Este trabalho foi apoiado por Subsídios do Instituto Nacional de Saúde Mental (R00MH103531 e R01MH116901 a J.A.), bolsa de formação pré-doutorado do Instituto Nacional de Medicina Geral (T32GM007635 a S.R.), e uma Bolsa Lyda Hill Gilliam para Estudos Avançados (GT11021 a S.R.). Agradecemos ao Dr. Kevin Woolfrey pela ajuda com o microscópio, Dr. K Ulrich Bayer pelo uso de seu microscópio epifluorescente, e Thomas Südhof (Universidade de Stanford) para o plasmídeo LRRTM2.

1. Cultura celular e transfecção
<ol><li>Faça mídia celular HEK com DMEM, 1x (Modificação do Meio da Águia) de Dulbecco com glicose de 4,5 g/L, l-glutamina & piruato de sódio e 10% FBS. Filtro estéril.</li>
	<li>Ligantes e receptores adequados para agregação de pré-determinantes e receptores para ensaio de agregação. NOTA: Neurexin3α SS4+/- e um de seus ligantes conhecidos, LRRTM2, foram utilizados neste estudo. Ligantes e receptores de interesse foram expressos a partir de cDNAs em pcDNA3.1. Um conjunto Gibson foi usado para inserir Neurexin3α no pcDNA3.112. Neurexin3α F/R: TTTAAACTTAAGCTTGGTACCGAGCTCGGATCCGCCACCATGAGCTTTACCCTCCCTACTC/ GAGCGGCCGCCCCGTGCTGGATATCTGCAGAATTCTTACACATAATACTCCTTGTCCTT.</li>
	<li>Prepare células HEK293T.<ol>
<li>Cresça células HEK293T para confluência em um frasco T-75.</li>
		<li>Uma vez confluente, use 2 mL de trippsina e coloque em incubadora de 37 °C por 2 min. Adicione 6 mL de mídia HEK ao frasco para resuspend células e transfira todos os 8 mL para um tubo cônico de 15 mL.</li>
		<li>Pelota a 500 x g por 5 min e resuspend na mídia de células HEK para um total de 8 mL.</li>
		<li>Conte células e adicione 735.000 células em cada poço de uma placa de 6 poços. Ajuste o volume final para 2 mL para cada poço usando mídia de célula HEK.</li>
		<li>Coloque na incubadora de 37 °C e permita que as células cresçam durante a noite ou até atingirem 50-60% de confluência.</li>
	</ol></li>
	<li>Células HEK293T transfectas utilizando o método fosfato de cálcio13.<ol>
<li>Transfetar bem-1 com 3 μg da proteína de interesse e co-transfeto com 1 μg de proteína fluorescente (3 μg de pcDNA3.1-Neurexin3αWT SS4- e 1 μg de mCherry).</li>
		<li>Transfect well-2 como na etapa 1.4.1. mas com a proteína mutante de interesse (pcDNA3.1-Neurexin3αA687T SS4-).</li>
		<li>Transfect well-3 com 3 μg do ligante de interesse e co-transfeito com 1 μg de outra proteína fluorescente (3 μg de pcDNA3.1 LRRTM2 e 1 μg de GFP).</li>
		<li>Transfect well-4 e well-5 para servir como controles negativos: bem-4 com 1 μg de GFP e bem-5 com 1 μg de mCherry.</li>
		<li>Prepare outra placa (como na etapa 1.4.1-1.4.4) se exigir condições ou controles adicionais (Neurexin3αWT/A687T SS4+). NOTA: A eficiência da transfecção é analisada 24 h após a transfecção sob um microscópio de epifluorescência e quantificada como o número de células expressando a proteína fluorescente com a qual foram transfecidas. Uma abordagem mais simplificada incluiria a transfecção de células HEK com uma codificação vetorial bicistrônica para uma proteína fluorescente e o ligante de interesse e é altamente recomendado acima da co-transfecção. No caso deste estudo, as neurexinas alfa são ~4,3 kb e a baixa intensidade de fluorescência foi observada usando um sistema bicistronic que necessita de co-transfecção.</li>
	</ol></li>
	<li>48 horas após a transfecção, colhe células para agregação.<ol>
<li>Lave cada poço duas vezes com PBS.</li>
		<li>Adicione 1 mL de 10 mM EDTA em PBS em cada poço para dissociar suavemente as interações célula-célula e incubar a placa a 37 °C por 5 minutos. NOTA: A trippsina não é recomendada para a etapa 1.5.2 devido ao potencial decote proteolítico de moléculas de adesão em estudo. Além disso, após a adição de EDTA, o protocolo pode não ser interrompido até a conclusão, pois as células serão agora expostas a condições ambientais.</li>
		<li>Bata suavemente a placa para desprender as células e colher cada poço em tubos cônicos separados de 15 mL.</li>
		<li>Centrífuga tubos cônicos a 500 x g e temperatura ambiente por 5 min.</li>
	</ol></li>
	<li>Enquanto as células estão pelotando, prepare 6 tubos de incubação rotulando a parte superior de cada tubo de microcentrifuuagem com cada condição. NOTA: Cada permutação das condições de GFP e mCherry deve ser usada para abranger todas as condições experimentais e controles adequados. Por exemplo: 1. GFP/mCherry, 2. mCherry/LRRTM2-GFP 3. GFP/Neurexin3αWT SS4-- mCherry, 4. GFP/Neurexin3αA687T SS4- –mCherry, 5. Neurexin3αWT SS4-— mCherry/LRRTM2 — GFP, 6. Neurexin3αA687T SS4- –mCherry/LRRTM2-GFP. Faça tubos adicionais para acomodar outras condições e controles.</li>
	<li>Remova as células supernascidas e resuspend em 500 μL de mídia HEK com 10 mM CaCl2 e 10 mM MgCl2 aquecidos a 37 °C. NOTA: A adição de CaCl2 e MgCl2 permite que moléculas de adesão restabeleçam a vinculação e só é necessária se os parceiros de interação transcelular em questão exigirem cáções divalentes para adesão.</li>
	<li>Conte as células em cada tubo cônico de 15 mL usando um hemocitômetro e alíquota de 200.000 células de cada condição em tubo apropriado a partir da etapa 1.6.1 para uma mistura de 1:1 em um volume total de 500 μL. NOTA: Deve levar apenas 5 minutos por condição para contar e parcelar valores.</li>
	<li>Incubar tubos à temperatura ambiente em um rotador de tubo lento.</li>
</ol>2. Aquisição de imagens
<ol><li>Otimize parâmetros de aquisição de microscópio para amostras específicas. Neste exemplo, as imagens foram tiradas em um microscópio de campo largo. Use um objetivo de ar 5x (NA: 0,15; WD: 20000 μm) para obter um campo grande o suficiente para análise.</li>
	<li>Avalie a agregação da linha de base imediatamente após misturar as duas condições das células HEK na etapa 1.8. Estas são agora as imagens do "tempo zero".<ol>
<li>Pipeta 40 μL de cada mistura de amostra em um slide de microscópio carregado e imagem sob fluorescência nos canais 488 e 561.</li>
		<li>Adquira três diferentes campos de visão em um plano focal por gota de amostra.</li>
	</ol>
</li>
	<li>Adquira imagens finais a 60 min como a imagem do "tempo 60".<ol>
<li>Para obter a imagem 'time 60' da mistura após uma incubação de 60 minutos, pegue outra amostra de 40 μL de cada condição a partir de tubos rotativos e pipeta cada amostra em um slide carregado. Imagem como na etapa 2.2.2. NOTA: A agregação celular deve ser verificada a cada 15 minutos até que ocorra a saturação. O tempo de agregação dependerá das proteínas que estão sendo testadas.</li>
	</ol>
</li>
</ol>3. Análise ImageJ/Fiji
<ol><li>Para quantificar a extensão da agregação usando Fiji/ImageJ, salve arquivos de análise.<ol>
<li>Salve os arquivos de codificação suplementar fornecidos na pasta de macros imageJ no computador.</li>
		<li>Instale a macro de agregação fornecida (Plugins, Macros, Install e selecione o arquivo "AgregaçãoSsay.txt").</li>
	</ol>
</li>
	<li>Determine limiares.<ol>
<li>Carregue um arquivo de .tif 'time zero' em imageJ e divida os canais (Imagem | | de cor Canais Divididos). NOTA: A imagem 'time zero' é usada para determinar o limiar e o menor tamanho de puncta para todo o experimento.</li>
		<li>Mascarar cada canal(Plugins | Macros | AggregationAssay_MakeMask). A janela Make Mask From Image será exibida. Verifique as caixas ao lado de Determine Threshold for Image e Determine Cluster Params from Histogram e clique em OK.</li>
		<li>Determine o limiar da imagem usando a barra de slides, grave o número à direita da barra de slides e clique em OK.</li>
		<li>Um Histograma do Tamanho do Cluster aparecerá. Selecione um tamanho de cluster do histograma que se adapte ao experimento, digite este número no Tamanho do Cluster Min: caixa e clique em OK. Clusters abaixo deste tamanho não serão analisados.</li>
	</ol>
</li>
	<li>Analise a análise.<ol>
<li>Abra a imagem 'time 60' da condição 1 na imagemJ e divida os canais como na etapa 3.2.1.</li>
		<li>Mascarar cada canal (Plugins, Macros, AggregationAssay_MakeMask). Use o mesmo limiar e tamanho determinados na etapa 3.2.3 e na etapa 3.2.4. Desmarque as caixas ao lado de Determine Threshold for Image e Determine Cluster Params do Histograma e digite manualmente o tamanho e os limiares nos campos apropriados e clique em OK.</li>
		<li>Calcular o índice de agregação (Plugins | Macros | AggregationAssay_CalculateOverlap). Selecione os canais mascarados a serem comparados e o diretório no qual os arquivos resultantes serão salvos.</li>
		<li>Repita as etapas 3.3.1-3.3.3 para cada imagem 'time 60' em cada condição. NOTA: O índice de agregação é definido como a área de sobreposição total dividida pela soma das duas áreas de canal menos a área de sobreposição multiplicada por 100 (Índice de agregação = área de sobreposição/[área do canal 1 + área do canal 2 – área de sobreposição] x 100). Esta normalização é uma operação 'OR' entre os dois canais mascarados representando os pixels totais em qualquer máscara.</li>
	</ol>
</li>
</ol>

<ol>
	<li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroligins+and+neurexins+link+synaptic+function+to+cognitive+disease.">Neuroligins and neurexins link synaptic function to cognitive disease.</a> Nature. 455 (7215), 903-911 (2008).</li><li>Lakey, J. H., Raggett, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+protein-protein+interactions.">Measuring protein-protein interactions.</a> Current Opinion in Structural Biology. 8 (1), 119-123 (1998).</li><li>Aoto, J., Martinelli, D. C., Malenka, R. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Presynaptic+neurexin-3+alternative+splicing+trans-synaptically+controls+postsynaptic+AMPA+receptor+trafficking.">Presynaptic neurexin-3 alternative splicing trans-synaptically controls postsynaptic AMPA receptor trafficking.</a> Cell. 154 (1), 75-88 (2013).</li><li>Aoto, J., F&#246;ldy, C., Ilcus, S. M. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+circuit-dependent+functions+of+presynaptic+neurexin-3+at+GABAergic+and+glutamatergic+synapses.">Distinct circuit-dependent functions of presynaptic neurexin-3 at GABAergic and glutamatergic synapses.</a> Nature Neuroscience. 18 (7), 997-1007 (2015).</li><li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+Neurexin+Complexes:+A+Molecular+Code+for+the+Logic+of+Neural+Circuits.">Synaptic Neurexin Complexes: A Molecular Code for the Logic of Neural Circuits.</a> Cell. 171 (4), 745-769 (2017).</li><li>Dai, J., Aoto, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+Splicing+of+Presynaptic+Neurexins+Differentially+Controls+Postsynaptic+NMDA+and+AMPA+Receptor+Responses.">Alternative Splicing of Presynaptic Neurexins Differentially Controls Postsynaptic NMDA and AMPA Receptor Responses.</a> Neuron. 102 (5), 993-1008 (2019).</li><li>Restrepo, S., Langer, N. J., Nelson, K. A., Aoto, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+a+Neurexin-3&#945;+Human+Mutation+in+Mouse+Neurons+Identifies+a+Novel+Role+in+the+Regulation+of+Transsynaptic+Signaling+and+Neurotransmitter+Release+at+Excitatory+Synapses.">Modeling a Neurexin-3&#945; Human Mutation in Mouse Neurons Identifies a Novel Role in the Regulation of Transsynaptic Signaling and Neurotransmitter Release at Excitatory Synapses.</a> The Journal of Neuroscience. 39 (46), 9065-9082 (2019).</li><li>Ko, J., Fuccillo, M. V., Malenka, R. C., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Functions+as+a+Neurexin+Ligand+in+Promoting+Excitatory+Synapse+Formation.">LRRTM2 Functions as a Neurexin Ligand in Promoting Excitatory Synapse Formation.</a> Neuron. 64 (6), 791-798 (2009).</li><li>de Wit, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Interacts+with+Neurexin1+and+Regulates+Excitatory+Synapse+Formation.">LRRTM2 Interacts with Neurexin1 and Regulates Excitatory Synapse Formation.</a> Neuron. 64 (6), 799-806 (2009).</li><li>Linhoff, M. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Unbiased+Expression+Screen+for+Synaptogenic+Proteins+Identifies+the+LRRTM+Protein+Family+as+Synaptic+Organizers.">An Unbiased Expression Screen for Synaptogenic Proteins Identifies the LRRTM Protein Family as Synaptic Organizers.</a> Neuron. 61 (5), 734-749 (2009).</li><li>Siddiqui, T. J., Pancaroglu, R., Kang, Y., Rooyakkers, A., Craig, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTMs+and+Neuroligins+Bind+Neurexins+with+a+Differential+Code+to+Cooperate+in+Glutamate+Synapse+Development.">LRRTMs and Neuroligins Bind Neurexins with a Differential Code to Cooperate in Glutamate Synapse Development.</a> Journal of Neuroscience. 30 (22), 7495-7506 (2010).</li><li>Gibson, D. G., Young, L., Chuang, R. -. Y., Venter, J. C., Hutchison, C. A., Smith, H. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nature Methods. 6 (5), 343-345 (2009).</li><li>Bacchetti, S., Graham, F. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfer+of+the+gene+for+thymidine+kinase+to+thymidine+kinase-deficient+human+cells+by+purified+herpes+simplex+viral+DNA.">Transfer of the gene for thymidine kinase to thymidine kinase-deficient human cells by purified herpes simplex viral DNA.</a> Proceedings of the National Academy of Sciences of the United States of America. 74 (4), 1590-1594 (1977).</li><li>Cerchiari, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+strategy+for+tissue+self-organization+that+is+robust+to+cellular+heterogeneity+and+plasticity.">A strategy for tissue self-organization that is robust to cellular heterogeneity and plasticity.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (7), 2287-2292 (2015).</li><li>Burdick, M. M., McCarty, O. J. T., Jadhav, S., Konstantopoulos, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+inflammation+and+cancer+metastasis.">Cell-cell interactions in inflammation and cancer metastasis.</a> IEEE Engineering in Medicine and Biology Magazine. 20 (3), 86-91 (2001).</li><li>Fox, D. A., Gizinski, A., Morgan, R., Lundy, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+rheumatoid+arthritis+synovium.">Cell-cell interactions in rheumatoid arthritis synovium.</a> Rheumatic Diseases Clinics of North America. 36 (2), 311-323 (2010).</li><li>Yamagata, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+insights+into+modulation+and+selectivity+of+transsynaptic+neurexin-LRRTM+interaction.">Structural insights into modulation and selectivity of transsynaptic neurexin-LRRTM interaction.</a> Nature Communications. 9 (1), 3964 (2018).</li><li>Nguyen, T., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binding+properties+of+neuroligin+1+and+neurexin+1beta+reveal+function+as+heterophilic+cell+adhesion+molecules.">Binding properties of neuroligin 1 and neurexin 1beta reveal function as heterophilic cell adhesion molecules.</a> The Journal of Biological Chemistry. 272 (41), 26032-26039 (1997).</li><li>Boucard, A. A., Ko, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Affinity+Neurexin+Binding+to+Cell+Adhesion+G-protein-coupled+Receptor+CIRL1/Latrophilin-1+Produces+an+Intercellular+Adhesion+Complex.">High Affinity Neurexin Binding to Cell Adhesion G-protein-coupled Receptor CIRL1/Latrophilin-1 Produces an Intercellular Adhesion Complex.</a> Journal of Biological Chemistry. 287 (12), 9399-9413 (2012).</li></ol>

Os autores não têm nada a revelar.

Dissecar as interações proteína-proteína que ocorrem em trans durante a adesão celular pode levar a uma melhor compreensão dos mecanismos moleculares subjacentes aos processos celulares básicos, incluindo a formação, função e manutenção de sinapses durante a maturação e remodelação. As implicações das interações célula-célula se expandem além da neurobiologia e têm papéis mais amplos na transdução de sinais, migração celular e desenvolvimento de tecidos14. Aberraçõe...

Interações sinápticas facilitadas por moléculas de adesão sináptica são fundamentais para o desenvolvimento, organização, especificação, manutenção e função das sinapses e da geração de redes neurais. A identificação dessas moléculas de adesão celular transsináptica está aumentando rapidamente; assim, é fundamentalmente importante identificar parceiros vinculantes e entender como essas novas moléculas de adesão interagem entre si. Além disso, o sequenciamento do genoma identificou mutações em muitas dessas moléculas de adesão que estão comumente ligadas a uma infinidade de distúrbios neurodesenvolvimentos, neuropsiquiátricos e de dependência1. Mutações em genes que codificam moléculas de adesão celular sináptica podem alterar prejudicialmente interações trans e podem contribuir para alterações fiofoficológicas na formação e ou manutenção da sinapse.
Existem ensaios múltiplos para avaliar quantitativamente interações proteína-proteína, como calrómetria isotérmica, dicromaísmo circular, ressonância de plasmon superficial2 e, embora quantitativa na natureza, eles têm várias limitações. Primeiro, eles requerem proteína recombinante, às vezes exigindo passos longos e tediosos de purificação. Em segundo lugar, exigem equipamentos especializados sofisticados e conhecimentos técnicos. Em terceiro lugar, eles podem superestimar a extensão da ligação, pois permitem interações cis e trans entre proteínas que são naturalmente amarradas a uma membrana in vivo. Aqui propomos um ensaio simples e relativamente rápido que testa exclusivamente interações trans.
Para contornar muitas das complicações associadas a ensaios proteicos purificados, otimizamos um ensaio de interação proteica baseado em células que recapitula interações trans em um sistema celular heterologos reduzido. Este ensaio tem sido usado anteriormente de várias formas para estudar interações transcelulares. Nesta abordagem, moléculas de adesão celular candidatas são transfectadas em células HEK293T. Em condições fisiológicas, as células HEK293T não apresentam auto-agregação, tornando-as modelos exemplares para este ensaio. No entanto, quando populações individuais de células HEK expressando receptor e ligante são combinadas, a ligação do receptor e do ligante força a agregação de células HEK a ocorrer. Esta agregação é mediada exclusivamente por interações trans e geralmente é observável em dezenas de minutos. Não são necessárias etapas de purificação de proteínas neste método, e a eficiência do método baseia-se no paradigma de que populações de células HEK expressando moléculas de adesão cogna estão sendo combinadas e, em seguida, imagens apenas dezenas de minutos depois. Além disso, este método é relativamente barato, pois nem anticorpos nem equipamentos caros são necessários. O único equipamento necessário para a aquisição de dados é um microscópio fluorescente padrão. Uma vantagem adicional para este ensaio baseado em células é a capacidade de rastrear rapidamente o efeito de mutações de pontos relevantes da doença nas interações trans. Isso pode ser realizado transfecando células HEK com cDNAs das variantes mutantes da proteína de interesse.
Neste protocolo, apresentamos um exemplo no qual investigamos se uma mutação missense em Neurexin3α (Neurexin3αA687T), identificada em um paciente diagnosticado com profunda deficiência intelectual e epilepsia, altera interações em trans com proteína trans trans reito transmembrana 2 (LRRTM2). Neurexin3α é um membro da família evolutivamente conservada de moléculas de adesão celular pré-sináptica e, embora o trabalho recente tenha identificado múltiplos papéis na sinapse3,4,5,6,7, nossa compreensão sináptica desta molécula e todos os membros da família neurexina permanecem incompletos. LRRTM2 é uma proteína de adesão celular pós-sináptica excitatória que participa da formação e manutenção da sinapse8,9,10. É importante ressaltar que o LRRTM2 interage exclusivamente com isoformas de neurexina que não possuem o local da emenda 4 exon alternativo (SS4-), mas não com isoformes de neurexina contendo o local da emenda 4 exon alternativo (SS4+). A mutação missense humana (A687T) identificada em Neurexin3α está localizada em uma região extracelular não estudada que é evolutivamente conservada e é conservada entre todas as neurexinas alfa7. Como a interação entre essas duas moléculas foi estabelecida8,9,11, colocamos a questão: a capacidade de ligação de Neurexin3α SS4- para LRRTM2 é alterada por uma mutação de ponto A687T? Este ensaio revelou que a mutação de ponto A687T aumentou inesperadamente a agregação de Neurexin3α para LRRTM2 sugerindo que a região extracelular em que a mutação de ponto está localizada, desempenha um papel na mediação de interações transsinápticas.

<table border="0" cellpadding="0" cellspacing="0" style="width:788px;" width="787">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="60">
			<td height="60" style="height:60px;width:339px;">1.5 mL disposable microtubes with snap caps</td>
			<td style="width:121px;">VWR</td>
			<td style="width:161px;">89000-028</td>
			<td style="width:167px;">Incubation of mixed population of HEK cells</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">1000 mL Rapid&#8212;Flow Filter Unit, 0.2 um aPES membrane</td>
			<td style="width:121px;">Thermo Fisher</td>
			<td style="width:161px;">567-0020</td>
			<td style="width:167px;">Sterilization of HEK media</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">15 mL SpectraTube centrifuge tubes</td>
			<td style="width:121px;">Ward&#8217;s Science</td>
			<td style="width:161px;">470224-998</td>
			<td style="width:167px;">Harvesting HEK cells</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">6 well sterile tissue culture plates</td>
			<td style="width:121px;">VWR</td>
			<td style="width:161px;">100062-892</td>
			<td style="width:167px;">culturing HEK cells</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:339px;">Calcium Chloride</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">223506-500G</td>
			<td style="width:167px;">Calcium phosphate transfection, HEK cell resuspension</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:45px;width:339px;">Centrifuge- Sorvall Legend RT</td>
			<td style="width:121px;">Kendro Laboratory Products</td>
			<td align="right" style="width:161px;">75004377</td>
			<td style="width:167px;">Harvesting HEK cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:22px;width:339px;">CO2 cell incubator</td>
			<td style="width:121px;">Thermo Scientific</td>
			<td style="width:161px;">HERACELL 150i</td>
			<td style="width:167px;">Incubation of HEK cells during growth</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:339px;">DMEM, 1x (Dulbecco&#39;s Modification of Eagle&#39;s Medium) with 4.5 g/L glucose, L-glutamine &#38; sodium pyruvate</td>
			<td style="width:121px;">Corning</td>
			<td style="width:161px;">10-013-CV</td>
			<td style="width:167px;">HEK cell maintenance</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">Dulbecco&#8217;s Phosphate Buffered Saline PBS (1X)</td>
			<td style="width:121px;">Gibco</td>
			<td style="width:161px;">14190-144</td>
			<td style="width:167px;">Passaging/harvesting HEK cell</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">Ethylenediaminetetraacetic acid</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">ED-500G</td>
			<td style="width:167px;">Harvesting HEK cells</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:339px;">Falcon Vented culture flasks, 75cm2 growth area</td>
			<td style="width:121px;">Corning</td>
			<td style="width:161px;">9381M26</td>
			<td style="width:167px;">Culturing HEK cells</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">Fetal Bovine Serum</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">17L184</td>
			<td style="width:167px;">HEK cell maintenance</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">HEK293T cells</td>
			<td style="width:121px;">ATCC</td>
			<td style="width:161px;"></td>
			<td style="width:167px;">Model system</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">ImageJ</td>
			<td style="width:121px;">NIH</td>
			<td style="width:161px;">V: 2.0.0-rc-69/1.52p</td>
			<td style="width:167px;">Image analysis</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">Magnesium Chloride hexahydrate</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">M9272-500G</td>
			<td style="width:167px;">HEK cell resuspension</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">Sodium phosphate dibasic anhydrous</td>
			<td style="width:121px;">Fisher BioReagents</td>
			<td style="width:161px;">BP332-500</td>
			<td style="width:167px;">Calcium phosphate transfection</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">Trypsin 0.25% (1X) Solution</td>
			<td style="width:121px;">GE Healthcare Life Sciences</td>
			<td style="width:161px;">SH30042.01</td>
			<td style="width:167px;">Passaging HEK cells</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">Tube rotator</td>
			<td style="width:121px;"></td>
			<td style="width:161px;"></td>
			<td style="width:167px;">Incubation of mixed population of HEK cells</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:339px;">UltraClear Microscope slides. White Frosted, Positive Charged</td>
			<td style="width:121px;">Denville Scientific Inc.</td>
			<td style="width:161px;">M1021</td>
			<td style="width:167px;">Image acquisition</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">Wide-field microscope</td>
			<td style="width:121px;">Zeiss</td>
			<td style="width:161px;">Axio Vert 200M</td>
			<td style="width:167px;">Image acquisition</td>
		</tr>
	</tbody>
</table>

measuring transcellular interactions through protein aggregation in a heterologous cell system

As interações proteicas nas interfaces celulares ditam uma infinidade de desfechos biológicos que vão desde o desenvolvimento de tecidos e progressão do câncer até a formação e manutenção da sinapse. Muitas dessas interações fundamentais ocorrem em trans e são tipicamente induzidas por interações heterofílicas ou homofílicas entre células expressando pares de ligação ancorados na membrana. Elucidar como mutações relevantes para doenças interrompem essas interações proteicas fundamentais pode fornecer uma visão de uma miríade de campos de biologia celular. Muitos ensaios de interação proteína-proteína não normalmente desambiguam entre interações cis e trans, o que potencialmente leva a uma superestimação da extensão da ligação que está ocorrendo in vivo e envolve purificação intensiva de proteínas e/ou equipamentos de monitoramento especializados. Aqui, apresentamos um protocolo simples otimizado que permite a observação e quantificação de apenas interações trans sem a necessidade de purificações de proteínas longas ou equipamentos especializados. O ensaio de agregação celular HEK envolve a mistura de duas populações independentes de células HEK, cada uma expressando ligantes cognatos ligados à membrana. Após um curto período de incubação, as amostras são imagens e os agregados resultantes são quantificados.

A mutação A687T aumenta a ligação Neurexin3α SS4 ao LRRTM27 Para investigar como as interações intercelulares de duas proteínas sinápticas conhecidas são afetadas pela introdução de uma mutação pontual encontrada em um paciente com deficiência intelectual e epilepsia, utilizamos o ensaio de agregação celular HEK acima(Figura 1). As células foram transfeinadas de acordo com a seção 1 e preparadas para imagens de acordo com as seções 1 e 2 d...

Watch this Scientific Journal Video about Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System at JoVE.com

Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Aqui, apresentamos um protocolo otimizado para medir rapidamente e semiquantitativamente as interações ligantes-receptores em trans em um sistema celular heterologous usando microscopia de fluorescência.

Medindo interações transcelulares através da agregação de proteínas em um sistema celular heterologous

Protein interactions at cellular interfaces dictate a multitude of biological outcomes ranging from tissue development and cancer progression to synapse ...

measuring-transcellular-interactions-through-protein-aggregation

Research

JoVE Journal

Neuroscience

3.4K visualizações.  University of Colorado Denver School of Medicine. Aqui, apresentamos um protocolo otimizado para medir rapidamente e semiquantitativamente as interações ligantes-receptores em trans em um sistema celular heterologous usando microscopia de fluorescência.

Vídeo: Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Assaying Surface Expression of Chemosensory Receptors in Heterologous Cells

The vivid world of odors is recognized by the sense of olfaction. Olfaction in mice is mediated by a repertoire of about 1200 G Protein Coupled Receptors (GPCRs) 1 that are postulated to bind volatile odorant molecules and converting the extracellular signal into an intracellular signal by coupling with G protein G&alpha;olf. Binding of the odorants to the receptors is thought to follow a combinatorial rule, that is, one odorant may bind several receptors and one receptor may bind several odorants to varying degrees 2. Biochemical, signaling and ligand binding studies have been conveniently carried out for most GPCRs using heterologous cells. However use of heterologous cells for study of odorant receptors, was precluded for a long time since on transfection they failed to export to the surface. Saito et al have demonstrated single membrane pass Receptor Transporting Protein (RTP) family chaperones show enhanced expression in the olfactory sensory neurons and act as chaperones to traffic odorant receptors to the surface in heterologous cells, when co transfected together 3. To carry out biochemical assays for receptors using heterologous cells, one must first determine if the receptor shows robust surface expression in the cell line. This can be assayed by overexpressing the receptors with the chaperone RTP1S followed by live cell staining to fluorescently label the extracellular domain or a tag in the extracellular domain exclusively. Here we demonstrate a protocol to carry out live cell staining that can be used to detect odorant receptors on the surface of HEK293T cells conveniently. In addition, it may also be used to assay for surface expression of other chemosensory receptors or GPCRs.

Here we demonstrate a protocol to carry out live cell staining that can be used to detect odorant receptors on the surface of HEK293T cells conveniently. In addition, it may also be used to assay for surface expression of other chemosensory receptors or GPCRs.

Assaying Expressão de Receptores de superfície chemosensory em células heterólogas

The vivid world of odors is recognized by the sense of olfaction. Olfaction in mice is mediated by a repertoire of about 1200 G Protein Coupled Receptors ...

Neurociência

Efficient Derivation of Human Neuronal Progenitors and Neurons from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system (CNS) structure and circuitry in today's healthcare industry. Cell-based therapies hold great promise to restore the lost nerve tissue and function for CNS disorders. However, cell therapies based on CNS-derived neural stem cells have encountered supply restriction and difficulty to use in the clinical setting due to their limited expansion ability in culture and failing plasticity after extensive passaging1-3. Despite some beneficial outcomes, the CNS-derived human neural stem cells (hNSCs) appear to exert their therapeutic effects primarily by their non-neuronal progenies through producing trophic and neuroprotective molecules to rescue the endogenous cells1-3. Alternatively, pluripotent human embryonic stem cells (hESCs) proffer cures for a wide range of neurological disorders by supplying the diversity of human neuronal cell types in the developing CNS for regeneration1,4-7. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity7-10. In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic11-13. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules14 (please see a schematic in Fig. 1). Retinoic acid (RA) does not induce neuronal differentiation of undifferentiated hESCs maintained on feeders1, 14. And unlike mouse ESCs, treating hESC-differentiated embryoid bodies (EBs) only slightly increases the low yield of neurons1, 14, 15. However, after screening a variety of small molecules and growth factors, we found that such defined conditions rendered retinoic acid (RA) sufficient to induce the specification of neuroectoderm direct from pluripotent hESCs that further progressed to neuroblasts that generated human neuronal progenitors and neurons in the developing CNS with high efficiency (Fig. 2). We defined conditions for induction of neuroblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human neuronal cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of neuroblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human neuronal progenitors and neuronal cell types in the developing CNS for neural repair.

Derivação eficiente dos recursos humanos Progenitores Neuronal e Neurônios de pluripotentes células estaminais embrionárias humanas com a indução de moléculas pequenas

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system ...

Peering into the Dynamics of Social Interactions: Measuring Play Fighting in Rats

Play fighting in the rat involves attack and defense of the nape of the neck, which if contacted, is gently nuzzled with the snout. Because the movements of one animal are countered by the actions of its partner, play fighting is a complex, dynamic interaction. This dynamic complexity raises methodological problems about what to score for experimental studies. We present a scoring schema that is sensitive to the correlated nature of the actions performed. The frequency of play fighting can be measured by counting the number of playful nape attacks occurring per unit time. However, playful defense, as it can only occur in response to attack, is necessarily a contingent measure that is best measured as a percentage (#attacks defended/total # attacks X 100%). How a particular attack is defended against can involve one of several tactics, and these are contingent on defense having taken place; consequently, the type of defense is also best expressed contingently as a percentage. Two experiments illustrate how these measurements can be used to detect the effect of brain damage on play fighting even when there is no effect on overall playfulness. That is, the schema presented here is designed to detect and evaluate changes in the content of play following an experimental treatment.

Play fighting in the rat involves attack and defense of the nape of the neck, which if contacted, is gently nuzzled with the snout. Because the movements of one animal are countered by the actions of its partner, play fighting is a complex, dynamic interaction. This dynamic complexity raises methodological problems about what to score for experimental studies. We present a scoring schema that is sensitive to the correlated nature of the actions performed. Two experiments illustrate how these measurements can be used to detect the effect of brain damage on play fighting even when there is no effect on overall playfulness. That is, the schema presented here is designed to detect and evaluate changes in the content of play following an experimental treatment.

Perscrutando a dinâmica das interações sociais: Play medição Lutando em ratos

Play fighting in the rat involves attack and defense of the nape of the neck, which if contacted, is gently nuzzled with the snout. Because the movements ...

Dual Electrophysiological Recordings of Synaptically-evoked Astroglial and Neuronal Responses in Acute Hippocampal Slices

Astrocytes form together with neurons tripartite synapses, where they integrate and modulate neuronal activity. Indeed, astrocytes sense neuronal inputs through activation of their ion channels and neurotransmitter receptors, and process information in part through activity-dependent release of gliotransmitters. Furthermore, astrocytes constitute the main uptake system for glutamate, contribute to potassium spatial buffering, as well as to GABA clearance. These cells therefore constantly monitor synaptic activity, and are thereby sensitive indicators for alterations in synaptically-released glutamate, GABA and extracellular potassium levels. Additionally, alterations in astroglial uptake activity or buffering capacity can have severe effects on neuronal functions, and might be overlooked when characterizing physiopathological situations or knockout mice. Dual recording of neuronal and astroglial activities is therefore an important method to study alterations in synaptic strength associated to concomitant changes in astroglial uptake and buffering capacities. Here we describe how to prepare hippocampal slices, how to identify stratum radiatum astrocytes, and how to record simultaneously neuronal and astroglial electrophysiological responses. Furthermore, we describe how to isolate pharmacologically the synaptically-evoked astroglial currents.

The preparation of acute brain slices from isolated hippocampi, as well as the simultaneous electrophysiological recordings of astrocytes and neurons in stratum radiatum during stimulation of schaffer collaterals is described. The pharmacological isolation of astroglial potassium and glutamate transporter currents is demonstrated.

Dois registros eletrofisiológicos de sinapticamente evocadas Respostas astroglial e neuronal em fatias hipocampais agudas

Astrocytes form together with neurons tripartite synapses, where they integrate and modulate neuronal activity. Indeed, astrocytes sense neuronal inputs ...

A Lightweight, Headphones-based System for Manipulating Auditory Feedback in Songbirds

Experimental manipulations of sensory feedback during complex behavior have provided valuable insights into the computations underlying motor control and sensorimotor plasticity1. Consistent sensory perturbations result in compensatory changes in motor output, reflecting changes in feedforward motor control that reduce the experienced feedback error. By quantifying how different sensory feedback errors affect human behavior, prior studies have explored how visual signals are used to recalibrate arm movements2,3 and auditory feedback is used to modify speech production4-7. The strength of this approach rests on the ability to mimic naturalistic errors in behavior, allowing the experimenter to observe how experienced errors in production are used to recalibrate motor output.
Songbirds provide an excellent animal model for investigating the neural basis of sensorimotor control and plasticity8,9. The songbird brain provides a well-defined circuit in which the areas necessary for song learning are spatially separated from those required for song production, and neural recording and lesion studies have made significant advances in understanding how different brain areas contribute to vocal behavior9-12. However, the lack of a naturalistic error-correction paradigm - in which a known acoustic parameter is perturbed by the experimenter and then corrected by the songbird - has made it difficult to understand the computations underlying vocal learning or how different elements of the neural circuit contribute to the correction of vocal errors13.
The technique described here gives the experimenter precise control over auditory feedback errors in singing birds, allowing the introduction of arbitrary sensory errors that can be used to drive vocal learning. Online sound-processing equipment is used to introduce a known perturbation to the acoustics of song, and a miniaturized headphones apparatus is used to replace a songbird's natural auditory feedback with the perturbed signal in real time. We have used this paradigm to perturb the fundamental frequency (pitch) of auditory feedback in adult songbirds, providing the first demonstration that adult birds maintain vocal performance using error correction14. The present protocol can be used to implement a wide range of sensory feedback perturbations (including but not limited to pitch shifts) to investigate the computational and neurophysiological basis of vocal learning.

We describe the design and assembly of miniaturized headphones suitable for replacing a songbird&#x2019;s natural auditory feedback with a manipulated acoustic signal. Online sound processing hardware is used to manipulate song output, introduce real-time errors in auditory feedback via the headphones, and drive vocal motor learning.

Um leve, sistema de fones baseado para manipular feedback auditivo em Songbirds

Experimental manipulations of sensory feedback during complex behavior have provided valuable insights into the computations underlying motor control and ...

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Genetic modification of specific regions of the developing mammalian brain is a very powerful experimental approach. However, generating novel mouse mutants is often frustratingly slow. It has been shown that access to the mouse brain developing in utero with reasonable post-operatory survival is possible. Still, results with this procedure have been reported almost exclusively for the most superficial and easily accessible part of the developing brain, i.e. the cortex. The thalamus, a narrower and more medial region, has proven more difficult to target. Transfection into deeper nuclei, especially those of the hypothalamus, is perhaps the most challenging and therefore very few results have been reported. Here we demonstrate a procedure to target the entire hypothalamic neuroepithelium or part of it (hypothalamic regions) for transfection through electroporation. The keys to our approach are longer narcosis times, injection in the third ventricle, and appropriate kind and positioning of the electrodes. Additionally, we show results of targeting and subsequent histological analysis of the most recessed hypothalamic nucleus, the mammillary body.

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Despite the functional and medical importance of the hypothalamus, in utero genetic manipulation of its development has rarely been attempted. We show a detailed procedure for in utero electroporation into the mouse hypothalamus and show representative results of total and partial (regional) hypothalamic transfection.

Manipulação genética do rato em desenvolvimento Hipotálamo através<em&gt; In utero</em&gt; Eletroporação

Genetic  modification of specific regions of the developing mammalian brain is a very  powerful experimental approach. However, generating novel mouse ...

A Caenorhabditis elegans Model System for Amylopathy Study

Amylopathy is a term that describes abnormal synthesis and accumulation of amyloid beta (A&beta;) in tissues with time. A&beta; is a hallmark of Alzheimer's disease (AD) and is found in Lewy body dementia, inclusion body myositis and cerebral amyloid angiopathy 1-4. Amylopathies progressively develop with time. For this reason simple organisms with short lifespans may help to elucidate molecular aspects of these conditions. Here, we describe experimental protocols to study A&beta;-mediated neurodegeneration using the worm Caenorhabditis elegans. Thus, we construct transgenic worms by injecting DNA encoding human A&beta;42 into the syncytial gonads of adult hermaphrodites. Transformant lines are stabilized by a mutagenesis-induced integration. Nematodes are age synchronized by collecting and seeding their eggs. The function of neurons expressing A&beta;42 is tested in opportune behavioral assays (chemotaxis assays). Primary neuronal cultures obtained from embryos are used to complement behavioral data and to test the neuroprotective effects of anti-apoptotic compounds.

A Caenorhabditis elegans Model System for Amylopathy Study

We describe methods to study aspects of amylopathies in the worm C. elegans. We show how to construct worms expressing human A&beta;42 in neurons and how to test their function in behavioral assays. We further show how to obtain primary neuronal cultures that can be used for pharmacological testing.

A<em&gt; Caenorhabditis elegans</em&gt; Sistema Modelo para Estudo Amylopathy

Amylopathy is a term that describes abnormal synthesis and accumulation of amyloid beta (A&beta;) in tissues with time. A&beta; is a hallmark of ...

Use of a Caspase Multiplexing Assay to Determine Apoptosis in a Hypothalamic Cell Model

The ability to multiplex assays in studies of complex cellular mechanisms eliminates the need for repetitive experiments, provides internal controls, and decreases waste in costs and reagents. Here we describe optimization of a multiplex assay to assess apoptosis following a palmitic acid (PA) challenge in an in vitro hypothalamic model, using both fluorescent and luminescent based assays to measure viable cell counts and caspase-3/7 activity in a 96-well microtiter plate format. Following PA challenge, viable cells were determined by a resazurin-based fluorescent assay. Caspase-3/7 activity was then determined using a luminogenic substrate, DEVD, and normalized to cell number. This multiplexing assay is a useful technique for determining change in caspase activity following an apoptotic stimulus, such as saturated fatty acid challenge. The saturated fatty acid PA can increase hypothalamic oxidative stress and apoptosis, indicating the potential importance of assays such as that described here in studying the relationship between saturated fatty acids and neuronal function.

Multiplex assays can provide beneficial information for basic cellular mechanisms&#160;and eliminate waste of reagents and unnecessary repetitive experiments. We describe here a multiplex caspase-3/7 activity assay, using fluorescent- and luminescent-based methods, to determine cell viability in an in vitro hypothalamic model following oxidative challenge with palmitic acid.

Utilização de uma caspase Multiplexing ensaio para determinar a apoptose em um modelo de célula hipotalâmica

The ability to multiplex assays in studies of complex cellular mechanisms eliminates the need for repetitive experiments, provides internal controls, and ...

Inducing Plasticity of Astrocytic Receptors by Manipulation of Neuronal Firing Rates

Close to two decades of research has established that astrocytes in situ and in vivo express numerous G protein-coupled receptors (GPCRs) that can be stimulated by neuronally-released transmitter. However, the ability of astrocytic receptors to exhibit plasticity in response to changes in neuronal activity has received little attention. Here we describe a model system that can be used to globally scale up or down astrocytic group I metabotropic glutamate receptors (mGluRs) in acute brain slices. Included are methods on how to prepare parasagittal hippocampal slices, construct chambers suitable for long-term slice incubation, bidirectionally manipulate neuronal action potential frequency, load astrocytes and astrocyte processes with fluorescent Ca2+ indicator, and measure changes in astrocytic Gq GPCR activity by recording spontaneous and evoked astrocyte Ca2+ events using confocal microscopy. In essence, a &#8220;calcium roadmap&#8221; is provided for how to measure plasticity of astrocytic Gq GPCRs. Applications of the technique for study of astrocytes are discussed. Having an understanding of how astrocytic receptor signaling is affected by changes in neuronal activity has important implications for both normal synaptic function as well as processes underlying neurological disorders and neurodegenerative disease.

Here we describe an adaptation of protocols used to induce homeostatic plasticity in neurons for the study of plasticity of astrocytic G protein-coupled receptors. Recently used to examine changes in astrocytic group I mGluRs in juvenile mice, the method can be applied to measure scaling of various astrocytic GPCRs, in tissue from adult mice in situ and in vivo, and to gain a better appreciation of the sensitivity of astrocytic receptors to changes in neuronal activity.

Induzir Plasticidade de astrocítica Receptores de Manipulação de Neuronal queima de moeda

Close to two decades of research has established that astrocytes in situ and in vivo express numerous G protein-coupled receptors (GPCRs) that can be ...

Quantitative Cell Biology of Neurodegeneration in Drosophila Through Unbiased Analysis of Fluorescently Tagged Proteins Using ImageJ

With the rising prevalence of neurodegenerative diseases, it is increasingly important to understand the underlying pathophysiology that leads to neuronal dysfunction and loss. Fluorescence-based imaging tools and technologies enable unprecedented analysis of subcellular neurobiological processes, yet there is still a need for unbiased, reproducible, and accessible approaches for extracting quantifiable data from imaging studies. We have developed a simple and adaptable workflow to extract quantitative data from fluorescence-based imaging studies using Drosophila models of neurodegeneration. Specifically, we describe an easy-to-follow, semi-automated approach using Fiji/ImageJ to analyze two cellular processes: first, we quantify protein aggregate content and profile in the Drosophila optic lobe using fluorescent-tagged mutant huntingtin proteins; and second, we assess autophagy-lysosome flux in the Drosophila visual system with ratiometric-based quantification of a tandem fluorescent reporter of autophagy. Importantly, the protocol outlined here includes a semi-automated segmentation step to ensure all fluorescent structures are analyzed to minimize selection bias and to increase resolution of subtle comparisons. This approach can be extended for the analysis of other cell biological structures and processes implicated in neurodegeneration, such as proteinaceous puncta (stress granules and synaptic complexes), as well as membrane-bound compartments (mitochondria and membrane trafficking vesicles). This method provides a standardized, yet adaptable reference point for image analysis and quantification, and could facilitate reliability and reproducibility across the field, and ultimately enhance mechanistic understanding of neurodegeneration.

Quantitative Cell Biology of Neurodegeneration in Drosophila Through Unbiased Analysis of Fluorescently Tagged Proteins Using ImageJ

We have developed a simple and adaptable workflow to extract quantitative data from fluorescence-imaging-based cell biological studies of protein aggregation and autophagic flux in the central nervous system of Drosophila models of neurodegeneration.

Biologia celular quantitativa de neurodegeneração em Drosophila , através de uma análise imparcial das proteínas fluorescente etiquetadas usando o ImageJ

With the rising prevalence of neurodegenerative diseases, it is increasingly important to understand the underlying pathophysiology that leads to neuronal ...