Gostaríamos de agradecer a Monika Tarnowska, Cornelia Albrecht, e Ewa Skoczylas pela excelente assistência técnica. Este estudo foi financiado pela SNF Sinergia concessão CRSI33-125073 para PP.

<ol>
	<li>Capecchi, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+in+mice:+functional+analysis+of+the+mammalian+genome+for+the+twenty-first+century.">Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century.</a> Nat. Rev. Genetics. 6, 507-512 (2005).</li><li>Johansson, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Building+a+zoo+of+mice+for+genetic+analyses:+a+comprehensive+protocol+for+the+rapid+generation+of+BAC+transgenic+mice.">Building a zoo of mice for genetic analyses: a comprehensive protocol for the rapid generation of BAC transgenic mice.</a> Genesis. 48, 264-280 (2010).</li><li>Skarnes, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conditional+knockout+resource+for+the+genome-wide+study+of+mouse+gene+function.">A conditional knockout resource for the genome-wide study of mouse gene function.</a> Nature. 474, 337-342 (2011).</li><li>Carbery, I. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modification+in+mice+using+zinc-finger+nucleases.">Targeted genome modification in mice using zinc-finger nucleases.</a> Genetics. 186, 451-459 (2010).</li><li>Meyer, M., de Angelis, M. H., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+by+homologous+recombination+in+mouse+zygotes+mediated+by+zinc-finger+nucleases.">Gene targeting by homologous recombination in mouse zygotes mediated by zinc-finger nucleases.</a> Proc. Natl. Acad. Sci. U.S.A. 107, 15022-15026 (2010).</li><li>Cui, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+integration+in+rat+and+mouse+embryos+with+zinc-finger+nucleases.">Targeted integration in rat and mouse embryos with zinc-finger nucleases.</a> Nat. Biotechnol. 29, 64-67 (2011).</li><li>Sung, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knockout+mice+created+by+TALEN-mediated+gene+targeting.">Knockout mice created by TALEN-mediated gene targeting.</a> Nat. Biotechnol. 31, 23-24 (2013).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+production+of+mouse+disease+models+by+embryo+microinjection+of+TALENs+and+oligodeoxynucleotides.">Direct production of mouse disease models by embryo microinjection of TALENs and oligodeoxynucleotides.</a> Proc. Natl. Acad. Sci. U.S.A. 110, 3782-3787 (2013).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-Step+generation+of+mice+carrying+mutations+in+multiple+genes+by+CRISPR/Cas-mediated+genome+engineering.">One-Step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering.</a> Cell. 153, 910-918 (2013).</li><li>Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., Gregory, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+editing+with+engineered+zinc+finger+nucleases.">Genome editing with engineered zinc finger nucleases.</a> Nat. Rev. Genetics. 11, 636-646 (2010).</li><li>ZFN, T. A. L. E. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas-based+methods+for+genome+engineering.">CRISPR/Cas-based methods for genome engineering.</a> Trends Biotechnol. 31, 397-405 (2013).</li><li>Joung, J. K., Sander, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TALENs:+a+widely+applicable+technology+for+targeted+genome+editing.">TALENs: a widely applicable technology for targeted genome editing.</a> Nat. Rev. Mol. Cell Biol. 14, 49-55 (2013).</li><li>Cermak, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+design+and+assembly+of+custom+TALEN+and+other+TAL+effector-based+constructs+for+DNA+targeting.">Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting.</a> Nucleic Acids Res. 39, (2011).</li><li>Reyon, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FLASH+assembly+of+TALENs+for+high-throughput+genome+editing.">FLASH assembly of TALENs for high-throughput genome editing.</a> Nat. Biotechnol. 30, 460-465 (2012).</li><li>Sanjana, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcription+activator-like+effector+toolbox+for+genome+engineering.">A transcription activator-like effector toolbox for genome engineering.</a> Nat. Protoc. 7, 171-192 (2012).</li><li>Kim, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+library+of+TAL+effector+nucleases+spanning+the+human+genome.">A library of TAL effector nucleases spanning the human genome.</a> Nat. Biotechnol. 31, 251-258 (2013).</li><li>Schmid-Burgk, J. L., Schmidt, T., Kaiser, V., Honing, K., Hornung, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ligation-independent+cloning+technique+for+high-throughput+assembly+of+transcription+activator-like+effector+genes.">A ligation-independent cloning technique for high-throughput assembly of transcription activator-like effector genes.</a> Nat. Biotechnol. 31, 76-81 (2013).</li><li>Hsu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+targeting+specificity+of+RNA-guided+Cas9+nucleases.">DNA targeting specificity of RNA-guided Cas9 nucleases.</a> Nat. Biotechnol. 31, 827-832 (2013).</li><li>Fu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+off-target+mutagenesis+induced+by+CRISPR-Cas+nucleases+in+human+cells.">High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.</a> Nat. Biotechnol. 31, 822-826 (2013).</li><li>Hermann, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+OPEN+zinc+finger+nucleases+for+direct+gene+targeting+of+the+ROSA26+locus+in+mouse+embryos.">Evaluation of OPEN zinc finger nucleases for direct gene targeting of the ROSA26 locus in mouse embryos.</a> PLoS ONE. 7, (2012).</li><li>Meyer, M., Ortiz, O., Hrabe de Angelis, M., Wurst, W., Kuhn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+disease+mutations+by+gene+targeting+in+one-cell+mouse+embryos.">Modeling disease mutations by gene targeting in one-cell mouse embryos.</a> Proc. Natl. Acad. Sci. U.S.A. 109, 9354-9359 (2012).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Miller, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+TALE+nuclease+architecture+for+efficient+genome+editing.">A TALE nuclease architecture for efficient genome editing.</a> Nat. Biotechnol. 29, 143-148 (2011).</li><li>Guo, J., Gaj, T., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+an+enhanced+and+highly+efficient+FokI+cleavage+domain+for+zinc+finger+nucleases.">Directed evolution of an enhanced and highly efficient FokI cleavage domain for zinc finger nucleases.</a> J. Mol. Biol. 400, 96-107 (2010).</li><li>Doyon, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancing+zinc-finger-nuclease+activity+with+improved+obligate+heterodimeric+architectures.">Enhancing zinc-finger-nuclease activity with improved obligate heterodimeric architectures.</a> Nat. Methods. 8, 74-79 (2011).</li><li>Wefers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Wefers, B., Wurst, W., K&#252;hn, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Mouse Biology. , (2011).</li><li>Haueter, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+vasectomy-overexpression+of+Prm1-EGFP+fusion+protein+in+elongating+spermatids+causes+dominant+male+sterility+in+mice.">Genetic vasectomy-overexpression of Prm1-EGFP fusion protein in elongating spermatids causes dominant male sterility in mice.</a> Genesis. 48, 151-160 (2010).</li><li>Perez-Pinera, P., Ousterout, D. G., Brown, M. T., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+targeting+to+the+ROSA26+locus+directed+by+engineered+zinc+finger+nucleases.">Gene targeting to the ROSA26 locus directed by engineered zinc finger nucleases.</a> Nucleic Acids Res. 40, 3741-3752 (2012).</li><li>Bultmann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+transcriptional+activation+of+silent+oct4+pluripotency+gene+by+combining+designer+TALEs+and+inhibition+of+epigenetic+modifiers.">Targeted transcriptional activation of silent oct4 pluripotency gene by combining designer TALEs and inhibition of epigenetic modifiers.</a> Nucleic Acids Res. 40, 5368-5377 (2012).</li><li>Valton, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overcoming+TALE+DNA+binding+domain+sensitivity+to+cytosine+methylation.">Overcoming TALE DNA binding domain sensitivity to cytosine methylation.</a> J. Biol. Chem. 287, 38427-38432 (2012).</li><li>Cradick, T. J., Ambrosini, G., Iseli, C., Bucher, P., McCaffrey, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ZFN-Site+searches+genomes+for+zinc+finger+nuclease+target+sites+and+off-target+sites.">ZFN-Site searches genomes for zinc finger nuclease target sites and off-target sites.</a> BMC Bioinform. 12, (2011).</li><li>Doyle, E. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TAL+Effector-Nucleotide+Targeter+(TALE-NT)+2.0:+tools+for+TAL+effector+design+and+target+prediction.">TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction.</a> Nucleic Acids Res. 40, 117-122 (2012).</li><li>Byers, S. L., Payson, S. J., Taft, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+of+ten+inbred+mouse+strains+following+assisted+reproductive+technologies+(ARTs).">Performance of ten inbred mouse strains following assisted reproductive technologies (ARTs).</a> Theriogenology. 65, 1716-1726 (2006).</li><li>Luo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Superovulation+strategies+for+6+commonly+used+mouse+strains.">Superovulation strategies for 6 commonly used mouse strains.</a> J. Am. Assoc. Lab. Animal Sci. 50, 471-478 (2011).</li><li>Pease, S., Saunders, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> International Society for Transgenic Technologies. Advanced protocols for animal transgenesis : an ISTT manual. , (2011).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339, 819-823 (2013).</li><li>Mali, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+human+genome+engineering+via+Cas9.">RNA-Guided human genome engineering via Cas9.</a> Science. 339, 823-826 (2013).</li></ol>

Os autores declaram não haver interesses conflitantes.

Orientada por nuclease Designer genoma abordagens edição estenderam significativamente a gama de espécies passíveis de alterações específicas dos respectivos genomas 10,12. Em ratinhos, em células ES de direccionamento de genes tem sido uma técnica padrão para mais de duas décadas; no entanto, tem sido difícil para se adaptar às células-tronco embrionárias de outros do que o mouse espécies, embora tenha havido algum sucesso recente em ratos células-tronco embrionárias. Mesmo com a disponibilidade de &quot;off-the-shelf&quot; rato ES clones de células alvo de genes fornecidos por consórcios como EUCOMM, KOMP ou NorCOMM 3 genoma edição por ZFN e TALEN proporciona maior precisão e flexibilidade em relação ao espectro de modificações que podem ser introduzida no genoma do rato. Animais fundadores portadores de mutações mediada por nuclease parece ser altamente germe linha competente 4-6,20,21, o que nem sempre é o caso para as quimeras provenientes injecções blastocisto de células ES. Assim, em certos casos, a microinjecção de desnucleases Igner pode resultar em geração significativamente mais rápido de novas linhas de mouse com modificações do genoma direcionados. A geração bem sucedida de camundongos knockout por injeção de ZFN e TALEN depende, em grande medida, da atividade do par nuclease injetado. TALENS tenham demonstrado ter uma elevada taxa de sucesso em atingir uma grande variedade de genes em vários organismos; No entanto, estudos recentes sugerem que a ligação é sensível ao TALEN metilação da citosina 30,31. Assim, os pares de nuclease recém-gerados, por exemplo TALENS clonado em vectores pCAG-T7, pode ser transfectada de forma transiente numa linha de células de rato tais como NIH-3T3 ou Neuro -2a, que imitam o estado da cromatina do embrião de rato, em certa medida. Aqui, a atividade nuclease pode ser estimada utilizando o ensaio endonuclease T7 ou uma restrição resumo de produto de PCR, como descrito na seção 5 antes da síntese de mRNA e microinjeção. Recomendamos seqüenciamento da região genômica de interesse no que diz respeitoive linha celular ea tensão do rato usado para experimentos de microinjeção. Em zigotos murinos, diferentes pares talen ou ZFN funcionará optimamente a diferentes concentrações de mRNA e, por conseguinte, a concentração de trabalho óptima do ARNm de nuclease microinjectado podem ter que ser determinadas experimentalmente. Dependendo do par de nuclease, uma concentração demasiado baixa irá resultar em nenhuma clivagem enquanto demasiado elevada pode resultar na letalidade de embrião. Dependendo do par de nuclease, tivemos sucesso utilizando as concentrações de mRNA total de tão baixas quanto 2 ng / mL e tão alta quanto 200 ug / ul. Estes efeitos são difíceis de prever a partir de experiências em cultura de células e a concentração óptima de nuclease para a sobrevivência do embrião e taxa de alteração do locus alvo precisa de ser determinada empiricamente. ZFN altamente ativa ou TALEN pode unir sua seqüência alvo além do estágio de uma célula do embrião microinjeção e, assim, causar padrões complexos de mutagênese umd mosaicismo em fundadores. Nós e os outros quatro têm observado três ou mais alelos mutantes distintos em um único fundador (Figura 5C). Assim, ao estabelecer uma nova linha de rato a partir desses fundadores, filhos devem ser cuidadosamente selecionados por sequenciamento para a presença da mutação favorável desde que os ensaios de digestão fornecem evidências de que apenas uma mutação indefinido está presente. Uma das críticas frequentemente manifestadas contra os sistemas de ZFN e talen é a possibilidade de que estas nucleases são também capazes de clivagem de sequências presentes em outro lugar no genoma, que são semelhantes aos sítios alvo. Tais efeitos fora do alvo têm sido observados com reagentes primeira geração usando o domínio homodimérico FokI e construções heterodímero foram projetados para aliviar os efeitos fora do alvo 25. Locais fora do alvo potencial podem ser previstos, em certa medida in silico 32,33 e rastreados por PCR e sequenciação. Uma vantagem óbvia of usando ZFNs TALENS e para a geração de ratinhos em vez de linhas de células é a possibilidade de remoção de fora mutações alvo não ligados a modificação do genoma desejado realizando retrocruzamentos a uma estirpe de tipo selvagem de escolha. Para a análise de um grande número de ratinhos progenitores, a próxima geração de profundidade sequenciação dos produtos de PCR gerados a partir do locus alvo de nuclease e in silico previsto fora do alvo loci pode oferecer uma leitura qualitativa e quantitativa alternativa aos ensaios de digestão dos produtos de PCR. As técnicas de reprodução assistida descritos neste protocolo são otimizados para cepas padrão de mouse usados ​​para experimentos de microinjeção, como C57Bl/6J ou B6D2F1. Ratos de diferentes origens, como cepas outbred, pode, em princípio, ser utilizada para abordagens edição do genoma e pode fornecer um fundo genético mais adequado para questões de pesquisa específicas. O desempenho de técnicas de reprodução assistida, como a superovulação pode ser predicted para um número de estirpes de 34-36, mas pode requerer mais de optimização para estirpes diferentes do padrão, a fim de se obter um número suficiente de embriões para nuclease microinjecção. Para além ZFN e TALEN, novas nucleases grife como o sistema CRISPR/Cas9 guiado RNA-9,37,38 foram agora introduzidas para aplicações de edição de genoma. Todos os métodos para a microinjecção e análise de animais fundadores aqui descritas são também aplicáveis ​​aos CRISPR/Cas9 e modos futuros de edição genoma.

Os ratos são, de longe, a plataforma mais popular para a geração de modelos de animais transgênicos. A caixa de ferramentas versáteis para a engenharia genética do embrião de rato 1-3 foi recentemente prorrogado por abordagens edição do genoma com base em nucleases designer, tais como nucleases dedo de zinco (ZFN) 4-6, transcrição nucleases efetoras ativador-like (Talen) 7,8, e os aglomerados regularmente intercaladas repete palindrômicas curtas (CRISPR) / (Cas) 9-associados CRISPR sistema 9. ZFN e função TALEN como pares de dois domínios de design personalizado à base de proteína de ligação a DNA (arrays de proteínas dedo de zinco e repetem-variable di-resíduos (RVDS), respectivamente), que são todos acoplados ao endonuclease FokI 10-12. Por outro lado, a especificidade de clivagem de ADN mediada por Cas9 é fornecido pela transactivação RNAs CRISPR (crRNA e tracrRNA, que também podem ser combinadas numa única molécula de ARN quimérico guia de ARN denominado 11) que age em complexo com oProteína CRISPR. Talens com uma seqüência definida de RVDS podem ser rapidamente construído por pesquisadores individuais, com uma multiplicidade de estratégias de montagem para escolher 13-17. CRISPR/Cas9 promete ainda menor geração de trabalho intensivo de nucleases grife, no entanto, a especificidade da guia de RNA-DNA de ligação ainda não está completamente resolvido 18,19. Geração de ZFNs personalizados até agora tem sido limitado a laboratórios acadêmicos especializados e fornecedores comerciais, como Sangamo Biosciences eo serviço Sigma CompoZr. Em geral, o genoma edição com nucleases grife visa introduzir vertente quebras duplas (DSB) em loci genômico definido, que, posteriormente, atrair final não homóloga juntar (NHEJ) ou recombinação homóloga (HR) máquinas de reparo do DNA 10,12. Reparação NHEJ-mediada de um DSB muitas vezes resulta na introdução de inserções e deleções, em estreita proximidade ao local de reparação. Assim NHEJ reparação cum ser explorada para bater para fora a função de um gene-alvo através da introdução de uma mutação frame-turno dentro do genes codificadores de proteínas seqüência 4,7,9. Alternativamente, a adição ou substituição de informação genética definida podem ser conseguidos proporcionando um doador de ADN em conjunto com as nucleases de design. Um doador de ADN compreende sequências de ADN concebidas para o investigador flanqueadas por regiões de homologia com o locus alvo, servindo assim como um molde para a reparação de DSB por HR. Ambos os plasmídeos 5,6,20 e de fita simples oligonucleotídeos 8,9,21 têm sido utilizados com sucesso como doadores. Nem NHEJ-nor genoma edição mediada por AR exigir a introdução de um marcador seleccionável para o genoma do embrião de rato, o que faz com que essas estratégias particularmente bem adequado para a criação de pequenas alterações na sequência de nucleótidos, sem perturbar a arquitectura genética global. Neste protocolo, descrevemos todos os procedimentos essenciais para a edição de genoma naembrião de rato usando Talens. Estes incluem: 1) identificação de um site de destino TALEN 22, 2) construção de Talens por clonagem Golden Gate 13, 3) síntese in vitro de TALEN mRNA, 4) microinjeção de TALEN mRNA em oócitos de camundongos fertilizados, 5) procedimentos cirúrgicos para transferência de embriões e 6) a análise de mutagénese induzida por TALEN em animais fundadores. Nós nos concentramos em microinjeção TALEN mRNA e triagem dos fundadores para induzidas NHEJ inserções / exclusões. Para este fim, geraram construções talen bifuncionais que permitem tanto a expressão em células de mamíferos quando transfectado como plasmídeos e na síntese in vitro do ARNm TALEN para microinjecção em embriões de ratinho. Estas construções compreendem um backbone CONTO truncado 23 fundido a heterodimeric FokI domínios 24,25 para a edição genoma ideal em células de mamíferos. Este protocolo também pode ser adotado para microinjeção de outras nucleases grife ou por injeções combinadas de nucleases grifee construções doadores (projeto de doadores de DNA tem sido descrita em excelentes publicações técnicas por Wefers et al. 26,27). Declaração de ética Todos os experimentos com animais foram realizados de acordo com as diretrizes e regulamentos do Instituto Cantonal de Veterinária da Cantão de Zurique.

<table border="0" cellpadding="0" cellspacing="0" width="524">
	<colgroup>
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">BsaI</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">R0535S or L</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Esp3I</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">ER0451</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T4 Ligase</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0202S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Spectinomycin</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">S0692-1ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ampicillin&#160;</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">A0166</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">X-Gal</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">B4252</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">IPTG</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">I6758</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Plasmid-Safe nuclease</td>
			<td style="width:111px;">Epicentre</td>
			<td style="width:119px;">E3101K</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">27106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAGEN Plasmid Midi Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">12143</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">QIAquick PCR Purification Kit</td>
			<td style="width:111px;">Qiagen</td>
			<td style="width:119px;">28106</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">mMESSAGE mMACHINE T7 Ultra Kit</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM1345</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NucAway Spin Columns</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM10070</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNaseZAP</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">R2020-250ML</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">NorthernMax Formaldyde Load Dye</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM8552</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNA Millennium Markers</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">AM7150</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">10x TBE buffer</td>
			<td style="width:111px;">Thermo Scientific</td>
			<td style="width:119px;">B52</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">T7 endonuclease</td>
			<td style="width:111px;">NEB</td>
			<td style="width:119px;">M0302S or L</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">pGEM-T EasyVector System I</td>
			<td style="width:111px;">Promega</td>
			<td style="width:119px;">A3600</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">SYBR Green I Nucleic Acid Gel Stain</td>
			<td style="width:111px;">Invitrogen</td>
			<td style="width:119px;">S-7563</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">pregnant mare&#39;s serum gonadotrophin (PMSG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">G4877</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">human chorionic gonadotropin (hCG)</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">CG5</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M2 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7167</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">M16 embryo culture medium</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M7292</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Mineral oil, embryo tested</td>
			<td style="width:111px;">Sigma</td>
			<td style="width:119px;">M8410</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ketamine</td>
			<td style="width:111px;">CentraVet</td>
			<td style="width:119px;">Ket 201</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Xylazine</td>
			<td style="width:111px;">Sigma Aldrich</td>
			<td style="width:119px;">46995</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Equipment/Tools</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Inverted microscope with Nomarski DIC optics (for example Nikon Eclipse TE200)</td>
			<td style="width:111px;">Nikon</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Micromanipulator units (for example Narishige, NT88NF)</td>
			<td style="width:111px;">&#160;Narishige</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo holding capillaries</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;">B100-75-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Embryo injection capillaries</td>
			<td style="width:111px;">Narishige</td>
			<td style="width:119px;">GD-1</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">Capillary puller (for example Sutter P97)</td>
			<td style="width:111px;">Sutter instruments</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Microforge (for example Narishige MF-900)</td>
			<td style="width:111px;">Narishige&#160;</td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Walton skin scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14077-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical scissors</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">14041-10</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Surgical probe</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">10140-03</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clip system (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12031-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Reflex wound clips (9mm)</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">12032-09</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dumont fine forceps 5</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11254-20</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria curvrd forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11370-31</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Moria fine forceps</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">11399-80</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Dietrich bulldog clamp</td>
			<td style="width:111px;">FST</td>
			<td style="width:119px;">18038-45</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Animals</td>
			<td style="width:111px;"></td>
			<td style="width:119px;"></td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">C57BL/6J mice</td>
			<td style="width:111px;">Jackson labs</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
		<tr height="39">
			<td height="39" style="height:39px;width:295px;">CD-1 mice</td>
			<td style="width:111px;">Charles river</td>
			<td style="width:119px;">strain code 000664</td>
		</tr>
	</tbody>
</table>

mouse genome engineering using designer nucleases

Camundongos transgênicos portadores modificações específicas do local do genoma (ko, batida-in) são de vital importância para dissecar sistemas biológicos complexos, bem como para a modelagem de doenças humanas e testar estratégias terapêuticas. Os recentes avanços no uso de nucleases de designer, tais como nucleases dedo de zinco (ZFNs), ativador de transcrição-como nucleases efetoras (Talens), e os aglomerados se repete regularmente palindrômicas curtas intercaladas (CRISPR) / (CAS) associada à CRISPR 9 sistema para o local- engenharia genoma específico em aberto a possibilidade de realizar rápida modificação do genoma segmentado em praticamente qualquer espécie de laboratório, sem a necessidade de contar com caule embrionárias (ES) tecnologia celular. Uma edição experimento genoma tipicamente inicia-se com a identificação de locais alvo de nuclease designer dentro de um gene de interesse, seguido por construção de domínios de ligação de ADN personalizados para dirigir a actividade de nuclease para o locus genómico definido pelo investigador. Plasmídeos nuclease Designer são in vitro &lt;/ Em&gt; transcrito para gerar mRNA para microinjeção de oócitos fertilizados de camundongo. Aqui, nós fornecemos um protocolo para alcançar a modificação do genoma alvo de injeção direta de TALEN mRNA em oócitos fertilizados de camundongo.

Foram construídos plasmídeos de destino compatível com o conjunto de Ouro GateTALEN publicado por 13 Cermak et al. Que permitem a expressão de TALENS em células de mamíferos, bem como a síntese in vitro de ARNm a partir do promotor do fago T7 (Figura 1C). Estes plasmídeos carregam domínios FokI heterodiméricos (ELD ou KKR mutações) que foram mostrados para reduzir fora do alvo efeitos relativos ao homodímeros FokI e aumentar a atividade clivagem em relação a primeira geração FokI heterodímeros 25,29. As reacções de montagem Golden Gate # 1 e # 2 são geralmente muito eficiente e cada colónia branca, quando analisados ​​por PCR de colónias, mostra o padrão esperado para o número particular de RVDS clonados (Figuras 1B e 1D). A análise em gel de ARNm sintetizada in vitro (Figura 2) deverá revelar uma única banda distinguíveis com pouca ou nenhuma mancha para cada amostra analisada. Deve haver uma mudança clara de tamanho entre amostras L1/R1 e L2/R2, L3/R3, que indica poliadenilação sucesso. Animais fundadores podem ser rastreados para alelos mutantes induzidos por NHEJ genotipagem utilizando PCR seguido por digestão com endonuclease de T7 (Figura 3) ou de uma digestão de restrição com uma enzima que cliva a sequência de tipo selvagem na região espaçadora do par de nuclease (Figura 4). O ensaio de T7 endonuclease é aplicável a qualquer tipo de mutação, independentemente da sequência genómica específica dentro da região espaçadora do par nuclease injectado; no entanto, ele detecta apenas desemparelhamentos entre cadeias de ADN de produtos de PCR de heteroduplex. Assim, no caso raro que um fundador carrega dois alelos mutantes de forma idêntica, os produtos de PCR que não mostram qualquer padrão de digestão T7. Essa distinção é, no entanto, sempre possível quando um local específico de restrição está localizado no interior da região espaçadora da nuclease que irá ser eliminado por NHEJInduzida por inserções / eliminações (Figura 5). Aqui, as bandas não digeridos indicam a presença de mutações e a ausência de quaisquer produtos digeridos sugere fortemente um fundador transportando mutações em ambos os alelos do gene alvo (marcado com um asterisco na Figura 4b). <img alt="Figura 1" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig1highres.jpg" src="/files/ftp_upload/50930/50930fig1.jpg" width="600" /> Figura 1. Golden Gate clonagem de Talen RVDS em heterodiméricos vetores pCAG-T7-Destino. A) Assembléia de matrizes RVD em vetores PFUs. Aqui é mostrado um exemplo de um par TALEN com matrizes CONTO individuais com 15 e 17 RVDS RVDS, respectivamente (para arrays CONTO mais de 21 RVDS, são necessárias três PFUs-RVDS assembléias, não apresentado). As setas indicam primers para reações de PCR colônia PFUs específicas do B). Produtos de PCRamplificados a partir de assembléias PFUs corretas normalmente mostram uma banda correspondente ao comprimento total de todos os RVDS clonados (por exemplo, cerca de 1,1 kb para 10 RVDS) e uma &quot;escada&quot; de menores bandas menos proeminentes devido à natureza repetitiva de matrizes RVD. C) A montagem final de matrizes PFUs-RVD e um plasmídeo contendo a última repetição (PLR) em vetores de expressão heterodiméricos Talen com FokIELD e FokIKKR variantes, respectivamente. A espinha dorsal TALEN (anotada como N e C) assemelha-se a arquitectura publicada por Miller et al. CAG 23 A (CMV elemento potenciador precoce / beta-actina de frango), o promotor permite níveis elevados de expressão em células de mamífero transfectadas, ao passo que o promotor do fago T7 permite em a síntese in vitro de mRNA (usar Saci para linearização do vector a jusante do codão de paragem da nuclease). D) Colónia de PCR utilizando os iniciadores indicados por setas em C) permite a identificação de montado correctamente TALENS. -Lengt completaprodutos h PCR são menos proeminentes, enquanto o &quot;efeito escada&quot; representa um indicador robusto de montagem bem-sucedida. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig1highres.jpg" target="_blank">Clique aqui para ver a imagem ampliada</a> . <img alt="Figura 2" fo:content-width="3in" fo:src="/files/ftp_upload/50930/50930fig2highres.jpg" src="/files/ftp_upload/50930/50930fig2.jpg" width="300" /> Figura 2. . Controle de qualidade de nuclease de ARNm na síntese in vitro utilizando electroforese em gel de agarose mRNAs ZFN são mostradas como um exemplo (L, deixou ZFN; R, ZFN direita). Amostras L1/R1 mostrar mRNA antes de poliadenilação, amostras L2/R2 espetáculo polyadenylated mRNA e L3/R3 mostrar mRNA poliadenilado purificada. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig2highres.jpg" target="_blank">Clique aqui para ver a imagem ampliada</a> . <img<html> alt = &quot;Figura 3&quot; fo: content-width = &quot;6 pol&quot; fo: src = &quot;/ files/ftp_upload/50930/50930fig3highres.jpg&quot; src = &quot;/ files/ftp_upload/50930/50930fig3.jpg&quot; width = &quot;600&quot; /&gt; Figura 3. Exemplo de uma digestão com endonucleases de T7 utilizados para a identificação de animais fundadores portadores de mutações induzidas por nuclease do locus alvo. A) Um par TALEN foi projetado para unir dentro da região codificadora do gene da proteína prion rato (Prnp, TALEN seqüência alvo pode ser fornecido mediante solicitação). Um produto de PCR é gerado usando um iniciador para a frente (F) localizado 110 pb a montante e um iniciador inverso (R) de 250 pb a jusante do local de clivagem TALEN. B) O produto de PCR é, subsequentemente, sujeito a formação de heteroduplex e digestão com endonuclease de T7. C) mutagénese induzida por TALEN dentro da região genómica alvo de fundadores individuais é revelada pela presença de um produto de comprimento completo por PCR com os produtos da digestão de 250 e 110 pb.50930/50930fig3highres.jpg &quot;target =&quot; _blank &quot;&gt; Clique aqui para ver imagem ampliada. <img alt="Figura 4" fo:content-width="6in" fo:src="/files/ftp_upload/50930/50930fig4highres.jpg" src="/files/ftp_upload/50930/50930fig4.jpg" width="600" /> Figura 4. Exemplo de uma digestão de restrição dos produtos de PCR utilizados para a identificação de animais fundadores portadores de mutações induzidas por nuclease do locus alvo específicos. ZFN para o locus alvo rato Rosa26 29 um local de restrição Xbal dentro do intrão 1. Fundadores A) foram rastreados por PCR utilizando a genotipagem um iniciador para a frente (F), localizado a 500 bp a jusante e um iniciador inverso (R) de 250 pb a jusante do local de clivagem. B) A digestão dos produtos de PCR com Xba I revela padrões de digestão, indicando ratinhos com mutações bi-alélicos (marcados com asteriscos), mono alélicas mutações (bandas digeridas e não digeridas, por exemplo, animais 2)e camundongos em peso (digestão completa, por exemplo, animais 21). C) Seqüenciamento de camundongos com potenciais modificações bi-alélicas mostra até 3 (animais 24) distintas inserções / exclusões. <a href="https://www.jove.com/files/ftp_upload/50930/50930fig4highres.jpg" target="_blank">Clique aqui para ver a imagem ampliada</a> . <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Nome do Primer </td><td> Sequência de 5 &#39;para 3&#39; </td></tr><tr><td> pCR8_F1 </td><td> ttgatgcctggcagttccct </td></tr><tr><td> pCR8_R1 </td><td> cgaaccgaacaggcttatgt </td></tr><tr><td> TAL_F1 </td><td> ttggcgtcggcaaacagtgg </td></tr><tr><td> TAL_R2 </td><td> ggcgacgaggtggtcgttgg </td></tr><tr><td> TAL_Seq_5-1 </td><td> catcgcgcaatgcactgac </td></tr></tbody></table> Tabela 1. Seqüências de primers utilizados para a PCR de colônia e sequenciamento dentro do conjunto Golden Gate TALENprotocolo. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Plasmídeo / Colecção </td><td> Contribuinte </td><td> Addgene ID </td><td> Comentários </td></tr><tr><td> Golden Gate TALEN e TAL Effector Kit 2.0 </td><td> Voytas laboratório </td><td> 1000000024 </td><td> Contém todos os plasmídeos necessários para a montagem Golden Gate TALEN </td></tr><tr><td> pCAG-T7-TALEN -KKR/ELD vetores destino </td><td> Pelczar laboratório </td><td> 40131, 40132 </td><td> Add-on plasmídeos para a expressão em células de mamíferos TALEN e na síntese de ARNm in vitro </td></tr></tbody></table> Tabela 2. Plasmídeos e coleções de plasmídeos necessários para a montagem Golden Gate TALEN podem ser obtidas Addgene ( <a href="http://www.addgene.org">www.addgene.org</a> ). <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> On-lineRecurso </td><td> Comentários </td></tr><tr><td> http://tale-nt.cac.cornell.edu </td><td> Projeto de TALEN; TALEN previsão off-alvo </td></tr><tr><td> http://zifit.partners.org/ZiFiT/ </td><td> Projeto de TALEN, ABERTO ZFN, CoDA ZFN, CRISPR/Cas9 </td></tr><tr><td> http://www.genome-engineering.org </td><td> Projeto de TALEN, CRISPR/Cas9; CRISPR/Cas9 previsão off-alvo </td></tr><tr><td> http://baolab.bme.gatech.edu/Research/BioinformaticTools/assembleTALSequences.html </td><td> Assembleia da TALEN seqüências para confirmação de resultados de sequenciamento </td></tr><tr><td> http://pgfe.umassmed.edu/ZFPmo dularsearchV2.html </td><td> Projeto de montagem modular ZFN </td></tr><tr><td> www.genomecenter.ucdavis.edu/s egallab / segallabsoftware </td><td> Projeto de montagem modular ZFN </td></tr></tbody></table> Tabela 3. Recursos on-line para a concepção de ZFN, TALEN e CRISPR/Cas9. </strong&gt;

Watch this Scientific Journal Video about Mouse Genome Engineering Using Designer Nucleases at JoVE.com

Mouse Genome Engineering Using Designer Nucleases

Nucleases designers, tais como as nucleases de dedos de zinco (ZFNs) e activadores de transcrição, tal como nucleases efectoras (TALENS) pode ser utilizado para modificar o genoma de embriões préimplantação de ratinho por desencadear tanto a extremidade não homóloga de união (NHEJ) e recombinação homóloga (HR) vias. Estes avanços permitir a rápida geração de ratinhos com modificações genéticas precisas.

Rato Genoma Engenharia Usando Nucleases Designer

Transgenic mice carrying site-specific genome modifications (knockout, knock-in) are of vital importance for dissecting complex biological systems as well ...

mouse-genome-engineering-using-designer-nucleases

Research

JoVE Journal

Biology

28.6K visualizações.  University of Zurich.  Nucleases designers, tais como as nucleases de dedos de zinco (ZFNs) e activadores de transcrição, tal como nucleases efectoras (TALENS) pode ser utilizado para modificar o genoma de embriões préimplantação de ratinho por desencadear tanto a extremidade não homóloga de união (NHEJ) e recombinação homóloga (HR) vias. Estes avanços permitir a rápida geração de ratinhos com modificações genéticas precisas. 

Vídeo: Mouse Genome Engineering Using Designer Nucleases

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish (Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the cellular and molecular features of the epithelia, which are mainly composed of two types of cells: hair cells (HCs) and supporting cells (SCs). Here we choose to study the inner ear sensory epithelia in adult zebrafish not only because the epithelial structures are highly conserved in all vertebrates studied, but also because the adult zebrafish is able to regenerate HCs, an ability that mammals lose shortly after birth. We use the inner ear of adult zebrafish as a model system to study the mechanisms of inner ear HC regeneration in adult vertebrates that could be helpful for clinical therapy of hearing/balance deficits in human as a result of HC loss.
Here we demonstrate how to do gross and fine dissections of inner ear sensory epithelia in adult zebrafish. The gross dissection removes the tissues surrounding the inner ear and is helpful for preparing tissue sections, which allows us to examine the detailed structure of the sensory epithelia. The fine dissection cleans up the non-sensory-epithelial tissues of each individual epithelium and enables us to examine the heterogeneity of the whole epithelium easily in whole-mount epithelial samples.

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish Danio rerio

The inner ear sensory epithelium of adult zebrafish is a good model system for understanding the mechanisms of hair cell regeneration in adult vertebrates. This protocol demonstrates the fine dissection of the epithelia, through which we can get tissue samples for studying the regenerative events at cellular and subcellular levels.

Dissecação bruta e Multa de Ouvido Interno Epitélio sensorial em adultos Zebrafish ( Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the ...

Biologia

Engineering Cell-permeable Protein

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can make use of the translocating ability of so-called cell penetrating peptides (CPPs), also designated as protein transduction domains (PTDs). The TAT-CPP derived from the human immunodeficiency virus type 1 (HIV-1) Tat (trans-activator of transcription) protein has been widely used. The positively charged TAT promotes cell permeability thereby overcoming the barriers of the cellular membrane by endocytosis or/and direct membrane penetration2. In combination with a nuclear localization signal (NLS) fusion proteins are able to enter the nucleus exhibiting functionality. Our video presentation demonstrates, as an exemplification for the engineering of cell-permeable proteins, the construction, production and application of a cell-permeable version of the DNA-modifying enzyme Cre.
Cre is a site-specific recombinase that is able to recognize and recombine 34 base pair loxP sites in mammalian cells in vitro and in vivo. Therefore the Cre/loxP system is widely used to conditionally induce mutations in the genome of living cells3,4. The delivery of active Cre recombinase to cells, however, represents a limitation.
We describe the pSESAME vector system, which allows a direct insertion of the gene-of-interest and provides a platform to rapidly clone different domains and tags used within the vector in a convenient and standardized manner. Rearranging of the different tags has been shown to modify the biochemical properties of the fusion proteins providing a possibility to achieve higher yield and better solubility. We demonstrate how to express and purify recombinant cell-permeant proteins in and from E. coli. The functionality of the recombinant Cre protein is finally validated in cell culture by assessing its intracellular recombinase activity.

Protein transduction enables the direct delivery of biologically active proteins into cells. In contrast to conventional methods such as DNA transfection or viral transduction this non-invasive paradigm allows highly efficient cellular manipulation in a titratable manner circumventing cellular toxicity and the risk of oncogenic transformation by permanent genetic modification.

Engenharia de Proteínas Cell-permeáveis

The protein transduction technique enables the direct delivery of biologically active material into mammalian cells [for review see 1,2]. For this one can ...

Genome-wide Analysis of Aminoacylation (Charging) Levels of tRNA Using Microarrays

tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both prokaryotic and eukaryotic cells lead to translational regulation which is a major cellular mechanism of stress response. Familiar examples are the stringent response in E. coli and the Gcn2 stress response pathway in yeast ([2-6]). Recent work in E. coli and S. cerevisiae have shown that tRNA charging patterns are highly dynamic and depends on the type of stress experienced by cells [1, 6, 7]. The highly dynamic, variable nature of tRNA charging makes it essential to determine changes in tRNA charging levels at the genomic scale, in order to fully elucidate cellular response to environmental variations. In this review we present a method for simultaneously measuring the relative charging levels of all tRNAs in S. cerevisiae . While the protocol presented here is for yeast, this protocol has been successfully applied for determining relative charging levels in a wide variety of organisms including E. coli and human cell cultures[7, 8].

Genome-wide Analysis of Aminoacylation Charging Levels of tRNA Using Microarrays

We describe a method for microarray analysis to determine relative aminoacylation levels of all tRNAs from S. cerivisiae.

Análise do genoma de Aminoacylation (carregamento) Níveis de tRNA Usando Microarrays

tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both ...

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the protein domains that bind to specific histone modifications. One such domain is the plant homeodomain (PHD), found in several chromatin-binding proteins. The epigenetic factor RBP2 has multiple PHD domains, however, they have different functions (Figure 4). In particular, the C-terminal PHD domain, found in a RBP2 oncogenic fusion in human leukemia, binds to trimethylated lysine 4 in histone H3 (H3K4me3)1. The transcript corresponding to the RBP2 isoform containing the C-terminal PHD accumulates during differentiation of promonocytic, lymphoma-derived, U937 cells into monocytes2. Consistent with both sets of data, genome-wide analysis showed that in differentiated U937 cells, the RBP2 protein gets localized to genomic regions highly enriched for H3K4me33. Localization of RBP2 to its targets correlates with a decrease in H3K4me3 due to RBP2 histone demethylase activity and a decrease in transcriptional activity. In contrast, two other PHDs of RBP2 are unable to bind H3K4me3. Notably, the C-terminal domain PHD of RBP2 is absent in the smaller RBP2 isoform4. It is conceivable that the small isoform of RBP2, which lacks interaction with H3K4me3, differs from the larger isoform in genomic location. The difference in genomic location of RBP2 isoforms may account for the observed diversity in RBP2 function. Specifically, RBP2 is a critical player in cellular differentiation mediated by the retinoblastoma protein (pRB). Consistent with these data, previous genome-wide analysis, without distinction between isoforms, identified two distinct groups of RBP2 target genes: 1) genes bound by RBP2 in a manner that is independent of differentiation; 2) genes bound by RBP2 in a differentiation-dependent manner.
To identify differences in localization between the isoforms we performed genome-wide location analysis by ChIP-Seq. Using antibodies that detect both RBP2 isoforms we have located all RBP2 targets. Additionally we have antibodies that only bind large, and not small RBP2 isoform (Figure 4). After identifying the large isoform targets, one can then subtract them from all RBP2 targets to reveal the targets of small isoform. These data show the contribution of chromatin-interacting domain in protein recruitment to its binding sites in the genome.

Here we are presenting a chromatin immunoprecipitation (ChIP) procedure for genome-wide location analysis of protein isoforms that differ in a histone-binding domain. We are applying it to ChIP-Seq analysis to identify the targets of the KDM5A/JARID1A/RBP2 histone demethylase.

Análise do genoma usando chip para identificar alvos isoforma específica Gene

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

In vivo Imaging and Therapeutic Treatments in an Orthotopic Mouse Model of Ovarian Cancer

Human cancer and response to therapy is better represented in orthotopic animal models. This paper describes the development of an orthotopic mouse model of ovarian cancer, treatment of cancer via oral delivery of drugs, and monitoring of tumor cell behavior in response to drug treatment in real time using in vivo imaging system. In this orthotopic model, ovarian tumor cells expressing luciferase are applied topically by injecting them directly into the mouse bursa where each ovary is enclosed. Upon injection of D-luciferin, a substrate of firefly luciferase, luciferase-expressing cells generate bioluminescence signals. This signal is detected by the in vivo imaging system and allows for a non-invasive means of monitoring tumor growth, distribution, and regression in individual animals. Drug administration via oral gavage allows for a maximum dosing volume of 10 mL/kg body weight to be delivered directly to the stomach and closely resembles delivery of drugs in clinical treatments. Therefore, techniques described here, development of an orthotopic mouse model of ovarian cancer, oral delivery of drugs, and in vivo imaging, are useful for better understanding of human ovarian cancer and treatment and will improve targeting this disease.

In vivo Imaging and Therapeutic Treatments in an Orthotopic Mouse Model of Ovarian Cancer

Orthotopic animal models of ovarian cancer replicate better human disease and therefore enhance our understanding of cancer progression and tumor response to therapy. A mouse model receives an intrabursal injection of luciferase-expressing ovarian tumor cells. Treatment is administered via oral gavage. Tumor growth is monitored by in vivo imaging system.

In vivo de imagens e tratamentos terapêuticos em um modelo de camundongo ortotópico de câncer de ovário

Human cancer and response to therapy is better represented in orthotopic animal models.  This paper describes the development of an orthotopic mouse model ...

Flow Cytometry Purification of Mouse Meiotic Cells

The heterogeneous nature of cell types in the testis and the absence of meiotic cell culture models have been significant hurdles to the study of the unique differentiation programs that are manifest during meiosis. Two principal methods have been developed to purify, to varying degrees, various meiotic fractions from both adult and immature animals: elutriation or Staput (sedimentation) using BSA and/or percoll gradients. Both of these methods rely on cell size and density to separate meiotic cells1-5. Overall, except for few cell populations6, these protocols fail to yield sufficient purity of the numerous meiotic cell populations that are necessary for detailed molecular analyses. Moreover, with such methods usually one type of meiotic cells can be purified at a given time, which adds an extra level of complexity regarding the reproducibility and homogeneity when comparing meiotic cell samples.
Here, we describe a refined method that allows one to easily visualize, identify, and purify meiotic cells, from germ cells to round spermatids, using FACS combined with Hoechst 33342 staining7,8. This method provides an overall snapshot of the entire meiotic process and allows one to highly purify viable cells from most stage of meiosis. These purified cells can then be analyzed in detail for molecular changes that accompany progression through meiosis, for example changes in gene expression9,10and the dynamics of nucleosome occupancy at hotspots of meiotic recombination11.

An efficient method to obtain highly purified viable meiotic fractions from mouse testis is described, which combines a refined cell dissociation protocol with fluorescent activated cell sorting (FACS). This method takes advantage of differences in the DNA content and nuclear density of discrete meiotic fractions.

Purificação de Citometria de Fluxo de células de camundongo meiótica

The heterogeneous nature of cell types in the testis and the absence of meiotic cell culture models have been significant hurdles to the study of the ...

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

Genome-wide tela de Metas de miRNA Usando a missão Biblioteca ID Alvo

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Genome Editing with CompoZr Custom Zinc Finger Nucleases (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such as chemical-based mutagenesis or random integration of DNA sequences confer indiscriminate genetic changes in an overall inefficient manner and require incorporation of undesirable synthetic sequences or use of aberrant culture conditions, potentially confusing biological study. By contrast, transient ZFN expression in a cell can facilitate precise, heritable gene editing in a highly efficient manner without the need for administration of chemicals or integration of synthetic transgenes.
Zinc finger nucleases (ZFNs) are enzymes which bind and cut distinct sequences of double-stranded DNA (dsDNA). A functional CompoZr ZFN unit consists of two individual monomeric proteins that bind a DNA "half-site" of approximately 15-18 nucleotides (see Figure 1). When two ZFN monomers "home" to their adjacent target sites the DNA-cleavage domains dimerize and create a double-strand break (DSB) in the DNA.1 Introduction of ZFN-mediated DSBs in the genome lays a foundation for highly efficient genome editing. Imperfect repair of DSBs in a cell via the non-homologous end-joining (NHEJ) DNA repair pathway can result in small insertions and deletions (indels). Creation of indels within the gene coding sequence of a cell can result in frameshift and subsequent functional knockout of a gene locus at high efficiency.2 While this protocol describes the use of ZFNs to create a gene knockout, integration of transgenes may also be conducted via homology-directed repair at the ZFN cut site.
The CompoZr Custom ZFN Service represents a systematic, comprehensive, and well-characterized approach to targeted gene editing for the scientific community with ZFN technology. Sigma scientists work closely with investigators to 1) perform due diligence analysis including analysis of relevant gene structure, biology, and model system pursuant to the project goals, 2) apply this knowledge to develop a sound targeting strategy, 3) then design, build, and functionally validate ZFNs for activity in a relevant cell line. The investigator receives positive control genomic DNA and primers, and ready-to-use ZFN reagents supplied in both plasmid DNA and in-vitro transcribed mRNA format. These reagents may then be delivered for transient expression in the investigator&#x2019;s cell line or cell type of choice. Samples are then tested for gene editing at the locus of interest by standard molecular biology techniques including PCR amplification, enzymatic digest, and electrophoresis. After positive signal for gene editing is detected in the initial population, cells are single-cell cloned and genotyped for identification of mutant clones/alleles.

Genome Editing with CompoZr Custom Zinc Finger Nucleases ZFNs

The CompoZr Custom Zinc-Finger Nuclease (ZFN) Service enables precise genome editing in any organism or cell line at any locus defined by the user. This article describes the process for the design, manufacture, validation and implementation of the CompoZr Custom ZFN Service.

Genoma Edição com CompoZr personalizados Nucleases dedo de zinco (ZFNs)

Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such ...

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present methods for the development of assays to query potentially clinically significant nonsynonymous changes using in vivo complementation in zebrafish. Zebrafish (Danio rerio) are a useful animal system due to their experimental tractability; embryos are transparent to enable facile viewing, undergo rapid development ex vivo, and can be genetically manipulated.1 These aspects have allowed for significant advances in the analysis of embryogenesis, molecular processes, and morphogenetic signaling. Taken together, the advantages of this vertebrate model make zebrafish highly amenable to modeling the developmental defects in pediatric disease, and in some cases, adult-onset disorders. Because the zebrafish genome is highly conserved with that of humans (~70% orthologous), it is possible to recapitulate human disease states in zebrafish. This is accomplished either through the injection of mutant human mRNA to induce dominant negative or gain of function alleles, or utilization of morpholino (MO) antisense oligonucleotides to suppress genes to mimic loss of function variants. Through complementation of MO-induced phenotypes with capped human mRNA, our approach enables the interpretation of the deleterious effect of mutations on human protein sequence based on the ability of mutant mRNA to rescue a measurable, physiologically relevant phenotype. Modeling of the human disease alleles occurs through microinjection of zebrafish embryos with MO and/or human mRNA at the 1-4 cell stage, and phenotyping up to seven days post fertilization (dpf). This general strategy can be extended to a wide range of disease phenotypes, as demonstrated in the following protocol. We present our established models for morphogenetic signaling, craniofacial, cardiac, vascular integrity, renal function, and skeletal muscle disorder phenotypes, as well as others.

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present a systematic approach for developing physiologically relevant, sensitive and specific in vivo assays for interpreting variation in human pathology. Transient genetic manipulation via microinjection of WT and mutant human mRNA and morpholino (MO) antisense oligonucleotides harness the tractability of the developing zebrafish embryo to rapidly assay pathogenic mutations, especially, but not exclusively, in the context of human developmental disorders.

In Vivo Modelagem do Morbid Genoma Humano utilizando Danio rerio

Here,  we present methods for the development of assays to query potentially clinically  significant nonsynonymous changes using in  vivo complementation ...

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs. Towards this end, much recent work has focused on identifying candidate genes for the evolution of traits in a variety of species. However, until recently it has been challenging to functionally validate interesting candidate genes. Recently developed tools for genetic engineering make it possible to manipulate specific genes in a wide range of organisms. Application of this technology in evolutionarily relevant organisms will allow for unprecedented insight into the role of candidate genes in evolution. Astyanax mexicanus (A. mexicanus) is a species of fish with both surface-dwelling and cave-dwelling forms. Multiple independent lines of cave-dwelling forms have evolved from ancestral surface fish, which are interfertile with one another and with surface fish, allowing elucidation of the genetic basis of cave traits. A. mexicanus has been used for a number of evolutionary studies, including linkage analysis to identify candidate genes responsible for a number of traits. Thus, A. mexicanus is an ideal system for the application of genome editing to test the role of candidate genes. Here we report a method for using transcription activator-like effector nucleases (TALENs) to mutate genes in surface A. mexicanus. Genome editing using TALENs in A. mexicanus has been utilized to generate mutations in pigmentation genes. This technique can also be utilized to evaluate the role of candidate genes for a number of other traits that have evolved in cave forms of A. mexicanus.

Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases TALENs

Gene-targeting mutagenesis is now possible in a wide range of organisms using genome editing techniques. Here, we demonstrate a protocol for targeted gene mutagenesis using transcription activator like effector nucleases (TALENs) in Astyanax mexicanus, a species of fish that includes surface fish and cavefish.

Genoma Edição na<em&gt; Mexicanus Astyanax</em&gt; Usando Transcrição Activator-like Effector nucleases (TALENS)

Identifying alleles of genes underlying evolutionary change is essential to understanding how and why evolution occurs.  Towards this end, much recent ...