Agradecemos Alessandro Cellerino, Tyrone Genade, Anne Brunet, Sabrina Sharp, Mickie Powell, Simone Keil, Yumi Kim, Patrick Smith, Kai Mathar e todos os membros do laboratório Valenzano no Instituto Max Planck de biologia do envelhecimento contribuem para diferentes aspectos o protocolo de criação de killifish actual ao longo dos anos.

<ol>
	<li>Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-canonical+aging+model+systems+and+why+we+need+them.">Non-canonical aging model systems and why we need them.</a> EMBO J. 36 (8), 959-963 (2017).</li><li>Harel, I., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish:+A+Model+for+Exploring+Vertebrate+Aging+and+Diseases+in+the+Fast+Lane.">The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane.</a> Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).</li><li>Smith, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+life+span+by+the+gut+microbiota+in+the+short-lived+African+turquoise+killifish.">Regulation of life span by the gut microbiota in the short-lived African turquoise killifish.</a> Elife. 6, (2017).</li><li>Cellerino, A., Valenzano, D. R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+the+bush+to+the+bench:+the+annual+Nothobranchius+fishes+as+a+new+model+system+in+biology.">From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology.</a> Biol Rev Camb Philos Soc. 91 (2), 511-533 (2016).</li><li>Kim, Y., Nam, H. G., Valenzano, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+short-lived+African+turquoise+killifish:+an+emerging+experimental+model+for+ageing.">The short-lived African turquoise killifish: an emerging experimental model for ageing.</a> Dis Model Mech. 9 (2), 115-129 (2016).</li><li>Blazek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repeated+intraspecific+divergence+in+life+span+and+aging+of+African+annual+fishes+along+an+aridity+gradient.">Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient.</a> Evolution. 71 (2), 386-402 (2017).</li><li>Terzibasi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large+differences+in+aging+phenotype+between+strains+of+the+short-lived+annual+fish+Nothobranchius+furzeri.">Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri.</a> PLoS One. 3 (12), e3866 (2008).</li><li>Kirschner, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+quantitative+trait+loci+controlling+lifespan+in+the+short-lived+fish+Nothobranchius+furzeri--a+new+vertebrate+model+for+age+research.">Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research.</a> Aging Cell. 11 (2), 252-261 (2012).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+loci+associated+with+tail+color+and+sex+determination+in+the+short-lived+fish+Nothobranchius+furzeri.">Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri.</a> Genetics. 183 (4), 1385-1395 (2009).</li><li>Reichwald, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+Sex+Chromosome+Evolution+and+Aging+from+the+Genome+of+a+Short-Lived+Fish.">Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish.</a> Cell. 163 (6), 1527-1538 (2015).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish+Genome+Provides+Insights+into+Evolution+and+Genetic+Architecture+of+Lifespan.">The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan.</a> Cell. 163 (6), 1539-1554 (2015).</li><li>Harel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+platform+for+rapid+exploration+of+aging+and+diseases+in+a+naturally+short-lived+vertebrate.">A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate.</a> Cell. 160 (5), 1013-1026 (2015).</li><li>Valenzano, D. R., Sharp, S., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon-Mediated+Transgenesis+in+the+Short-Lived+African+Killifish+Nothobranchius+furzeri,+a+Vertebrate+Model+for+Aging.">Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging.</a> G3. 1 (7), 531-538 (2011).</li><li>Harel, I., Valenzano, D. R., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+engineering+approaches+for+the+short-lived+African+turquoise+killifish.">Efficient genome engineering approaches for the short-lived African turquoise killifish.</a> Nat Protoc. 11 (10), 2010-2028 (2016).</li><li>Polacik, M., Blazek, R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laboratory+breeding+of+the+short-lived+annual+killifish+Nothobranchius+furzeri.">Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri.</a> Nat Protoc. 11 (8), 1396-1413 (2016).</li><li>Avdesh, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regular+care+and+maintenance+of+a+zebrafish+(Danio+rerio)+laboratory:+an+introduction.">Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction.</a> J Vis Exp. (69), e4196 (2012).</li></ol>

Todos os autores declaram não concorrentes interesses financeiros e não financeiros.

Descreveremos um protocolo para laboratório de cultivo de killies turquesa, incluindo a colheita de embriões, incubação, bem como a carcaça de peixes adultos, reprodução e alimentação. Nosso protocolo destina-se especificamente aos laboratórios que realizam pesquisas focadas em peixes adultos, em particular em estudos experimentais sobre envelhecimento e vida útil. Killies turquesa podem ser gerado em uma instalação padrão do zebrafish; no entanto, aspectos importantes da criação de killifish diferem dos cuidados de zebrafish padrão16. Essas adaptações incluem transição precoce de uma dieta só de artémia para uma dieta suplementada com verme de sangue rico em proteínas, bem como as etapas específicas na incubação de embriões, consistindo de uma fase de incubação líquidas e secas.
Passos críticos dentro do protocolo incluem transporte de embriões na faixa de temperatura de 8-30 ° C. Em caso de reprodução, fecundidade depende da alimentação, frequência e qualidade dos alimentos; Portanto, recomendamos pelo menos duas refeições por dia por reprodução tanque para aumentar o rendimento de embriões (ver secção 5.6.). Durante o clareamento de embrião, não se estendem incubação de embriões na solução de branqueamento. Isso pode causar danos ao córion ovo e embrião maior mortalidade. Quando incubando embriões com azul de metileno, não prolonga a incubação de embriões de pronto-a-porta por mais de 2 semanas como sua viabilidade será drasticamente reduzida. Para incubação killies turquesa, baixa temperatura da solução de ácido húmico melhora para incubação e imersão completa dos embriões na solução permite sincronizado para incubação. Não é suficiente arejamento durante os resultados de incubação em altas taxas de alevinos não é capazes de encher a bexiga de gás (fenótipo "barriga-slider", ver notas na secção 5.1).
Limitação do protocolo para reprodução inclui o uso do substrato areia quais desafios de poses para centralizada de sistemas de filtragem e devem ser substituídos por métodos alternativos no futuro. Possíveis alternativas poderiam ser a utilização de tanques de criação de zebrafish. Branqueamento de embrião pode causar grandes mudanças físico-químicas no córion ovo que pode resultar na fisiologia do córion alterada e o sucesso da incubação. Constante exposição dos embriões ao azul de metileno pode induzir mudanças de longo prazo em fisiologia de peixes adultos. Criar peixes adultos em tanques individuais para estudos de coorte de sobrevivência pode afetar negativamente saúde e comportamento dos peixes. No entanto, Alojamento em grupo para estudos de coorte de sobrevivência adiciona fatores de confundimento significativos devido ao estabelecimento de dominância social e territórios masculinos, levando a rígidas hierarquias sociais. Portanto, julgamos que o isolamento de peixe masculino para estudos de sobrevivência é um compromisso razoável. Colônias de killies laboratório alimentação com alimento vivo de fontes não-controlados adicionar um risco de contaminações externas de comunidades microbianas potencialmente patogênicas e parasitas. No futuro, um alimento para peixes estéril ad hoc deve ser desenvolvido.
Futuras melhorias para este protocolo incidirá sobre uma dieta controlada, não-vivo, que ainda leva para completar a maturação sexual dentro de 3-4 semanas. Em resumo, nosso protocolo oferece acessibilidade para turquesa killies laboratório de cultivo de uma comunidade científica ampla.

Dada a sua curta duração e ciclo de vida rápido, killies turquesas estão crescendo rapidamente como um promissor novo organismo modelo em biologia1,2,3. Esta espécie é caracterizada por um ciclo de vida exclusivo para um teleósteos, consistindo de diapausa embrionária, rápida maturação sexual e uma duração prolongada pós-reprodutivo estágio4,5. Trabalhos recentes tem contribuído para elucidar a biologia desta espécie em cativeiro e no selvagem6,7. Turquesas killies vivem em corpos de água doce sazonal que se formam durante a estação chuvosa na savana africana em Zimbabwe e Moçambique. Durante a estação seca, embriões sobrevivem na lama seca na ausência de água em virtude de um estágio de vida resistente ao estresse chamado diapausa.
Mapas de genética desta espécie foram gerados8,9, e recentemente seu genoma foi sequenciado e montado10,11. Desenvolveram-se várias cepas de peixes do laboratório puras e transgênese e genoma edição via CRISPR/Cas9 tornaram-se disponíveis nesta espécie, de fato promover killies turquesa como um organismo de vertebrados modelo competitivo de laboratório 12,13,14.
Embora um protocolo do laboratório já tenha sido publicado por esta espécie de15, no presente protocolo, nós desenvolvemos uma lista abrangente das orientações do laboratório experimental que visam especificamente a estudos que investigam o envelhecimento e sobrevivência. O presente protocolo permite que pesquisadores já familiarizados com a criação do zebrafish e medaka tornar-se versado na criação de killifish turquesa através da adopção de um número mínimo de ajustes chaves. Ao mesmo tempo, este protocolo fornece pesquisadores sem experiência prévia em criação de peixes com as ferramentas essenciais para criar uma próspera colônia de killies turquesa.

<table><tbody><tr><td>Probe calibration buffer solution pH=7.0</td><td>Roth</td><td>A518.1</td><td>1L buffer solution pH=7.0 to calibrate water system pH-electrode</td></tr><tr><td>Probe calibration buffer solution pH=4.0</td><td>Roth</td><td>P712.1</td><td>1L buffer solution pH=4.0 to calibrate water system pH-electrode</td></tr><tr><td>Conductivity standard</td><td>VWR</td><td>83607.260</td><td>500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode</td></tr><tr><td>Easy Strips Test 6in1</td><td>JBL</td><td>2533900</td><td>Test strips for determination chlorine values of system water</td></tr><tr><td>Ammonia Test</td><td>JBL</td><td>2536500</td><td>Test to determine ammonia content of system water</td></tr><tr><td>Red Sea Salt</td><td>Red Sea</td><td></td><td>22 kg bucket</td></tr><tr><td>Sodium hydrogen carbonate</td><td>VWR</td><td>27780.360</td><td></td></tr><tr><td>Humic acid</td><td>Sigma- Aldrich</td><td>53680-50G</td><td></td></tr><tr><td>New HUFA Artemia enrichment</td><td>ZM Systems UK</td><td></td><td>75g bottle</td></tr><tr><td>Methylene blue</td><td>Roth</td><td>AE64.1</td><td></td></tr><tr><td>Hydrogen peroxide solution</td><td>Sigma- Aldrich</td><td>31642-1L</td><td>30% (w/w)</td></tr><tr><td>Coconut fiber</td><td>Dragon</td><td>ZCS010</td><td></td></tr><tr><td>Whatman paper</td><td>GE healthcare</td><td>3030-690</td><td></td></tr><tr><td>Ethanol pure</td><td>VWR</td><td>20821.467</td><td>100%</td></tr><tr><td>Silica sand</td><td>local pet shop</td><td></td><td></td></tr><tr><td>Artemia Eggs Premium Grade</td><td>Sanders</td><td></td><td></td></tr><tr><td>Bloodworm</td><td>local distributor</td><td></td><td>Poseidon Aquakultur Germany</td></tr><tr><td>dNTPs solution mix</td><td>Biolabs</td><td>N04472</td><td>10mM</td></tr><tr><td>Taq DNA polymerase</td><td>Invitrogen</td><td>18038-042</td><td>5U/uL</td></tr><tr><td>PCR 10x Buffer</td><td>Invitrogen</td><td>18038-042</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Invitrogen</td><td>18038-042</td><td>50mM</td></tr><tr><td>NaOH</td><td>Sigma- Aldrich</td><td>S8045-500g</td><td>50mM</td></tr><tr><td>Tris-HCl, pH=8.0 solution</td><td>Sigma- Aldrich</td><td>T2694-1L</td><td>1M</td></tr><tr><td>HCl 37%</td><td>Sigma- Aldrich</td><td>H1758-500mL</td><td></td></tr><tr><td>Fish tanks</td><td>Aquaneering</td><td></td><td>volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids</td></tr><tr><td>Orbital shaker</td><td>VWR</td><td>89032-100</td><td>model 5000</td></tr><tr><td>Microbiological incubator</td><td>Thermo Scientific, Heratherm</td><td>50125882</td><td>model IMC18; for storage embryos in the liquid phase, set to t=27-28&amp;deg;C</td></tr><tr><td>Cooling Incubator</td><td>Binder</td><td>9020-0209</td><td>model KT115; for storage embryos in the solid phase, set to t=27-28&amp;deg;C</td></tr><tr><td>Hatching incubator</td><td>Thermo Scientific, Heratherm</td><td>51028114</td><td>model OGS180; for embryos hatching, set to t=27-28&amp;deg;C</td></tr><tr><td>Stereomicroscope</td><td>Leica</td><td></td><td>model M80</td></tr><tr><td>Breeding sand/hatching boxes</td><td>Roth</td><td>1598.1</td><td>1000mL</td></tr><tr><td>Petri dish</td><td>Sarstedt</td><td>82.1473</td><td>92x16mm</td></tr><tr><td>50 mL Conical tube</td><td>Sarstedt</td><td>62.547.254</td><td></td></tr><tr><td>15 mL Conical tube</td><td>Sarstedt</td><td>62.554.002</td><td></td></tr><tr><td>Disposable Plastic Pasteur pipette</td><td>Roth</td><td>EA71.1</td><td>2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter</td></tr><tr><td>Serological pipette</td><td>Sarstedt</td><td>86.1689.001</td><td>50mL</td></tr><tr><td>Syringe</td><td>Henke Sass Wolf</td><td>4100-000V0</td><td>10mL</td></tr><tr><td>Metal strainer</td><td></td><td></td><td>fineness &amp;lt;1mm; for embryos collection</td></tr><tr><td>Tweezers</td><td>Dumont</td><td>0508-5/45-PO</td><td>type5/45; for embryos transfer</td></tr><tr><td>25 L Brine shrimp hatcher</td><td>Aquaneering</td><td>ZHBS25</td><td>main hatcher</td></tr><tr><td>500 mL Brine shrimp hatcher</td><td>JBL</td><td>6106100</td><td>model Artemio 1; backup hatcher</td></tr><tr><td>Narrow-mesh fish nets</td><td>JBL</td><td></td><td></td></tr><tr><td>Sand beaker</td><td>VWR</td><td>BURK7102-5000</td><td>5000mL</td></tr><tr><td>Brine shrimp separation beaker</td><td>VWR</td><td>BURK7102-2000</td><td>2000mL</td></tr><tr><td>Plastic zipper bag</td><td>Roth</td><td>P279.2</td><td>for dead fish storage</td></tr><tr><td>Pipetboy</td><td>Integra</td><td>155000</td><td>model Pipetboy acu2</td></tr><tr><td>Parafilm</td><td>P-Lab</td><td>P701605</td><td></td></tr><tr><td>Air tubing</td><td>www.zajac.de</td><td>AQ380</td><td>4-6 mm diameter</td></tr><tr><td>1 L Glass bottle</td><td>VWR</td><td>215-1595</td><td></td></tr><tr><td>2 L Glass bottle</td><td>VWR</td><td>215-1596</td><td></td></tr><tr><td>500 mL Squeeze bottle</td><td>Roth</td><td>K665.1</td><td>for fish feeding with brine shrimp</td></tr><tr><td>120-&amp;#956;m brine shrimp strainer</td><td>Florida Aqua Farms</td><td>BB-PC2</td><td>for brine shrimp/bloodworm collection</td></tr><tr><td>Finish filter socks</td><td>Aquaneering</td><td>MFVB025C</td><td>25-&amp;#956;m</td></tr><tr><td>Central filtration fish housing system</td><td></td><td></td><td>Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz</td></tr></tbody></table>

a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)

O desenvolvimento de práticas de produção animal em laboratório não-modelo peixe utilizados para fins experimentais muito beneficiou a criação de peixes de referência sistemas modelo, tais como o zebrafish e medaka. Nos últimos anos, um peixe emergente – os killies turquesa (Nothobranchius furzeri) – tem sido adotado por um número crescente de grupos de pesquisa nos campos da biologia do envelhecimento e ecologia. Com uma extensão de vida em cativeiro de 4 a 8 meses, esta espécie é o enfase vertebrados criados em cativeiro e permite que a comunidade científica para teste – em um curto período de tempo – intervenções experimentais que podem levar a alterações da taxa de envelhecimento e a expectativa de vida. Dada a biologia exclusiva desta espécie, caracterizada por diapausa embrionária, maturação sexual explosiva, marcado dimorfismo sexual morfológico e comportamental - e sua expectativa de vida relativamente curta adulta - criação ad hoc , as práticas são em urgente demanda. Este protocolo relata um conjunto de medidas de criação de chave que permitem ideal killies turquesa cuidados de laboratório, permitindo que a comunidade científica adoptar esta espécie como um modelo animal de laboratório poderoso.

Criação adequada de turquesa killies resulta na sobrevida média variando entre 12-18 semanas na estirpe GRZ (por exemplo, Figura 4A). Variações de sobrevida mediana dependem de dieta, frequência de alimentação e as condições de temperatura de alojamento. Resultados de criação pobre em curvas de sobrevivência apresentando aumentaram a mortalidade precoce e repetitivas, súbitas gotas de sobrevivência ao longo do tempo, caracteriza-se por vários pontos de inflexão (Figura 4B).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57073/57073fig1.jpg"> Figura 1: estádios de desenvolvimento embrionários representativos com substrato de incubação respectivos. (A) recém coletados embriões, incubados em solução de azul de metileno na incubadora a 28 ° C. (B) pronto para ser transferido para um meio sólido, embriões também filtro de fibra de papel ou coco. (C) embriões pronto para ser chocado, exibindo o típicas íris douradas. Barra de escala é igual a 1 mm. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig1large.jpg" target="_blank">clique aqui para ver uma versão maior desta figura.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57073/57073fig2.jpg"> Figura 2: estágios de turquesa killies pós-incubação desenvolvimento. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig2large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57073/57073fig3.jpg"> Figura 3: etiqueta de identificação representativa de peixe para peixe de fase 3 em diante. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig3large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57073/57073fig4.jpg"> Figura 4: curva representativa de sobrevivência para 70 masculinos turquesas killies. (A) curva de sobrevivência típico para laboratório-gerado turquesa killies. (B) comparação de curvas de sobrevivência obtidos de peixes criados sob condições ideais de criação (preto) e pecuária pobre (vermelho e azul). Linha horizontal tracejada vermelha indica 50% de sobrevivência, curva de sobrevivência se cruzam no tempo de vida médio (indicado no eixo x). <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig4large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>ID</td>
			<td colspan="2">Cartilha para a frente</td>
			<td colspan="2">Primeira demão reversa</td>
			<td>Faixa de tamanho (bp)</td>
		</tr>
<tr>
<td>* NfuSU0007</td>
			<td colspan="2">GGCTAAGCCTTGCTGACAGA</td>
			<td colspan="2">CAGGGAGCTGAAAACCTCAG</td>
			<td>166 - 214</td>
		</tr>
<tr>
<td>* NfuSU0010</td>
			<td colspan="2">CGCAGTCTGATCAAATCGTGT</td>
			<td colspan="2">TGTTTGAAGGTTCACATTCATTATC</td>
			<td>220 - 272</td>
		</tr>
<tr>
<td>NfuSU0016</td>
			<td colspan="2">CATGGCTAAACCGTGATGAA</td>
			<td colspan="2">GAAGGACGCCAGCTATGAAG</td>
			<td>209 - 240</td>
		</tr>
<tr>
<td>NfuSU0022</td>
			<td colspan="2">AACACAGCTCTCGTAAGGAGGTA</td>
			<td colspan="2">TTCAGACTTGTCTTACTACCATGTTT</td>
			<td>198 - 238</td>
		</tr>
<tr>
<td>NfuSU0027</td>
			<td colspan="2">TCCAGCTGAATCGGTAATGA</td>
			<td colspan="2">AAACTCGAGGGTGCAATCTG</td>
			<td>164 - 226</td>
		</tr>
<tr>
<td>NfuSU0049</td>
			<td colspan="2">CTGGACAAAGTGCCAATCAC</td>
			<td colspan="2">CTCCCACAGTCCCAAAACAT</td>
			<td>196 - 197</td>
		</tr>
<tr>
<td>NfuSU0050</td>
			<td colspan="2">CCAGAATGAACAATACTCAGATCAA</td>
			<td colspan="2">GCAGCTTAGTTTAATGATATCACAATG</td>
			<td>252 - 295</td>
		</tr>
<tr>
<td>NfuSU0060</td>
			<td colspan="2">CTAGCCACTCCCCTGGTTTA</td>
			<td colspan="2">CCGTCACGATGTGCTGATAC</td>
			<td>216 - 248</td>
		</tr>
<tr>
<td>NfuFLI0030</td>
			<td colspan="2">CAGAAGCTAAAGGCCAGACG</td>
			<td colspan="2">GGGAAACAATAGGGAACCAC</td>
			<td>174 - 205</td>
		</tr>
<tr>
<td>* NfuFLI0091</td>
			<td colspan="2">ACGCTGACTCTACCCAGTC</td>
			<td colspan="2">CTGCCTGCTACTGACAATG</td>
			<td>355 - 373</td>
		</tr>
<tr>
<td colspan="6">* - marcadores de determinação do sexo</td>
		</tr>
</tbody></table>Tabela 1: Primers de genotipagem para identificação da estirpe.

Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

Habitação de laboratório de turquesa killies podem ser escalados para casa e eficientemente criar milhares de peixes individuais em um sistema de filtragem de água centralizado, empregando a mesma infraestrutura utilizada para instalações padrão do zebrafish. Aqui detalhamos uma lista de procedimentos padronizados que permitem a manutenção eficiente killies.

Um protocolo para laboratório habitação de turquesa Killifish (Nothobranchius furzeri)

The development of husbandry practices in non-model laboratory fish used for experimental purposes has greatly benefited from the establishment of ...

a-protocol-for-laboratory-housing-turquoise-killifish-nothobranchius

Research

JoVE Journal

Biology

A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri)

16.8K visualizações.  Max Planck Institute for the Biology of Ageing. Habitação de laboratório de turquesa killies podem ser escalados para casa e eficientemente criar milhares de peixes individuais em um sistema de filtragem de água centralizado, empregando a mesma infraestrutura utilizada para instalações padrão do zebrafish. Aqui detalhamos uma lista de procedimentos padronizados que permitem a manutenção eficiente killies.

Vídeo: A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

Protocol for Acute and Chronic Ecotoxicity Testing of the Turquoise Killifish Nothobranchius furzeri

The killifish Nothobranchius furzeri is an emerging model organism in the field of ecotoxicology and its applicability in acute and chronic ecotoxicity testing has been demonstrated. Overall, the sensitivity of the species to toxic compounds is in the range with, or higher than, that of other model species.
This work describes protocols for acute, chronic, and multigenerational bioassays of single and combined stressor effects on N. furzeri. Due to its short maturation time and life-cycle, this vertebrate model allows the study of endpoints such as maturation time and fecundity within four months. Transgenerational full life-cycle exposure trials can be performed in as little as 8 months. Since this species produces eggs that are drought-resistant and remain viable for years, the on-site culture of the species is not needed but individuals can be recruited when required. The protocols are designed to measure life-history traits (mortality, growth, fecundity, weight) and critical thermal maximum.

Protocol for Acute and Chronic Ecotoxicity Testing of the Turquoise Killifish Nothobranchius furzeri

In this work, we describe an acute, chronic and multigenerational bioassay to study the effects of single and combined stressors on the Turquoise killifish Nothobranchius furzeri. This protocol is designed to study life-history traits (mortality, growth, fecundity, weight) and critical thermal maximum.

Protocolo para aguda e crônica de ensaios toxicológicos do turquesa Killifish Nothobranchius furzeri

The killifish Nothobranchius furzeri is an emerging model organism in the field of ecotoxicology and its applicability in acute and chronic ecotoxicity ...

Ambiente

Bioindication Testing of Stream Environment Suitability for Young Freshwater Pearl Mussels Using In Situ Exposure Methods

Knowledge of habitat suitability for freshwater mussels is an important step in the conservation of this endangered species group. We describe a protocol for performing in situ juvenile exposure tests within oligotrophic river catchments over one-month and three-month periods. Two methods (in both modifications) are presented to evaluate the juvenile growth and survival rate. The methods and modifications differ in value for the locality bioindication and each has its benefits as well as limitations. The sandy cage method works with a large set of individuals, but only some of the individuals are measured and the results are evaluated in bulk. In the mesh cage method, the individuals are kept and measured separately, but a low individual number is evaluated. The open water exposure modification is relatively easy to apply; it shows the juvenile growth potential of sites and can also be effective for water toxicity testing. The within-bed exposure modification needs a high workload but is closer to the conditions of a natural juvenile environment and it is better for reporting the real suitability of localities. On the other hand, more replications are needed in this modification due to its high-hyporheic environment variability.

Bioindication Testing of Stream Environment Suitability for Young Freshwater Pearl Mussels Using In Situ Exposure Methods

In situ bioindications enable determination of the suitability of an environment for endangered mussel species. We describe two methods based on the juvenile exposure of freshwater pearl mussels in cages to oligotrophic river habitats. Both methods are implemented in variants for open water and hyporheic water environments.

Bioindicação teste de adequação de ambiente de fluxo para jovens de água doce da pérola mexilhões usando métodos de exposição em Situ

Knowledge of habitat suitability for freshwater mussels is an important step in the conservation of this endangered species group. We describe a protocol ...

Raising the Mexican Tetra Astyanax mexicanus for Analysis of Post-larval Phenotypes and Whole-mount Immunohistochemistry

River and cave-adapted populations of Astyanax mexicanus show differences in morphology, physiology, and behavior. Research focused on comparing adult forms has revealed the genetic basis of some of these differences. Less is known about how the populations differ at post-larval stages (at the onset of feeding). Such studies may provide insight into how cavefish survive through adulthood in their natural environment. Methods for comparing post-larval development in the laboratory require standardized aquaculture and feeding regimes. Here we describe how to raise fish on a diet of nutrient-rich rotifers in non-recirculating water for up to two-weeks post fertilization. We demonstrate how to collect post-larval fish from this nursery system and perform whole-mount immunostaining. Immunostaining is an attractive alternative to transgene expression analysis for investigating development and gene function in A. mexicanus. The nursery method can also be used as a standard protocol for establishing density-matched populations for growth into adults.

Raising the Mexican Tetra Astyanax mexicanus for Analysis of Post-larval Phenotypes and Whole-mount Immunohistochemistry

In this protocol, we demonstrate how to breed Astyanax mexicanus adults, raise the larvae, and perform whole-mount immunohistochemistry on post-larval fish to compare the phenotypes of surface and cave morphotypes.

Levantando o Tetra mexicano Astyanax mexicanus para análise dos fenótipos Post-larval e imuno-histoquímica toda a montagem

River and cave-adapted populations of Astyanax mexicanus show differences in morphology, physiology, and behavior. Research focused on comparing adult ...

Genética

Behavioral Tracking and Neuromast Imaging of Mexican Cavefish

Cave-dwelling animals have evolved a series of morphological and behavioral traits to adapt to their perpetually dark and food-sparse environments. Among these traits, foraging behavior is one of the useful windows into functional advantages of behavioral trait evolution. Presented herein are updated methods for analyzing vibration attraction behavior (VAB: an adaptive foraging behavior) and imaging of associated mechanosensors of cave-adapted tetra, Astyanax mexicanus. In addition, methods are presented for high-throughput tracking of a series of additional cavefish behaviors including hyperactivity and sleep-loss. Cavefish also show asociality, repetitive behavior and higher anxiety. Therefore, cavefish serve as an animal model for evolved behaviors. These methods use free-software and custom-made scripts that can be applied to other types of behavior. These methods provide practical and cost-effective alternatives to commercially available tracking software.

Here, we present methods for high-throughput study of a series of the Mexican cavefish behaviors and vital staining of a mechanosensory system. These methods use free-software and custom-made scripts, providing a practical and cost-effective method for the studies of behaviors.

Acompanhamento comportamental e Neuromast imagem de Cavefish mexicano

Cave-dwelling animals have evolved a series of morphological and behavioral traits to adapt to their perpetually dark and food-sparse environments. Among ...

Comportamento

A Standardized Protocol for Preference Testing to Assess Fish Welfare

Animal welfare assessment techniques try to take into consideration the specific needs and wants of the animal in question. Providing enrichment (the addition of physical objects or conspecifics in the housing environment) is often a way to give captive animals the opportunity to choose who or what they interact with and how they spend their time. A fundamental component of the aquatic environment that is often overlooked in captivity, however, is the ability for the animal to choose to engage in physical exercise. For many animals, including fish, exercise is an important aspect of their life history, and is known to have many health benefits, including positive changes in the brain and behavior. Here we present a method for assessing habitat preferences in captive animals. The protocol could easily be adapted to look at a variety of environmental factors (e.g., gravel versus sand as a substrate, plastic plants versus live plants, low flow versus high flow of water) in different aquatic species, or for use with terrestrial species. Statistical assessment of preference is carried out using Jacob&#39;s preference index, which ranks the habitats from -1 (avoidance) to +1 (most preferred). With this information, it can be determined what the animal wants from a welfare perspective, including their preferred location.

A fundamental aspect of assessing the welfare of animals in captivity is to ask whether the animals have what they want. Here, we present a protocol to determine housing preference in the zebrafish (Danio rerio) with respect to the presence/absence of environmental enrichment and access to flowing of water.

Um protocolo padronizado para testes de preferência para avaliar o bem-estar dos peixes

Animal welfare assessment techniques try to take into consideration the specific needs and wants of the animal in question. Providing enrichment (the ...

Examination of Host Phenotypes in Gambusia affinis Following Antibiotic Treatment

The commonality of antibiotic usage in medicine means that understanding the resulting consequences to the host is vital. Antibiotics often decrease host microbiome community diversity and alter the microbial community composition. Many diseases such as antibiotic-associated enterocolitis, inflammatory bowel disease, and metabolic disorders have been linked to a disrupted microbiota. The complex interplay between host, microbiome, and antibiotics needs a tractable model for studying host-microbiome interactions. Our freshwater vertebrate fish serves as a useful model for investigating the universal aspects of mucosal microbiome structure and function as well as analyzing consequential host effects from altering the microbial community. Methods include host challenges such as infection by a known fish pathogen, exposure to fecal or soil microbes, osmotic stress, nitrate toxicity, growth analysis, and measurement of gut motility. These techniques demonstrate a flexible and useful model system for rapid determination of host phenotypes.

Examination of Host Phenotypes in Gambusia affinis Following Antibiotic Treatment

This study involves methods to reveal effects on a model fish host following alteration of the skin and gut microbiome communities&#160;composition by an antibiotic.

Exame de fenótipos de acolhimento em<em&gt; Gambusia affinis</em&gt; Após o tratamento antibiótico

The commonality of antibiotic usage in medicine means that understanding the resulting consequences to the host is vital. Antibiotics often decrease host ...

Imunologia e Infecção

Regular Care and Maintenance of a Zebrafish (Danio rerio) Laboratory: An Introduction

This protocol describes regular care and maintenance of a zebrafish laboratory. Zebrafish are now gaining popularity in genetics, pharmacological and behavioural research. As a vertebrate, zebrafish share considerable genetic sequence similarity with humans and are being used as an animal model for various human disease conditions. The advantages of zebrafish in comparison to other common vertebrate models include high fecundity, low maintenance cost, transparent embryos, and rapid development. Due to the spur of interest in zebrafish research, the need to establish and maintain a productive zebrafish housing facility is also increasing. Although literature is available for the maintenance of a zebrafish laboratory, a concise video protocol is lacking. This video illustrates the protocol for regular housing, feeding, breeding and raising of zebrafish larvae. This process will help researchers to understand the natural behaviour and optimal conditions of zebrafish husbandry and hence troubleshoot experimental issues that originate from the fish husbandry conditions. This protocol will be of immense help to researchers planning to establish a zebrafish laboratory, and also to graduate students who are intending to use zebrafish as an animal model.

Regular Care and Maintenance of a Zebrafish Danio rerio Laboratory: An Introduction

This protocol outlines regular maintenance and care to maintain optimal conditions for zebrafish husbandry. The video illustrates the protocol for system maintenance, regular housing, feeding, breeding, and raising of zebrafish larvae.

Cuidados e manutenção regular de um peixe-zebra (<em&gt; Danio rerio</em&gt;) Laboratório: Uma Introdução

This protocol describes regular care and maintenance of a zebrafish laboratory. Zebrafish are now gaining popularity in genetics, pharmacological and ...

Biologia

Construction of an Affordable and Easy-to-Build Zebrafish Facility

In vivo biomedical research is pivotal to translate in vitro findings into clinical advances. Small academic institutions with limited resources find it virtually impossible to build and maintain typical rodent facilities for research. Zebrafish research has been demonstrated to be a valuable alternative for in vivo research in pharmacology, physiology, development and genetic studies. This article demonstrates that a functional zebrafish facility can be built in an easy and affordable manner. We demonstrate that such a facility could be built in about one working day with minimal tools and expertise. The cost of the 27 1.8 L fish tank zebrafish facility constructed in this study was approximately $1,500. We estimate that the maintenance of an initial working 150 fish colony for 3 months is $1,000. This project involved students, who were introduced to aquaculturing of zebrafish for research proposes.

A Zebrafish facility suitable for breeding and in vivo research is built in an easy and affordable manner. Maintenance is minimal. This facility is ideal for student involvement and independent research.

Construção de uma compilação de fácil Facility Zebrafish Acessível e

In vivo biomedical research is pivotal to translate in vitro findings into clinical advances. Small academic institutions with limited resources find it ...

Gentle Isolation of Nuclei from the Brain Tissue of Adult African Turquoise Killifish, a Naturally Short-Lived Model for Aging Research

Studying brain aging at single-cell resolution in vertebrate systems remains challenging due to cost, time, and technical constraints. Here, we demonstrate a protocol to generate single-nucleus RNA sequencing (snRNA-seq) libraries from the brains of the naturally short-lived vertebrate African turquoise killifish Nothobranchius furzeri. The African turquoise killifish has a lifespan of 4-6 months and can be housed in a cost-effective manner, thus reducing cost and time barriers to study vertebrate brain aging. However, tailored protocols are needed to isolate nuclei of sufficient quality for downstream single-cell experiments from the brain of young and aged fish. Here, we demonstrate an empirically optimized protocol for the isolation of high-quality nuclei from the brain of adult African turquoise killifish, a critical step in the generation of high-quality single nuclei omic libraries. Furthermore, we show that the steps to reduce contaminating background RNA are important to clearly distinguish cell types. In summary, this protocol demonstrates the feasibility of studying brain aging in non-traditional vertebrate model organisms.

Here we present a protocol to isolate nuclei from the brains of the short-lived vertebrate model Nothobranchius furzeri for downstream applications such as single-nucleus RNA sequencing or single-nucleus assay for transposase-accessible chromatin with sequencing (ATAC-seq).

Isolamento suave de núcleos do tecido cerebral de Killifish turquesa africano adulto, um modelo naturalmente de curta duração para a pesquisa do envelhecimento

Studying brain aging at single-cell resolution in vertebrate systems remains challenging due to cost, time, and technical constraints. Here, we ...

Neurociência

Environmental Screening of Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa in Zebrafish Systems

Health monitoring systems are developed and used in zebrafish research facilities because pathogens of Danio rerio such as Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa have the potential to impair animal welfare and research. The fish are typically analyzed post mortem to detect microbes. The use of sentinels is a suggested way to improve the sensitivity of the surveillance and to reduce the number of animals to sample. The setting of a pre-filtration sentinel tank out of a recirculating system is described. The technique is developed to prevent water pollution and to represent the fish population by a careful selection of age, gender, and strains. In order to use the minimum number of animals, techniques to screen the environment are also detailed. Polymerase Chain Reaction (PCR) on surface sump swabs is used to significantly improve the detection of some prevalent and pathogenic mycobacterial species such as Mycobacterium fortuitum, Mycobacterium haemophilum, and Mycobacterium chelonae. Another environmental method consists of processing the sludge at the bottom of a holding tank or sump to look for P. tomentosa eggs. This is a cheap and fast technique that can be applied in quarantine where a breeding device is submerged into the holding tank of imported animals. Finally, PCR is applied to the sludge sample and A. hydrophila is detected at the sump&#39;s bottom and surface. Generally, these environmental screening techniques applied to these specific pathogens have led to an increased sensitivity compared to the testing of pre-filtration sentinels.

Environmental Screening of Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa in Zebrafish Systems

This protocol describes the use of sump swabs and sludge analysis of zebrafish systems, which leads to increased detection compared to the sole use of sentinels to detect pathogens such as Aeromonas hydrophila, Mycobacterium spp., and Pseudocapillaria tomentosa. A system to monitor P. tomentosa eggs in quarantine is also proposed.

Um protocolo para laboratório habitação de turquesa Killifish (Nothobranchius furzeri)

Resumo

Explore mais vídeos

Capítulos neste vídeo