>
			<td style="width:71px;">Fisher</td>
			<td style="width:119px;">13-678-6B</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Standard Glass Capillaries</td>
			<td style="width:71px;">World Precision Instruments</td>
			<td style="width:119px;">1B100-4</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Microcaps</td>
			<td style="width:71px;">Drummond Scientific Company</td>
			<td style="width:119px;">1-000-0010</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Eppendorf Femtotips Microloader Tips for Femtojet Microinjector</td>
			<td style="width:71px;">Eppendorf (ordered through Fisher)</td>
			<td style="width:119px;">E5242956003</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium hydroxide</td>
			<td style="width:71px;">Fisher</td>
			<td style="width:119px;">S318-500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris base</td>
			<td style="width:71px;">Fisher</td>
			<td style="width:119px;">BP152-1</td>
			<td></td>
		</tr>
	</tbody>
</table>

genome editing in astyanax mexicanus using transcription activator-like effector nucleases (talens)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs. Towards this end, much recent work has focused on identifying candidate genes for the evolution of traits in a variety of species. However, until recently it has been challenging to functionally validate interesting candidate genes. Recently developed tools for genetic engineering make it possible to manipulate specific genes in a wide range of organisms. Application of this technology in evolutionarily relevant organisms will allow for unprecedented insight into the role of candidate genes in evolution. Astyanax mexicanus (A. mexicanus) is a species of fish with both surface-dwelling and cave-dwelling forms. Multiple independent lines of cave-dwelling forms have evolved from ancestral surface fish, which are interfertile with one another and with surface fish, allowing elucidation of the genetic basis of cave traits. A. mexicanus has been used for a number of evolutionary studies, including linkage analysis to identify candidate genes responsible for a number of traits. Thus, A. mexicanus is an ideal system for the application of genome editing to test the role of candidate genes. Here we report a method for using transcription activator-like effector nucleases (TALENs) to mutate genes in surface A. mexicanus. Genome editing using TALENs in A. mexicanus has been utilized to generate mutations in pigmentation genes. This technique can also be utilized to evaluate the role of candidate genes for a number of other traits that have evolved in cave forms of A. mexicanus.

TALEN 쌍 주사 (NHEJ)를 결합 비 상동 단부를 통해 복구 될 수 이중 가닥 나누기 39의 결과 FokI 따라서 도메인의 이량 체화를 특정 DNA 뉴클레오티드에 RVDS 바인딩을 초래한다. NHEJ 자주 삽입 또는 삭제 (삽입과 삭제)에서 발생하는 오류를 소개합니다. 삽입과 삭제가 TALEN 대상 부위 주변의 영역을 증폭하며 TALEN 스페이서 영역 내에서 절단하는 제한 효소로 생성 된 앰플 리콘 절단함으로써 식별 될 수있다. 대립 유전자는 제한 효소에 강한 밴드를 생성 (도 2) 소화되지 제한 효소 표적 서열을 변경 삽입과 삭제를 포함하면서 INDEL없는 대립 소화한다. TALEN 주사 가능성이 A의 biallelic 유전자 돌연변이가 발생할 수 있습니다 mexicanus 29. 따라서, 일부 표현형은 설립자 물고기에서 평가 될 수있다. 에 대한<html> 예를 들어, 우리는 TALENs 대상으로 oca2, cavefish 1,28의 여러 변종 집단에서 백색증에 대한 책임을 가정하는 유전자를 주입 표면 생선에 색소 침착을 평가 하였다. 우리는 uninjected 물고기 (29) (그림 3)에 존재하지 oca2 TALEN 주입 물고기 흰둥이 패치를 발견했다. 많은 실험을 위해, 표현형을 평가 물고기의 돌연변이 라인을 갖는 것이 바람직하다. 전송 돌연변이 대립 유전자와 설립자 물고기는 야생형 물고기 (그림 4)에 설립자 물고기의 십자가에서 자손 유전형에 의해 식별 될 수있다. <img alt="그림 1" src="/files/ftp_upload/54113/54113fig1.jpg" /> mRNA를 주입 그림 1. 바늘. 이전에 마이크로 피펫의 사진은 하나의 단세포 배아에 TALEN mRNA의 주입에 사용 깨진된다._upload / 54113 / 54113fig1large.jpg &quot;대상 =&quot;_ 빈 &quot;&gt;이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. <img alt="그림 2" src="/files/ftp_upload/54113/54113fig2.jpg" /> TALEN mRNA의 상이한 양이 29을 주사했을 때의 아 스티 아낙 스 mexicanus에서 oca2의 엑손 9에서 Oca2. 306 bp의 PCR 제품도 2 TALEN 효율은 제한 효소 부위의 손실에 대해 조사 하였다. 앰플 리콘의 일부 TALEN 배아 주입 (10)의 풀에 대한 제한 소화 내성 동안 제어 배아로부터 앰플 리콘 소화 하였다. 효소 TALEN의 mRNA를 주입 한 배아에서 저항 밴드를 소화 제한은 oca2가 삽입과 삭제 (29)를 포함하는 것으로 나타났다 대상. 의 mRNA의 증가 농도가 증가 TALEN 효율 (더 소화되지 않은 DNA)의 결과를 주입합니다. &quot;-&quot;와 차선으로 차선을 소화되지 않은있다 &quot;+&quot;diges은테드 제한 효소로. <a href="https://www.jove.com/files/ftp_upload/54113/54113fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/54113/54113fig3.jpg" /> 색소 침착의 변화 그림 3. 표현형의 설립자 물고기입니다. (A) uninjected 표면 A. 제어 mexicanus. (B) 패치 oca2 (화살표)를 대상으로 400 페이지 TALEN mRNA를 주입 설립자면 물고기 melanophores 결여. <a href="https://www.jove.com/files/ftp_upload/54113/54113fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 4" src="/files/ftp_upload/54113/54113fig4.jpg" /> TALEN 유도 mutatio 그림 4. 생식 계열 전송A.에서 oca2의 엑손 9에서 NS. 306 bp의 PCR 제품 mexicanus는 주입 설립자 물고기 10 F 1의 물고기 풀의 제한 효소 사이트의 손실을 조사 하였다. 앰플 리콘 (10)의 일부가 F 한 배아의 풀에 대한 제한 소화 내성 동안 제어 배아로부터 앰플 리콘 소화 하였다. 제한 효소 1 초는 삽입과 삭제 (29)를 포함하는 것으로 나타났다 oca2 F에서 저항 밴드를 소화. 와 레인은 &quot;-&quot; &quot;+&quot;제한 효소로 소화하여, 차선을 소화되지 않은 있습니다. <a href="https://www.jove.com/files/ftp_upload/54113/54113fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 반응 A를 </td><td></td><td></td><td> 를 ReactiB에 </td><td></td></tr><tr><td> 양 </td><td> 시약 </td><td></td><td> 양 </td><td> 시약 </td></tr><tr><td> 4 μL </td><td> 물 </td><td></td><td> 10 μL </td><td> 물 </td></tr><tr><td> 1 μL </td><td> pFUS_A </td><td></td><td> 1 μL </td><td> pFUS_B4 </td></tr><tr><td> 1 μL </td><td> BsaI </td><td></td><td> 1 μL </td><td> BsaI </td></tr><tr><td> 1 μL </td><td> BSA </td><td></td><td> 1 μL </td><td> BSA </td></tr><tr><td> 1 μL </td><td> 리가 </td><td></td><td> 1 μL </td><td> 리가 </td></tr><tr><td> 2 μL </td><td colspan="2"> 10 배 리가 버퍼 </td><td> 1 μL </td><td> 10 배 리가 버퍼 </td></tr><tr><td> 1 μL </td><td> pNH1 </td><td></td><td> 1 μL </td><td> pNG1 </td></tr><tr><td> 1 μL </td><td> pNH2 </td><td></td><td> 1 μL </td><td> PHD2 </td></tr><tr><td> 1 μL </td><td> pNG3 </td><td></td><td> 1 μL </td><td> pNH3 </td></tr><tr><td> 1 μL </td><td> pHD4 </td><td></td><td> 1 μL </td><td> pNI4 </td></tr><tr><td> 1 μL </td><td> pHD5 </td><td></td><td></td><td></td></tr><tr><td> 1 μL </td><td> pHD6 </td><td></td><td></td><td></td></tr><tr><td> 1 μL </td><td> pNG7 </td><td></td><td></td><td></td></tr><tr><td> 1 μL </td><td> pHD8 </td><td></td><td></td><td></td></tr><tr><td> 1 μL </td><td> pNG9 </td><td></td><td></td><td></td></tr><tr><td> 1 μL </td><td> pHD10 </td><td></td><td></td><td></td></tr></tbody></table> A에 대한 표 1 실시 예 반응 어셈블리 A 및 BTALEN 포함 RVDS NH-NH-NG-HD-HD-HD-NG-HD-NG-HD-NG-HD-NH-NI-NG. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 프라이머 이름 </td><td> 서열 (5&#39;-3 &#39;) </td></tr><tr><td> pCR8_F1 </td><td> ttgatgcctggcagttccct </td></tr><tr><td> pCR8_R1 </td><td> cgaaccgaacaggcttatgt </td></tr><tr><td> TAL_F1 </td><td> ttggcgtcggcaaacagtgg </td></tr><tr><td> TAL_R2 </td><td> ggcgacgaggtggtcgttgg </td></tr></tbody></table> (34)로부터 식민지 PCR 표 2. PCR 프라이머. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 시약 </td><td> 양 </td></tr><tr><td> DNA 형성 촉매 mastermix 2 배 </td><td> 50 μL </td></tr><tr><td> pCR8_F1 프라이머,10 μM의 </td><td> 4 μL </td></tr><tr><td> pCR8_R1 프라이머, 10 μM의 </td><td> 4 μL </td></tr><tr><td> 클레아없는 물 </td><td> 42 μL </td></tr><tr><td colspan="2"> 다른 Taq를 사용하는 경우 * 마스터 믹스를 조정 </td></tr></tbody></table> 식민지 100 μL (15 μL / 반응) PCR 1 표 3. 마스터 믹스. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 단계 </td><td> 온도 (° C) </td><td> 시간 (초) </td></tr><tr><td> 1 </td><td> (95) </td><td> (120) </td></tr><tr><td> 이 </td><td> (95) </td><td> (30) </td></tr><tr><td> 삼 </td><td> (55) </td><td> (30) </td></tr><tr><td> 4 </td><td> (72) </td><td> (105) </td></tr><tr><td> (5) </td><td colspan="2"> 30 사이클 2 단계로 이동 </td></tr><tr><td> 6 </td><td> (72) </td><td> (300) </td></tr></tbody></table> 식민지 PCR 1 표 4. PCR 프로그램입니다. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 양 </td><td> 시약 </td><td> 집중 </td></tr><tr><td> 12 μL </td><td> 물 </td><td></td></tr><tr><td> 1 μL </td><td> 벡터 A를 </td><td> 100 NG / μL </td></tr><tr><td> 1 μL </td><td> 벡터 B </td><td> 100 NG / μL </td></tr><tr><td> 1 μL </td><td> 대상 벡터 pT3Ts-GT </td><td> 50 NG / μL </td></tr><tr><td> 1 μL </td><td> 최종 RVD (PLR-RVD) </td><td> 100 NG / μL </td></tr><tr><td> 1 μL </td><td> Esp3I </td><td></td></tr><tr><td> 1 μL </td><td> 리가 </td><td></td></tr><tr><td> 2 μL </td><td colspan="2"> 10 배 리가 버퍼 </td></tr></tbody></table> 두 번째 조립 반응을 표 5. 프로토콜. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 단계 </td><td> 온도 (° C) </td><td> 시간 (초) </td></tr><tr><td> 1 </td><td> (95) </td><td> (120) </td></tr><tr><td> 이 </td><td> (95) </td><td> (30) </td></tr><tr><td> 삼 </td><td> (55) </td><td> (30) </td></tr><tr><td> 4 </td><td> (72) </td><td> (180) </td></tr><tr><td> (5) </td><td colspan="2"> 30 사이클 2 단계로 이동 </td></tr><tr><td> 6 </td><td> (72) </td><td> (300) </td></tr></tbody></table> 표 6. PCR 프로그램식민지 PCR 2. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 열 </td><td> (290) </td></tr><tr><td> 당기다 </td><td> (150) </td></tr><tr><td> 속도 </td><td> (100) </td></tr><tr><td> 시각 </td><td> (150) </td></tr><tr><td colspan="2"> 이러한 매개 변수는 저점 필라멘트를 사용하여 불타는 / 브라운 마이크로 피펫 풀러 모델 P-97입니다 </td></tr></tbody></table> 프로그램을 당겨 표 7. 샘플 바늘. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 시약 </td><td> 양 </td></tr><tr><td> DNA 형성 촉매 mastermix 2 배 </td><td> 12.5 μL </td></tr><tr><td> 유전자 특정 정방향 프라이머, 10 μM </td><td> 1 μ엘 </td></tr><tr><td> 유전자 특정 역방향 프라이머, 10 μM </td><td> 1 μL </td></tr><tr><td> 클레아없는 물 </td><td> 9.5 μL </td></tr><tr><td> DNA </td><td> 1 μL </td></tr><tr><td colspan="2"> 다른 Taq를 사용하는 경우 * 마스터 믹스를 조정 </td></tr></tbody></table> 유전자 특정 PCR 표 8. 샘플 프로토콜입니다. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 단계 </td><td> 온도 (° C) </td><td> 시간 (초) </td></tr><tr><td> 1 </td><td> (95) </td><td> (120) </td></tr><tr><td> 이 </td><td> (95) </td><td> (30) </td></tr><tr><td> 삼 </td><td> (56) </td><td> (30) </td></tr><tr><td> 4 </td><td> (72) </td><td> (60) </td></tr><tr><td> (5) </td><td colspan="2"> s로 이동35 사이클 TEP (2) </td></tr><tr><td> 6 </td><td> (72) </td><td> (300) </td></tr><tr><td colspan="3"> * 특정 프라이머 및 PCR 생성물 크기 어닐링 온도 및 연기 시간을 조정 </td></tr></tbody></table> 유전자 특정 PCR 표 9. 샘플 PCR 프로그램입니다.

Watch this Scientific Journal Video about Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs at JoVE.com

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs

유전자 돌연변이는 유전자 타겟팅 편집 기법을 사용하여 유기체의 광범위한 이제 가능하다. 여기, 우리는 아 스티 아낙 스 mexicanus, 표면 물고기와 cavefish를 포함 물고기의 종 이펙터 뉴 클레아 제 (TALENs) 등의 전사 활성을 이용하여 표적 유전자의 돌연변이 유발을위한 프로토콜을 보여줍니다.

의 게놈 편집<em&gt; 아 스티 아낙 스의 mexicanus</em&gt; 사용 전사 활성제와 같은 이펙터 뉴 클레아 제 (TALENs)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs.  Towards this end, much recent ...

genome-editing-astyanax-mexicanus-using-transcription-activator-like

Nanyang Technological University

Research

JoVE Journal

Biology

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs)

8.2K 조회수.  Iowa State University.  유전자 돌연변이는 유전자 타겟팅 편집 기법을 사용하여 유기체의 광범위한 이제 가능하다. 여기, 우리는 아 스티 아낙 스 mexicanus, 표면 물고기와 cavefish를 포함 물고기의 종 이펙터 뉴 클레아 제 (TALENs) 등의 전사 활성을 이용하여 표적 유전자의 돌연변이 유발을위한 프로토콜을 보여줍니다. 

비디오: Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs

Imaging Effector Memory T cells in the Ear After Induction of Adoptive DTH

Delayed type hypersensitivity (DTH) is an immune reaction in which the main players are CCR7- effector / memory T lymphocytes. Here, we demonstrate a method for inducing and recording the progress of a DTH reaction in the rat ear. This is followed by a demonstration of the preparation of rat ear tissue for two-photon imaging of the CCR7- effector / memory T cell response.
An adoptive DTH is induced by the intraperitoneal injection of GFP-labeled Ova-specific CCR7- effector / memory T cell line (Beeton, C J. Visualized Experiments, Issue 8). Cells are then allowed to equilibrate in the rat for 48 hours before challenge by injecting one ear with saline (control ear) and the other with a 1:1 mix of Ova and Ova conjugated to Texas-Red (Ova-TR) to allow visualization of resident antigen-presenting cells.
We describe a method of tissue preparation useful for imaging the motility of cells within the deep dermal layer during an immune response, in conjunction with visualization of collagen fibers by second harmonic generation. Ear tissue is cut into 5 x 5 mm squares (slightly larger is better) and mounted onto plastic cover slips using Vetbond&trade;, which are then secured using silicone grease in an imaging chamber and superfused by oxygen-bubbled tissue culture medium at 37&deg;C.

Here we demonstrate a method for inducing and recording the progress of a delayed type-hypersensitivity (DTH) reaction in the rat ear. This is followed by a demonstration of the preparation of rat ear tissue for two-photon imaging of the effector / memory T cell response.

입양 DTH의 유도 후 귀에 영상 효과기 메모리 T 세포

Delayed type hypersensitivity (DTH) is an immune reaction in which the main players are CCR7- effector / memory T lymphocytes. Here, we demonstrate a ...

연구

생물학

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish (Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the cellular and molecular features of the epithelia, which are mainly composed of two types of cells: hair cells (HCs) and supporting cells (SCs). Here we choose to study the inner ear sensory epithelia in adult zebrafish not only because the epithelial structures are highly conserved in all vertebrates studied, but also because the adult zebrafish is able to regenerate HCs, an ability that mammals lose shortly after birth. We use the inner ear of adult zebrafish as a model system to study the mechanisms of inner ear HC regeneration in adult vertebrates that could be helpful for clinical therapy of hearing/balance deficits in human as a result of HC loss.
Here we demonstrate how to do gross and fine dissections of inner ear sensory epithelia in adult zebrafish. The gross dissection removes the tissues surrounding the inner ear and is helpful for preparing tissue sections, which allows us to examine the detailed structure of the sensory epithelia. The fine dissection cleans up the non-sensory-epithelial tissues of each individual epithelium and enables us to examine the heterogeneity of the whole epithelium easily in whole-mount epithelial samples.

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish Danio rerio

The inner ear sensory epithelium of adult zebrafish is a good model system for understanding the mechanisms of hair cell regeneration in adult vertebrates. This protocol demonstrates the fine dissection of the epithelia, through which we can get tissue samples for studying the regenerative events at cellular and subcellular levels.

성인 Zebrafish에서 내이 (内耳) 감각 상피 조직의 총과 파인 해부 ( Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the ...

Detection of Signaling Effector-Complexes Downstream of BMP4 Using in situ PLA, a Proximity Ligation Assay

BMPs are responsible for a wide range of developmental and biological effects. BMP receptors activate (phosphorylate) the Smad1/5/8 effectors, which then, form a complex with Smad4 and translocate to the nucleus where they function as transcription factors to initiate BMP specific downstream effects 1. Traditional immuno-fluorescence techniques with antibodies against phospho-Smad peptides exhibit low sensitivity, high background and offer gross quantification as they rely on intensity of the antibody signal particularly if this is photosensitive fluorescent. In addition, phospho-Smads may not all be in complex with Smad4 and engaged in active transcription.
In situ PLA is a technology capable of detecting protein interactions with high specificity and sensitivity 2-4. This new technology couples antibody recognition with the amplification of DNA surrogate of the protein. It generates a localized, discrete signal in a form of spots revealing the exact position of the recognition event. The number of signals can be counted and compared providing a measurement. We applied in situ PLA, using the Duolink kit, with a combination of antibodies that allows the detection of the BMP signaling effectors phospho-Smad1/5/8 and Smad4 only when these are in proximity i.e. in a complex, which occurs only with signaling activation. This allowed for the first time, the visualization and measurement of endogenous BMP signaling with high specificity and sensitivity in a time course experiment under BMP4 stimulation.

Detection of Signaling Effector-Complexes Downstream of BMP4 Using in situ PLA, a Proximity Ligation Assay

Here we show how to use Proximity Ligation Assay (PLA), with a combination of antibodies to visualize Bone Morphogenetic Protein (BMP) signaling in fixed cells. This technique allowed us to follow the nuclear accumulation of endogenous BMP activated effector-complexes and quantify their levels over time under BMP4 stimulation.

효과기 - 단지에게 사용 BMP4의 다운 스트림 신호의 감지 현장에서 괞찮아, 근접 내고 분석

BMPs are responsible for a wide range of developmental and biological effects. BMP receptors activate (phosphorylate) the Smad1/5/8 effectors, which then, ...

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

선교 대상 아이디 라이브러리를 사용하여 miRNA 목표를위한 게놈 - 와이드 스크린

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Genome Editing with CompoZr Custom Zinc Finger Nucleases (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such as chemical-based mutagenesis or random integration of DNA sequences confer indiscriminate genetic changes in an overall inefficient manner and require incorporation of undesirable synthetic sequences or use of aberrant culture conditions, potentially confusing biological study. By contrast, transient ZFN expression in a cell can facilitate precise, heritable gene editing in a highly efficient manner without the need for administration of chemicals or integration of synthetic transgenes.
Zinc finger nucleases (ZFNs) are enzymes which bind and cut distinct sequences of double-stranded DNA (dsDNA). A functional CompoZr ZFN unit consists of two individual monomeric proteins that bind a DNA "half-site" of approximately 15-18 nucleotides (see Figure 1). When two ZFN monomers "home" to their adjacent target sites the DNA-cleavage domains dimerize and create a double-strand break (DSB) in the DNA.1 Introduction of ZFN-mediated DSBs in the genome lays a foundation for highly efficient genome editing. Imperfect repair of DSBs in a cell via the non-homologous end-joining (NHEJ) DNA repair pathway can result in small insertions and deletions (indels). Creation of indels within the gene coding sequence of a cell can result in frameshift and subsequent functional knockout of a gene locus at high efficiency.2 While this protocol describes the use of ZFNs to create a gene knockout, integration of transgenes may also be conducted via homology-directed repair at the ZFN cut site.
The CompoZr Custom ZFN Service represents a systematic, comprehensive, and well-characterized approach to targeted gene editing for the scientific community with ZFN technology. Sigma scientists work closely with investigators to 1) perform due diligence analysis including analysis of relevant gene structure, biology, and model system pursuant to the project goals, 2) apply this knowledge to develop a sound targeting strategy, 3) then design, build, and functionally validate ZFNs for activity in a relevant cell line. The investigator receives positive control genomic DNA and primers, and ready-to-use ZFN reagents supplied in both plasmid DNA and in-vitro transcribed mRNA format. These reagents may then be delivered for transient expression in the investigator&#x2019;s cell line or cell type of choice. Samples are then tested for gene editing at the locus of interest by standard molecular biology techniques including PCR amplification, enzymatic digest, and electrophoresis. After positive signal for gene editing is detected in the initial population, cells are single-cell cloned and genotyped for identification of mutant clones/alleles.

Genome Editing with CompoZr Custom Zinc Finger Nucleases ZFNs

The CompoZr Custom Zinc-Finger Nuclease (ZFN) Service enables precise genome editing in any organism or cell line at any locus defined by the user. This article describes the process for the design, manufacture, validation and implementation of the CompoZr Custom ZFN Service.

CompoZr 맞춤 아연 손가락 Nucleases와 게놈 편집 (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such ...

Chromatin Interaction Analysis with Paired-End Tag Sequencing (ChIA-PET) for Mapping Chromatin Interactions and Understanding Transcription Regulation

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such architectures are not random and involve interactions between gene promoters and regulatory elements 13. The binding of transcription factors to specific regulatory sequences brings about a network of transcription regulation and coordination 1, 14. 
Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) was developed to identify these higher-order chromatin structures 5,6. Cells are fixed and interacting loci are captured by covalent DNA-protein cross-links. To minimize non-specific noise and reduce complexity, as well as to increase the specificity of the chromatin interaction analysis, chromatin immunoprecipitation (ChIP) is used against specific protein factors to enrich chromatin fragments of interest before proximity ligation. Ligation involving half-linkers subsequently forms covalent links between pairs of DNA fragments tethered together within individual chromatin complexes. The flanking MmeI restriction enzyme sites in the half-linkers allow extraction of paired end tag-linker-tag constructs (PETs) upon MmeI digestion. As the half-linkers are biotinylated, these PET constructs are purified using streptavidin-magnetic beads. The purified PETs are ligated with next-generation sequencing adaptors and a catalog of interacting fragments is generated via next-generation sequencers such as the Illumina Genome Analyzer. Mapping and bioinformatics analysis is then performed to identify ChIP-enriched binding sites and ChIP-enriched chromatin interactions 8. 
We have produced a video to demonstrate critical aspects of the ChIA-PET protocol, especially the preparation of ChIP as the quality of ChIP plays a major role in the outcome of a ChIA-PET library. As the protocols are very long, only the critical steps are shown in the video.

Chromatin Interaction Analysis with Paired-End Tag Sequencing ChIA-PET for Mapping Chromatin Interactions and Understanding Transcription Regulation

Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) is a method for de novo detection of chromatin interactions, for better understanding of transcriptional control.

염색질 상호 작용을 매핑 및 전사 규정을 이해하는 데 이점 엔드 태그 장면 (ChIA-PET)과 염색질의 상호 작용 분석

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such ...

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present methods for the development of assays to query potentially clinically significant nonsynonymous changes using in vivo complementation in zebrafish. Zebrafish (Danio rerio) are a useful animal system due to their experimental tractability; embryos are transparent to enable facile viewing, undergo rapid development ex vivo, and can be genetically manipulated.1 These aspects have allowed for significant advances in the analysis of embryogenesis, molecular processes, and morphogenetic signaling. Taken together, the advantages of this vertebrate model make zebrafish highly amenable to modeling the developmental defects in pediatric disease, and in some cases, adult-onset disorders. Because the zebrafish genome is highly conserved with that of humans (~70% orthologous), it is possible to recapitulate human disease states in zebrafish. This is accomplished either through the injection of mutant human mRNA to induce dominant negative or gain of function alleles, or utilization of morpholino (MO) antisense oligonucleotides to suppress genes to mimic loss of function variants. Through complementation of MO-induced phenotypes with capped human mRNA, our approach enables the interpretation of the deleterious effect of mutations on human protein sequence based on the ability of mutant mRNA to rescue a measurable, physiologically relevant phenotype. Modeling of the human disease alleles occurs through microinjection of zebrafish embryos with MO and/or human mRNA at the 1-4 cell stage, and phenotyping up to seven days post fertilization (dpf). This general strategy can be extended to a wide range of disease phenotypes, as demonstrated in the following protocol. We present our established models for morphogenetic signaling, craniofacial, cardiac, vascular integrity, renal function, and skeletal muscle disorder phenotypes, as well as others.

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present a systematic approach for developing physiologically relevant, sensitive and specific in vivo assays for interpreting variation in human pathology. Transient genetic manipulation via microinjection of WT and mutant human mRNA and morpholino (MO) antisense oligonucleotides harness the tractability of the developing zebrafish embryo to rapidly assay pathogenic mutations, especially, but not exclusively, in the context of human developmental disorders.

Danio rerio를 사용하여 병적 인 인간 게놈의 생체 모델링에

Here,  we present methods for the development of assays to query potentially clinically  significant nonsynonymous changes using in  vivo complementation ...

Mouse Genome Engineering Using Designer Nucleases

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well as for modeling human diseases and testing therapeutic strategies. Recent advances in the use of designer nucleases such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 system for site-specific genome engineering open the possibility to perform rapid targeted genome modification in virtually any laboratory species without the need to rely on embryonic stem (ES) cell technology. A genome editing experiment typically starts with identification of designer nuclease target sites within a gene of interest followed by construction of custom DNA-binding domains to direct nuclease activity to the investigator-defined genomic locus. Designer nuclease plasmids are in vitro transcribed to generate mRNA for microinjection of fertilized mouse oocytes. Here, we provide a protocol for achieving targeted genome modification by direct injection of TALEN mRNA into fertilized mouse oocytes.

Designer nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) can be used to modify the genome of mouse preimplantation embryos by triggering both the nonhomologous end joining (NHEJ) and homologous recombination (HR) pathways. These advances enable the rapid generation of mice with precise genetic modifications.

디자이너 클레아 제를 사용하여 마우스 게놈 엔지니어링

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well ...

Functional Imaging of Viral Transcription Factories Using 3D Fluorescence Microscopy

It is well known that spatial and temporal regulation of genes is an integral part of governing proper gene expression. Consequently, it is invaluable to understand where and when transcription is taking place within nuclear space and to visualize the relationship between episomes infected within the same cell's nucleus. Here, both immunofluorescence (IFA) and RNA-FISH have been combinedto identify actively transcribing Kaposi's sarcoma-associated herpesvirus (KSHV) episomes. By staining KSHV latency-associated nuclear antigen (LANA), it is possible to locate where viral episomes exist within the nucleus. In addition, by designing RNA-FISH probes to target the intron region of a viral gene, which is expressed only during productive infection, nascent RNA transcripts can be located. Using this combination of molecular probes, it is possible to visualize the assembly of large viral transcription factories and analyze the spatial regulation of viral gene expression during KSHV reactivation. By including anti-RNA polymerase II antibody staining, one can also visualize the association between RNA polymerase II (RNAPII) aggregation and KSHV transcription during reactivation.

Viral transcriptional factories are discrete structures that are enriched with cellular RNA polymerase II to increase viral gene transcription during reactivation. Here, a method to locate sites of actively transcribing viral chromatin in 3D nuclear space by a combination of immunofluorescence staining and in situ RNA hybridization is described.

기능 이미징 3D 형광 현미경 검사 법을 사용 하 여 바이러스 성 녹음 방송 공장

It is well known that spatial and temporal regulation of genes is an integral part of governing proper gene expression. Consequently, it is invaluable to ...

Gamete Collection and In Vitro Fertilization of Astyanax mexicanus

Astyanax mexicanus is emerging as a model organism for a variety of research fields in biological science. Part of the recent success of this teleost fish species is that it possesses interfertile cave and river-dwelling populations. This enables the genetic mapping of heritable traits that were fixed during adaptation to the different environments of these populations. While this species can be maintained and bred in the lab, it is challenging to both obtain embryos during the daytime and create hybrid embryos between strains. In vitro fertilization (IVF) has been used with a variety of different model organisms to successfully and repeatedly breed animals in the lab. In this protocol, we show how, by acclimatizing A. mexicanus to different light cycles coupled with changes in water temperature, we can shift breeding cycles to a chosen time of the day. Subsequently, we show how to identify suitable parental fish, collect healthy gametes from males and females, and produce viable offspring using IVF. This enables related procedures such as the injection of genetic constructs or developmental analysis to occur during normal working hours. Furthermore, this technique can be used to create hybrids between the cave and surface-dwelling populations, and thereby enable the study of the genetic basis of phenotypic adaptations to different environments.

Gamete Collection and In Vitro Fertilization of Astyanax mexicanus

In vitro fertilization is a commonly used technique with a variety of model organisms to maintain lab populations and produce synchronized embryos for downstream applications. Here, we present a protocol that implements this technique for different populations of the Mexican tetra fish, Astyanax mexicanus.

아스티야낙스 멕시코의 게임테 컬렉션 및 체외 수정

Astyanax mexicanus is emerging as a model organism for a variety of research fields in biological science. Part of the recent success of this teleost fish ...