Diese Arbeit wurde durch Stipendien des National Institute of Mental Health (R00MH103531 und R01MH116901 to J.A.), ein Predoctoral Training Grant vom National Institute of General Medicine (T32GM007635 to S.R.) und ein Lyda Hill Gilliam Fellowship for Advanced Study (GT11021 to S.R.) unterstützt. Wir danken Dr. Kevin Woolfrey für die Hilfe beim Mikroskop, Dr. K. Ulrich Bayer für den Einsatz seines Epifluoreszenzmikroskops und Thomas Südhof (Stanford University) für das LRRTM2-Plasmid.

1. Zellkultur und Transfektion
<ol><li>Herstellung von HEK-Zellmedien mit DMEM, 1x (Dulbecco es Modification of Eagle es Medium) ergänzt mit 4,5 g/L Glukose, L-Glutamin & Natriumpyruvat und 10% FBS. Steriler Filter.</li>
	<li>Präbestimmen Sie geeignete Liganden und Rezeptoren für den Aggregationstest. HINWEIS: In dieser Studie wurden Neurexin3-SS4+/- und einer seiner bekannten Liganden, LRRTM2, verwendet. Liganden und Rezeptoren von Interesse wurden aus cDNAs in pcDNA3.1 ausgedrückt. Eine Gibson-Baugruppe wurde verwendet, um Neurexin3" in pcDNA3.112einzufügen. Neurexin3- F/R: TTTAAACTTAAGCTTGGTGAGCTCGGATCCGCCACCTCTCTCTCTCTCTCTCTCTCTCTCTCTCCCT GAGCGGCCGCCACTGTGCTGGATATCTGCAGAATTCTTACACATAATACTCCTTGTCCTT.</li>
	<li>Bereiten Sie HEK293T-Zellen vor.<ol>
<li>Wachsen Sie HEK293T-Zellen, um in einem T-75-Kolben zu konfluenz.</li>
		<li>Einmal konfluent, 2 ml Trypsin verwenden und 2 min in 37 °C Inkubator geben. Fügen Sie dem Kolben 6 ml HEK-Medien hinzu, um Zellen wieder auszusetzen, und übertragen Sie alle 8 ml in ein 15 ml konisches Rohr.</li>
		<li>Pellet bei 500 x g für 5 min und resuspendieren in HEK-Zellmedien für insgesamt 8 ml.</li>
		<li>Zählen Sie Zellen und fügen Sie 735.000 Zellen in jeden Brunnen einer 6-Well-Platte hinzu. Passen Sie die Endlautstärke mit HEK-Zellmedien auf 2 ml für jeden Brunnen an.</li>
		<li>In 37 °C-Inkubator geben und Zellen über Nacht oder bis zu 50-60% Konfluenz wachsen lassen.</li>
	</ol></li>
	<li>Transfekte HEK293T-Zellen mit der Calciumphosphatmethode13.<ol>
<li>Transfekte gut-1 mit 3 g des von Interesse und Co-Transfekte mit 1 g fluoreszierendem Protein (3 g pcDNA3.1-Neurexin3-WT SS4- und 1 g mCherry).</li>
		<li>Transfekte gut-2 wie in Schritt 1.4.1. aber mit dem mutierten Protein von Interesse (pcDNA3.1-Neurexin3-A687T SS4-).</li>
		<li>Transfekte gut-3 mit 3 g des Liganden von Interesse und ko-transfekect mit 1 g eines anderen fluoreszierenden Proteins (3 g pcDNA3.1 LRRTM2 und 1 g GFP).</li>
		<li>Transfezieren Sie gut-4 und well-5 als Negativkontrollen: gut-4 mit 1 g GFP und gut-5 mit 1 g mCherry.</li>
		<li>Bereiten Sie eine weitere Platte (wie in Schritt 1.4.1-1.4.4) vor, wenn zusätzliche Bedingungen oder Kontrollen erforderlich sind (Neurexin3-WT/A687T SS4+). HINWEIS: Die Transfektionseffizienz wird 24 h nach der Transfektion unter einem Epifluoreszenzmikroskop analysiert und als Anzahl der Zellen quantifiziert, die das fluoreszierende Protein exzieren, mit dem sie transfiziert wurden. Ein schlankerer Ansatz würde die Transfektion von HEK-Zellen mit einem bikannronischen Vektor, der für ein fluoreszierendes Protein kodiert, und den Liganden von Interesse umfassen und wird oberhalb der Kotransfektion dringend empfohlen. Im Falle dieser Studie sind Alpha-Neurexine 4,3 kb und eine niedrige Fluoreszenzintensität wurde mit einem bicistronischen System beobachtet, das eine Kotransfektion erforderlich macht.</li>
	</ol></li>
	<li>48 Stunden nach der Transfektion Ernten Sie Zellen zur Aggregation.<ol>
<li>Waschen Sie jeden Brunnen zweimal mit PBS.</li>
		<li>Fügen Sie 1 ml 10 mM EDTA in PBS in jeden Brunnen ein, um Zell-zu-Zell-Wechselwirkungen sanft zu dissoziieren und die Platte bei 37 °C für 5 min zu inkubieren. HINWEIS: Trypsin wird für Schritt 1.5.2 aufgrund einer möglichen proteolytischen Spaltung von Adhäsionsmolekülen in der Studie nicht empfohlen. Darüber hinaus kann das Protokoll nach der EDTA-Zugabe möglicherweise erst nach Abschluss angehalten werden, da Zellen nun Umgebungsbedingungen ausgesetzt sind.</li>
		<li>Tippen Sie vorsichtig auf die Platte, um die Zellen zu lösen, und ernten Sie jede gut in separaten 15 ml konischen Rohren.</li>
		<li>Zentrifugenkonrohre bei 500 x g und Raumtemperatur für 5 min.</li>
	</ol></li>
	<li>Während zellenpelletieren, bereiten Sie 6 Inkubationsröhrchen vor, indem Sie die Oberseite jedes Mikrozentrifugenrohres mit jeder Bedingung beschriften. HINWEIS: Jede Permutation der GFP- und mCherry-Bedingungen sollte verwendet werden, um alle experimentellen Bedingungen und ordnungsgemäßen Kontrollen zu umfassen. Zum Beispiel: 1. GFP/mCherry, 2. mCherry/LRRTM2-GFP 3. GFP/Neurexin3-WT SS4-—mCherry, 4. GFP/Neurexin3-A687T SS4- –mCherry, 5. Neurexin3"WT SS4-—mCherry/LRRTM2—GFP, 6. Neurexin3-A687T SS4- –mCherry/LRRTM2—GFP. Stellen Sie zusätzliche Rohre vor, um weitere Bedingungen und Kontrollen zu erfüllen.</li>
	<li>Entfernen Sie den Überstand und setzen Sie die Zellen in 500 l HEK-Medien mit 10 mM CaCl2 und 10 mM MgCl2 auf 37 °C erwärmt. HINWEIS: Die Zugabe von CaCl2 und MgCl2 ermöglicht die Wiederherstellung der Bindung von Haftmolekülen und ist nur erforderlich, wenn die betreffenden transzellulären Interaktionspartner divalente Kationen zur Adhäsion benötigen.</li>
	<li>Zählen Sie die Zellen in jedem 15 ml konischen Rohr mit einem Hämozytometer und aliquot 200.000 Zellen jeder Bedingung in ein geeignetes Rohr von Schritt 1.6.1 für eine 1:1-Mischung in einem Gesamtvolumen von 500 l. HINWEIS: Es sollte nur 5 min pro Bedingung zu zählen und aliquot Beträge.</li>
	<li>Röhren bei Raumtemperatur in einem langsamen Rohrrotator inkubieren.</li>
</ol>2. Bildaufnahme
<ol><li>Optimieren Sie die Aufnahmeparameter für mikroskopische Erfassungsparameter für bestimmte Proben. In diesem Beispiel wurden Bilder auf einem Weitfeldmikroskop aufgenommen. Verwenden Sie ein 5-faches Luftobjektiv (NA: 0,15; WD: 20000 m), um ein ausreichend großes Feld für die Analyse zu erhalten.</li>
	<li>Bewerten Sie die Basisaggregation unmittelbar nach dem Mischen der beiden Bedingungen von HEK-Zellen in Schritt 1.8. Dies sind jetzt die "Time Zero"-Bilder.<ol>
<li>Pipette 40 l jedes Probengemisches auf ein geladenes Mikroskopschlitten und Bild unter Fluoreszenz in den Kanälen 488 und 561.</li>
		<li>Erwerben Sie drei verschiedene Sichtfelder auf einer Fokusebene pro Stichprobenablage.</li>
	</ol>
</li>
	<li>Erfassen Sie die endgültigen Bilder in 60 min als 'zeit 60' Bild.<ol>
<li>Um das "Zeit 60"-Bild des Gemischs nach einer 60 min Inkubation zu erhalten, nehmen Sie eine weitere 40-L-Probe jeder Bedingung aus rotierenden Rohren und Pipette jeder Probe auf einem geladenen Schlitten. Bild wie in Schritt 2.2.2. HINWEIS: Die Zellaggregation sollte alle 15 Min. überprüft werden, bis die Sättigung eintritt. Der Zeitpunkt der Aggregation hängt von den getesteten Proteinen ab.</li>
	</ol>
</li>
</ol>3. ImageJ/Fidschi-Analyse
<ol><li>Um das Ausmaß der Aggregation mit Fiji/ImageJ zu quantifizieren, speichern Sie Analysedateien.<ol>
<li>Speichern Sie die bereitgestellten ergänzungskodierungsdateien Dateien im Ordner imageJ-Makros auf dem Computer.</li>
		<li>Installieren Sie das bereitgestellte Aggregationsmakro (Plugins, Makros, Installieren und wählen Sie die Datei "AggregationAssay.txt".</li>
	</ol>
</li>
	<li>Bestimmen Sie Schwellenwerte.<ol>
<li>Laden Sie eine 'Time Zero' .tif Datei in imageJ und teilen Sie die Kanäle auf (Bild | Farbe | Split-Kanäle). HINWEIS: Das Bild "Zeit Null" wird verwendet, um die Schwellenwerte und die kleinste Punktzeichengröße für das gesamte Experiment zu bestimmen.</li>
		<li>Maskieren Sie jeden Kanal(Plugins | Makros | AggregationAssay_MakeMask). Das Fenster "Maske aus Bild erstellen" wird angezeigt. Aktivieren Sie die Kontrollkästchen neben Schwellenwert für Bild bestimmen und Clusterparams aus Histogramm bestimmen, und klicken Sie auf OK.</li>
		<li>Bestimmen Sie den Schwellenwert des Bildes mithilfe der Folienleiste, notieren Sie die Zahl rechts neben der Folienleiste, und klicken Sie auf OK.</li>
		<li>Es wird ein Histogramm der Clustergröße angezeigt. Wählen Sie eine Clustergröße aus dem Histogramm aus, das zum Experiment passt, geben Sie diese Zahl in das Feld Min ClusterGröße: ein, und klicken Sie auf OK. Cluster unterhalb dieser Größe werden nicht analysiert.</li>
	</ol>
</li>
	<li>Führen Sie die Analyse aus.<ol>
<li>Öffnen Sie das 'time 60'-Bild von Bedingung 1 in imageJ und teilen Sie die Kanäle wie in Schritt 3.2.1 auf.</li>
		<li>Maskieren Sie jeden Kanal (Plugins, Makros, AggregationAssay_MakeMask). Verwenden Sie den gleichen Schwellenwert und dieselbe Größe, die in Schritt 3.2.3 und Schritt 3.2.4 festgelegt wurden. Deaktivieren Sie die Felder neben Schwellenwert für Bild bestimmen und Clusterparams aus Histogramm bestimmen, und geben Sie die Größe und die Schwellenwerte manuell in die entsprechenden Felder ein, und klicken Sie dann auf OK.</li>
		<li>Berechnen sie denAggregationsindex (Plugins | Makros | AggregationAssay_CalculateOverlap). Wählen Sie die maskierten Kanäle aus, in die verglichen werden soll, und das Verzeichnis, in das die resultierenden Dateien gespeichert werden sollen.</li>
		<li>Wiederholen Sie die Schritte 3.3.1–3.3.3 für jedes 'time 60'-Bild in jeder Bedingung. ANMERKUNG: Der Aggregationsindex ist definiert als die Gesamteoüberlappungsfläche geteilt durch die Summe der beiden Kanalbereiche abzüglich des Überlappungsbereichs multipliziert mit 100 (Aggregationsindex = Überlappungsfläche/[Fläche von Kanal 1 + Fläche von Kanal 2 – Überlappungsfläche] x 100). Diese Normalisierung ist ein "OR"-Vorgang zwischen den beiden maskierten Kanälen, die die Gesamtpixel in beiden Masken darstellen.</li>
	</ol>
</li>
</ol>

<ol>
	<li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroligins+and+neurexins+link+synaptic+function+to+cognitive+disease.">Neuroligins and neurexins link synaptic function to cognitive disease.</a> Nature. 455 (7215), 903-911 (2008).</li><li>Lakey, J. H., Raggett, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+protein-protein+interactions.">Measuring protein-protein interactions.</a> Current Opinion in Structural Biology. 8 (1), 119-123 (1998).</li><li>Aoto, J., Martinelli, D. C., Malenka, R. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Presynaptic+neurexin-3+alternative+splicing+trans-synaptically+controls+postsynaptic+AMPA+receptor+trafficking.">Presynaptic neurexin-3 alternative splicing trans-synaptically controls postsynaptic AMPA receptor trafficking.</a> Cell. 154 (1), 75-88 (2013).</li><li>Aoto, J., F&#246;ldy, C., Ilcus, S. M. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+circuit-dependent+functions+of+presynaptic+neurexin-3+at+GABAergic+and+glutamatergic+synapses.">Distinct circuit-dependent functions of presynaptic neurexin-3 at GABAergic and glutamatergic synapses.</a> Nature Neuroscience. 18 (7), 997-1007 (2015).</li><li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+Neurexin+Complexes:+A+Molecular+Code+for+the+Logic+of+Neural+Circuits.">Synaptic Neurexin Complexes: A Molecular Code for the Logic of Neural Circuits.</a> Cell. 171 (4), 745-769 (2017).</li><li>Dai, J., Aoto, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+Splicing+of+Presynaptic+Neurexins+Differentially+Controls+Postsynaptic+NMDA+and+AMPA+Receptor+Responses.">Alternative Splicing of Presynaptic Neurexins Differentially Controls Postsynaptic NMDA and AMPA Receptor Responses.</a> Neuron. 102 (5), 993-1008 (2019).</li><li>Restrepo, S., Langer, N. J., Nelson, K. A., Aoto, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+a+Neurexin-3&#945;+Human+Mutation+in+Mouse+Neurons+Identifies+a+Novel+Role+in+the+Regulation+of+Transsynaptic+Signaling+and+Neurotransmitter+Release+at+Excitatory+Synapses.">Modeling a Neurexin-3&#945; Human Mutation in Mouse Neurons Identifies a Novel Role in the Regulation of Transsynaptic Signaling and Neurotransmitter Release at Excitatory Synapses.</a> The Journal of Neuroscience. 39 (46), 9065-9082 (2019).</li><li>Ko, J., Fuccillo, M. V., Malenka, R. C., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Functions+as+a+Neurexin+Ligand+in+Promoting+Excitatory+Synapse+Formation.">LRRTM2 Functions as a Neurexin Ligand in Promoting Excitatory Synapse Formation.</a> Neuron. 64 (6), 791-798 (2009).</li><li>de Wit, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Interacts+with+Neurexin1+and+Regulates+Excitatory+Synapse+Formation.">LRRTM2 Interacts with Neurexin1 and Regulates Excitatory Synapse Formation.</a> Neuron. 64 (6), 799-806 (2009).</li><li>Linhoff, M. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Unbiased+Expression+Screen+for+Synaptogenic+Proteins+Identifies+the+LRRTM+Protein+Family+as+Synaptic+Organizers.">An Unbiased Expression Screen for Synaptogenic Proteins Identifies the LRRTM Protein Family as Synaptic Organizers.</a> Neuron. 61 (5), 734-749 (2009).</li><li>Siddiqui, T. J., Pancaroglu, R., Kang, Y., Rooyakkers, A., Craig, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTMs+and+Neuroligins+Bind+Neurexins+with+a+Differential+Code+to+Cooperate+in+Glutamate+Synapse+Development.">LRRTMs and Neuroligins Bind Neurexins with a Differential Code to Cooperate in Glutamate Synapse Development.</a> Journal of Neuroscience. 30 (22), 7495-7506 (2010).</li><li>Gibson, D. G., Young, L., Chuang, R. -. Y., Venter, J. C., Hutchison, C. A., Smith, H. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nature Methods. 6 (5), 343-345 (2009).</li><li>Bacchetti, S., Graham, F. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfer+of+the+gene+for+thymidine+kinase+to+thymidine+kinase-deficient+human+cells+by+purified+herpes+simplex+viral+DNA.">Transfer of the gene for thymidine kinase to thymidine kinase-deficient human cells by purified herpes simplex viral DNA.</a> Proceedings of the National Academy of Sciences of the United States of America. 74 (4), 1590-1594 (1977).</li><li>Cerchiari, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+strategy+for+tissue+self-organization+that+is+robust+to+cellular+heterogeneity+and+plasticity.">A strategy for tissue self-organization that is robust to cellular heterogeneity and plasticity.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (7), 2287-2292 (2015).</li><li>Burdick, M. M., McCarty, O. J. T., Jadhav, S., Konstantopoulos, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+inflammation+and+cancer+metastasis.">Cell-cell interactions in inflammation and cancer metastasis.</a> IEEE Engineering in Medicine and Biology Magazine. 20 (3), 86-91 (2001).</li><li>Fox, D. A., Gizinski, A., Morgan, R., Lundy, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+rheumatoid+arthritis+synovium.">Cell-cell interactions in rheumatoid arthritis synovium.</a> Rheumatic Diseases Clinics of North America. 36 (2), 311-323 (2010).</li><li>Yamagata, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+insights+into+modulation+and+selectivity+of+transsynaptic+neurexin-LRRTM+interaction.">Structural insights into modulation and selectivity of transsynaptic neurexin-LRRTM interaction.</a> Nature Communications. 9 (1), 3964 (2018).</li><li>Nguyen, T., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binding+properties+of+neuroligin+1+and+neurexin+1beta+reveal+function+as+heterophilic+cell+adhesion+molecules.">Binding properties of neuroligin 1 and neurexin 1beta reveal function as heterophilic cell adhesion molecules.</a> The Journal of Biological Chemistry. 272 (41), 26032-26039 (1997).</li><li>Boucard, A. A., Ko, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Affinity+Neurexin+Binding+to+Cell+Adhesion+G-protein-coupled+Receptor+CIRL1/Latrophilin-1+Produces+an+Intercellular+Adhesion+Complex.">High Affinity Neurexin Binding to Cell Adhesion G-protein-coupled Receptor CIRL1/Latrophilin-1 Produces an Intercellular Adhesion Complex.</a> Journal of Biological Chemistry. 287 (12), 9399-9413 (2012).</li></ol>

Die Autoren haben nichts zu verraten.

Die Sezieren der Protein-Protein-Wechselwirkungen, die während der Zelladhäsion im Trans auftreten, kann zu einem besseren Verständnis der molekularen Mechanismen führen, die grundlegenden zellulären Prozessen zugrunde liegen, einschließlich der Bildung, Funktion und Wartung von Synapsen während der Reifung und des Umbaus. Die Implikationen von Zell-zu-Zell-Interaktionen gehen über die Neurobiologie hinaus und spielen eine breitere Rolle bei der Signaltransduktion, Zellmigration und Gewebeentwicklung<sup class="x...

Synaptische Wechselwirkungen, die durch synaptische Adhäsionsmoleküle erleichtert werden, sind die Grundlage für die Entwicklung, Organisation, Spezifikation, Wartung und Funktion von Synapsen und die Erzeugung von neuronalen Netzwerken. Die Identifizierung dieser transsynaptischen Zelladhäsionsmoleküle nimmt rapide zu; Daher ist es von grundlegender Bedeutung, verbindliche Partner zu identifizieren und zu verstehen, wie diese neuen Adhäsionsmoleküle miteinander interagieren. Zusätzlich hat die Genomsequenzierung Mutationen in vielen dieser Adhäsionsmoleküle identifiziert, die häufig mit einer Vielzahl von neuroentwicklungsbedingten, neuropsychiatrischen und Suchterkrankungen verbunden sind1. Mutationen in Genen, die für synaptische Zelladhäsionsmoleküle kodieren, können Trans-Wechselwirkungen nachteilig verändern und zu pathophysiologischen Veränderungen bei der Synapsenbildung und-Erhaltung beitragen.
Es gibt mehrere Assays zur quantitativen Bewertung von Protein-Protein-Wechselwirkungen wie isotherme Kalorimetrie, kreisförmiger Dichroismus, Oberflächen-Plasmonresonanz2 und obwohl quantitativ, haben sie mehrere Einschränkungen. Erstens benötigen sie rekombinantes Protein, das manchmal langwierige und mühsame Reinigungsschritte erfordert. Zweitens erfordern sie eine ausgeklügelte Spezialausrüstung und technisches Know-how. Drittens können sie das Bindungsgrad überschätzen, da sie sowohl cis- als auch Trans-Wechselwirkungen zwischen Proteinen ermöglichen, die natürlicherweise in vivo an eine Membran gebunden sind. Hier schlagen wir einen einfachen und relativ schnellen Assay vor, der ausschließlich Trans-Interaktionen testet.
Um viele der Komplikationen im Zusammenhang mit gereinigten Protein-Assays zu umgehen, haben wir einen zellbasierten Protein-Interaktionstest optimiert, der Trans-Interaktionen in einem reduzierten heterologen Zellsystem rekapituliert. Dieser Assay wurde zuvor in verschiedenen Formen verwendet, um transzelluläre Wechselwirkungen zu untersuchen. Bei diesem Ansatz werden Kandidatenzelladhäsionsmoleküle in HEK293T-Zellen transfiziert. Unter physiologischen Bedingungen weisen HEK293T-Zellen keine Selbstaggregation auf, so dass sie beispielhafte Modelle für diesen Test aufweisen. Wenn jedoch einzelne Populationen von HEK-Zellen, die Rezeptor und Liganden exexegieren, kombiniert werden, erzwingt die Bindung des Rezeptors und des Liganden die Aggregation von HEK-Zellen. Diese Aggregation wird ausschließlich durch Transinteraktionen vermittelt und ist in der Regel in Dutzenden von Minuten beobachtbar. Bei dieser Methode sind keine Proteinreinigungsschritte erforderlich, und die Effizienz der Methode beruht auf dem Paradigma, dass Populationen von HEK-Zellen, die Cognate-Adhäsionsmoleküle exdrücken, kombiniert und dann nur zig Minuten später abgebildet werden. Darüber hinaus ist diese Methode relativ kostengünstig, da weder Antikörper noch kostspielige Ausrüstung erforderlich sind. Die einzige Ausrüstung, die für die Erfassung von Daten benötigt wird, ist ein Standard-Fluoreszenzmikroskop. Ein weiterer Vorteil dieses zellbasierten Assays ist die Fähigkeit, die Wirkung krankheitsrelevanter Punktmutationen auf Trans-Wechselwirkungen schnell zu untersuchen. Dies kann durch Transfizieren von HEK-Zellen mit cDNAs der mutierten Varianten des Proteins von Interesse durchgeführt werden.
In diesem Protokoll stellen wir ein Beispiel vor, in dem wir untersuchen, ob sich eine Missense-Mutation in Neurexin3 "(Neurexin3"A687T), die bei einem Patienten mit einer tiefen geistigen Behinderung und Epilepsie identifiziert wurde, wechselwirkungen im Trans mit Leucin-reichem Repeat-Transmembranprotein 2 (LRRTM2) verändert. Neurexin3 ist ein Mitglied der evolutionär konservierten Familie von präsynaptischen Zelladhäsionsmolekülen und während neuere Arbeiten mehrere Rollen an der Synapseidentifizierthaben 3,4,5,6,7, bleibt unser synaptisches Verständnis dieses Moleküls und aller Mitglieder der Neurexin-Familie unvollständig. LRRTM2 ist ein exzitatorisches postsynaptisches Zelladhäsionsprotein, das an der Synapsenbildung und-erhaltung8,9,10teilnimmt. Wichtig ist, dass LRRTM2 ausschließlich mit Neurexin-Isoformen interagiert, denen die Spleißstelle 4 alternatives Exon (SS4-) fehlt, aber nicht mit Neurexin-Isoformen, die die Spleißstelle 4 alternatives Exon (SS4+) enthalten. Die menschliche Missense-Mutation (A687T), die in Neurexin3 identifiziert wurde, befindet sich in einer nicht untersuchten extrazellulären Region, die evolutionär konserviert ist und zwischen allen Alpha-Neurexinenkonserviertwird 7 . Da die Wechselwirkung zwischen diesen beiden Molekülen8,9,11festgestellt wurde, stellten wir die Frage: Wird die Bindungsfähigkeit von Neurexin3' SS4- zu LRRTM2 durch eine A687T-Punktmutation verändert? Dieser Test ergab, dass die A687T-Punktmutation unerwartet die Aggregation von Neurexin3zu LRRTM2 verbesserte, was darauf hindeutet, dass die extrazelluläre Region, in der sich die Punktmutation befindet, eine Rolle bei der Vermittlung transsynaptischer Wechselwirkungen spielt.

<table><tbody><tr><td>1.5 mL disposable microtubes with snap caps</td><td>VWR</td><td>89000-028</td><td>Incubation of mixed population of HEK cells</td></tr><tr><td>1000 mL Rapid&amp;mdash;Flow Filter Unit, 0.2 um aPES membrane</td><td>Thermo Fisher</td><td>567-0020</td><td>Sterilization of HEK media</td></tr><tr><td>15 mL SpectraTube centrifuge tubes</td><td>Ward&amp;rsquo;s Science</td><td>470224-998</td><td>Harvesting HEK cells</td></tr><tr><td>6 well sterile tissue culture plates</td><td>VWR</td><td>100062-892</td><td>culturing HEK cells</td></tr><tr><td>Calcium Chloride</td><td>Sigma</td><td>223506-500G</td><td>Calcium phosphate transfection, HEK cell resuspension</td></tr><tr><td>Centrifuge- Sorvall Legend RT</td><td>Kendro Laboratory Products</td><td>75004377</td><td>Harvesting HEK cells</td></tr><tr><td>CO2 cell incubator</td><td>Thermo Scientific</td><td>HERACELL 150i</td><td>Incubation of HEK cells during growth</td></tr><tr><td>DMEM, 1x (Dulbecco&#039;s Modification of Eagle&#039;s Medium) with 4.5 g/L glucose, L-glutamine &amp;amp; sodium pyruvate</td><td>Corning</td><td>10-013-CV</td><td>HEK cell maintenance</td></tr><tr><td>Dulbecco&amp;rsquo;s Phosphate Buffered Saline PBS (1X)</td><td>Gibco</td><td>14190-144</td><td>Passaging/harvesting HEK cell</td></tr><tr><td>Ethylenediaminetetraacetic acid</td><td>Sigma</td><td>ED-500G</td><td>Harvesting HEK cells</td></tr><tr><td>Falcon Vented culture flasks, 75cm&lt;sup&gt;2&lt;/sup&gt; growth area</td><td>Corning</td><td>9381M26</td><td>Culturing HEK cells</td></tr><tr><td>Fetal Bovine Serum</td><td>Sigma</td><td>17L184</td><td>HEK cell maintenance</td></tr><tr><td>HEK293T cells</td><td>ATCC</td><td></td><td>Model system</td></tr><tr><td>ImageJ</td><td>NIH</td><td>V: 2.0.0-rc-69/1.52p</td><td>Image analysis</td></tr><tr><td>Magnesium Chloride hexahydrate</td><td>Sigma</td><td>M9272-500G</td><td>HEK cell resuspension</td></tr><tr><td>Sodium phosphate dibasic anhydrous</td><td>Fisher BioReagents</td><td>BP332-500</td><td>Calcium phosphate transfection</td></tr><tr><td>Trypsin 0.25% (1X) Solution</td><td>GE Healthcare Life Sciences</td><td>SH30042.01</td><td>Passaging HEK cells</td></tr><tr><td>Tube rotator</td><td></td><td></td><td>Incubation of mixed population of HEK cells</td></tr><tr><td>UltraClear Microscope slides. White Frosted, Positive Charged</td><td>Denville Scientific Inc.</td><td>M1021</td><td>Image acquisition</td></tr><tr><td>Wide-field microscope</td><td>Zeiss</td><td>Axio Vert 200M</td><td>Image acquisition</td></tr></tbody></table>

measuring transcellular interactions through protein aggregation in a heterologous cell system

Protein-Wechselwirkungen an zellulären Schnittstellen diktieren eine Vielzahl von biologischen Ergebnissen, die von der Gewebeentwicklung und Krebsprogression bis hin zur Synapsenbildung und -erhaltung reichen. Viele dieser grundlegenden Wechselwirkungen treten bei Trans auf und werden typischerweise durch heterophile oder homophile Wechselwirkungen zwischen Zellen induziert, die membranverankerte Bindungspaare exdrücken. Die Aufklärung, wie krankheitsrelevante Mutationen diese grundlegenden Proteinwechselwirkungen stören, kann Einen Einblick in eine Vielzahl von Zellbiologiefeldern geben. Viele Protein-Protein-Interaktions-Assays sind in der Regel nicht uneindeutig zwischen cis und Trans-Wechselwirkungen, was potenziell zu einer Überschätzung des In-vivo-Bindungsumfangs führt und eine arbeitsintensive Reinigung von Protein- und/oder spezialisierten Überwachungsgeräten beinhaltet. Hier präsentieren wir ein optimiertes einfaches Protokoll, das die Beobachtung und Quantifizierung von nur Trans-Wechselwirkungen ohne langwierige Proteinreinigungen oder spezielle Geräte ermöglicht. Der HEK-Zellaggregationstest beinhaltet das Mischen von zwei unabhängigen Populationen von HEK-Zellen, die jeweils membrangebundene Cognateligaden exdrücken. Nach einer kurzen Inkubationszeit werden Proben abgebildet und die resultierenden Aggregate quantifiziert.

Die A687T-Mutation erhöht die Neurexin3-SS4-Bindung an LRRTM27 Um zu untersuchen, wie interzelluläre Wechselwirkungen zweier bekannter synaptischer Proteine durch die Einführung einer Punktmutation bei einem Patienten mit geistiger Behinderung und Epilepsie beeinflusst werden, verwendeten wir den oben genannten HEK-Zellaggregationstest (Abbildung 1). Die Zellen wurden gemäß Abschnitt 1 transfiziert und für die Bildgebung gemäß den Abschnitten 1 und 2 de...

Watch this Scientific Journal Video about Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System at JoVE.com

Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Hier präsentieren wir ein optimiertes Protokoll zur schnellen und semiquantitativen Messung von Liganden-Rezeptor-Wechselwirkungen in Trans in einem heterologen Zellsystem mittels Fluoreszenzmikroskopie.

Messung transzellulärer Wechselwirkungen durch Proteinaggregation in einem heterologen Zellsystem

Protein interactions at cellular interfaces dictate a multitude of biological outcomes ranging from tissue development and cancer progression to synapse ...

measuring-transcellular-interactions-through-protein-aggregation

Research

JoVE Journal

Neuroscience

3.5K Aufrufe.  University of Colorado Denver School of Medicine. Hier präsentieren wir ein optimiertes Protokoll zur schnellen und semiquantitativen Messung von Liganden-Rezeptor-Wechselwirkungen in Trans in einem heterologen Zellsystem mittels Fluoreszenzmikroskopie.

Serie: Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Extracellular Protein Microarray Technology for High Throughput Detection of Low Affinity Receptor-Ligand Interactions

Secreted factors, membrane-tethered receptors, and their interacting partners are main regulators of cellular communication and initiation of signaling cascades during homeostasis and disease, and as such represent prime therapeutic targets. Despite their relevance, these interaction networks remain significantly underrepresented in current databases; therefore, most extracellular proteins have no documented binding partner. This discrepancy is primarily due to the challenges associated with the study of the extracellular proteins, including expression of functional proteins, and the weak, low affinity, protein interactions often established between cell surface receptors. The purpose of this method is to describe the printing of a library of extracellular proteins in a microarray format for screening of protein-protein interactions. To enable detection of weak interactions, a method based on multimerization of the query protein under study is described. Coupled to this microbead-based multimerization approach for increased multivalency, the protein microarray allows robust detection of transient protein-protein interactions in high throughput. This method offers a rapid and low sample consuming-approach for identification of new interactions applicable to any extracellular protein. Protein microarray printing and screening protocol are described. This technology will be useful for investigators seeking a robust method for discovery of protein interactions in the extracellular space.

Here, we present a protocol to screen extracellular protein microarrays for identification of novel receptor-ligand interactions in high throughput. We also describe a method to enhance detection of transient protein-protein interactions by using protein-microbead complexes.

Extrazelluläre Protein-Microarray-Technologie für hohen Durchsatz-Erkennung von geringe Affinität-Rezeptor-Ligand-Wechselwirkungen

Secreted factors, membrane-tethered receptors, and their interacting partners are main regulators of cellular communication and initiation of signaling ...

Forschung

Biochemie

A Fluorescence Fluctuation Spectroscopy Assay of Protein-Protein Interactions at Cell-Cell Contacts

A variety of biological processes involves cell-cell interactions, typically mediated by proteins that interact at the interface between neighboring cells. Of interest, only few assays are capable of specifically probing such interactions directly in living cells. Here, we present an assay to measure the binding of proteins expressed at the surfaces of neighboring cells, at cell-cell contacts. This assay consists of two steps: mixing of cells expressing the proteins of interest fused to different fluorescent proteins, followed by fluorescence fluctuation spectroscopy measurements at cell-cell contacts using a confocal laser scanning microscope. We demonstrate the feasibility of this assay in a biologically relevant context by measuring the interactions of the amyloid precursor-like protein 1 (APLP1) across cell-cell junctions. We provide detailed protocols on the data acquisition using fluorescence-based techniques (scanning fluorescence cross-correlation spectroscopy, cross-correlation number and brightness analysis) and the required instrument calibrations. Further, we discuss critical steps in the data analysis and how to identify and correct external, spurious signal variations, such as those due to photobleaching or cell movement.
In general, the presented assay is applicable to any homo- or heterotypic protein-protein interaction at cell-cell contacts, between cells of the same or different types and can be implemented on a commercial confocal laser scanning microscope. An important requirement is the stability of the system, which needs to be sufficient to probe diffusive dynamics of the proteins of interest over several minutes.

This protocol describes a fluorescence fluctuation spectroscopy-based approach to investigate interactions among proteins mediating cell-cell interactions, i.e. proteins localized in cell junctions, directly in living cells. We provide detailed guidelines on instrument calibration, data acquisition and analysis, including corrections to possible artefact sources.

Eine Fluoreszenz Fluktuation Spektroskopie Assay von Protein-Protein-Wechselwirkungen an den Zell-Zell-Kontakten

A variety of biological processes involves cell-cell interactions, typically mediated by proteins that interact at the interface between neighboring ...

Bead Aggregation Assays for the Characterization of Putative Cell Adhesion Molecules

Cell-cell adhesion is fundamental to multicellular life and is mediated by a diverse array of cell surface proteins. However, the adhesive interactions for many of these proteins are poorly understood. Here we present a simple, rapid method for characterizing the adhesive properties of putative homophilic cell adhesion molecules. Cultured HEK293 cells are transfected with DNA plasmid encoding a secreted, epitope-tagged ectodomain of a cell surface protein. Using functionalized beads specific for the epitope tag, the soluble, secreted fusion protein is captured from the culture medium. The coated beads can then be used directly in bead aggregation assays or in fluorescent bead sorting assays to test for homophilic adhesion. If desired, mutagenesis can then be used to elucidate the specific amino acids or domains required for adhesion. This assay requires only small amounts of expressed protein, does not require the production of stable cell lines, and can be accomplished in 4 days.

Here we present a simple, rapid method for characterizing the intrinsic adhesive properties of putative cell adhesion molecules. The secreted, epitope-tagged ectodomain of a cell adhesion molecule is captured from the culture medium on small, uniform functionalized beads. These beads can then be used immediately in simple bead aggregation assays.

Wulst Aggregationsassays zur Charakterisierung von putativen Zelladhäsionsmoleküle

Cell-cell adhesion is fundamental to multicellular life and is mediated by a diverse array of cell surface proteins. However, the adhesive interactions ...

Biotechnik

Monitoring Protein Aggregation Kinetics In Vivo using Automated Inclusion Counting in Caenorhabditis elegans

Protein aggregation into insoluble inclusions is a hallmark of a variety of human diseases, many of which are age-related. The nematode Caenorhabditis elegans is a well-established model organism that has been widely used in the field to study protein aggregation and toxicity. Its optical transparency enables the direct visualization of protein aggregation by fluorescence microscopy. Moreover, the fast reproductive cycle and short lifespan make the nematode a suitable model to screen for genes and molecules that modulate this process.
However, the quantification of aggregate load in living animals is poorly standardized, typically performed by manual inclusion counting under a fluorescence dissection microscope at a single time point. This approach can result in high variability between observers and limits the understanding of the aggregation process. In contrast, amyloid-like protein aggregation in vitro is routinely monitored by thioflavin T fluorescence in a highly quantitative and time-resolved fashion.
Here, an analogous method is presented for the unbiased analysis of aggregation kinetics in living C. elegans, using a high-throughput confocal microscope combined with custom-made image analysis and data fitting. The applicability of this method is demonstrated by monitoring inclusion formation of a fluorescently labeled polyglutamine (polyQ) protein in the body wall muscle cells. The image analysis workflow allows the determination of the numbers of inclusions at different timepoints, which are fitted to a mathematical model based on independent nucleation events in individual muscle cells. The method described here may prove useful to assess the effects of proteostasis factors and potential therapeutics for protein aggregation diseases in a living animal in a robust and quantitative manner.

Monitoring Protein Aggregation Kinetics In Vivo using Automated Inclusion Counting in Caenorhabditis elegans

Here, a method is presented for the analysis of protein aggregation kinetics in the nematode Caenorhabditis elegans. Animals from an age-synchronized population are imaged at different time points, followed by semiautomated inclusion counting in CellProfiler and fitting to a mathematical model in AmyloFit.

Überwachung der Proteinaggregationskinetik in vivo mittels automatisierter Einschlusszählung bei Caenorhabditis elegans

Protein aggregation into insoluble inclusions is a hallmark of a variety of human diseases, many of which are age-related. The nematode Caenorhabditis ...

Pulldown Assay Coupled with Co-Expression in Bacteria Cells as a Time-Efficient Tool for Testing Challenging Protein-Protein Interactions

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble effectively in vitro. Such complexes may require co-translational assembly and the presence of molecular chaperones; either they form stable oligomers which cannot dissociate and re-associate in vitro or are unstable without a binding partner. To overcome these problems, it is possible to use a method based on the bacterial co-expression of differentially tagged proteins using a set of compatible vectors followed by the conventional pulldown techniques. The workflow is more time-efficient compared to traditional pulldown because it lacks the time-consuming steps of separate purification of interacting proteins and their following incubation. Another advantage is a higher reproducibility due to a significantly smaller number of steps and a shorter period of time in which proteins that exist within the in vitro environment are exposed to proteolysis and oxidation. The method was successfully applied for studying a number of protein-protein interactions when other in vitro techniques were found to be unsuitable. The method can be used for batch testing protein-protein interactions. Representative results are shown for studies of interactions between BTB domain and intrinsically disordered proteins, and of heterodimers of zinc-finger-associated domains.

Here, we describe a method for the bacterial co-expression of differentially tagged proteins using a set of compatible vectors, followed by the conventional pulldown techniques to study protein complexes that cannot assemble in vitro.

Pulldown-Assay gekoppelt mit Co-Expression in Bakterienzellen als zeiteffizientes Werkzeug zum Testen anspruchsvoller Protein-Protein-Interaktionen

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble ...

4D Imaging of Protein Aggregation in Live Cells

One of the key tasks of any living cell is maintaining the proper folding of newly synthesized proteins in the face of ever-changing environmental conditions and an intracellular environment that is tightly packed, sticky, and hazardous to protein stability1. The ability to dynamically balance protein production, folding and degradation demands highly-specialized quality control machinery, whose absolute necessity is observed best when it malfunctions. Diseases such as ALS, Alzheimer's, Parkinson's, and certain forms of Cystic Fibrosis have a direct link to protein folding quality control components2, and therefore future therapeutic development requires a basic understanding of underlying processes. Our experimental challenge is to understand how cells integrate damage signals and mount responses that are tailored to diverse circumstances.
The primary reason why protein misfolding represents an existential threat to the cell is the propensity of incorrectly folded proteins to aggregate, thus causing a global perturbation of the crowded and delicate intracellular folding environment1. The folding health, or "proteostasis," of the cellular proteome is maintained, even under the duress of aging, stress and oxidative damage, by the coordinated action of different mechanistic units in an elaborate quality control system3,4. A specialized machinery of molecular chaperones can bind non-native polypeptides and promote their folding into the native state1, target them for degradation by the ubiquitin-proteasome system5, or direct them to protective aggregation inclusions6-9.
In eukaryotes, the cytosolic aggregation quality control load is partitioned between two compartments8-10: the juxtanuclear quality control compartment (JUNQ) and the insoluble protein deposit (IPOD) (Figure 1 - model). Proteins that are ubiquitinated by the protein folding quality control machinery are delivered to the JUNQ, where they are processed for degradation by the proteasome. Misfolded proteins that are not ubiquitinated are diverted to the IPOD, where they are actively aggregated in a protective compartment.
Up until this point, the methodological paradigm of live-cell fluorescence microscopy has largely been to label proteins and track their locations in the cell at specific time-points and usually in two dimensions. As new technologies have begun to grant experimenters unprecedented access to the submicron scale in living cells, the dynamic architecture of the cytosol has come into view as a challenging new frontier for experimental characterization. We present a method for rapidly monitoring the 3D spatial distributions of multiple fluorescently labeled proteins in the yeast cytosol over time. 3D timelapse (4D imaging) is not merely a technical challenge; rather, it also facilitates a dramatic shift in the conceptual framework used to analyze cellular structure.
We utilize a cytosolic folding sensor protein in live yeast to visualize distinct fates for misfolded proteins in cellular aggregation quality control, using rapid 4D fluorescent imaging. The temperature sensitive mutant of the Ubc9 protein10-12 (Ubc9ts) is extremely effective both as a sensor of cellular proteostasis, and a physiological model for tracking aggregation quality control. As with most ts proteins, Ubc9ts is fully folded and functional at permissive temperatures due to active cellular chaperones. Above 30 &deg;C, or when the cell faces misfolding stress, Ubc9ts misfolds and follows the fate of a native globular protein that has been misfolded due to mutation, heat denaturation, or oxidative damage. By fusing it to GFP or other fluorophores, it can be tracked in 3D as it forms Stress Foci, or is directed to JUNQ or IPOD.

Cellular viability depends on timely and efficient management of protein misfolding. Here we describe a method for visualizing the different potential fates of a misfolded protein: refolding, degradation, or sequestration in inclusions. We demonstrate the use of a folding sensor, Ubc9ts, for monitoring proteostasis and aggregation quality control in live cells using 4D microscopy.

4D-Bildgebung von Protein Aggregation in lebenden Zellen

One of the key tasks of any living cell is maintaining the proper folding of newly synthesized proteins in the face of ever-changing environmental ...

Biologie

Genetic and Biochemical Approaches for In Vivo and In Vitro Assessment of Protein Oligomerization: The Ryanodine Receptor Case Study

Oligomerization is often a structural requirement for proteins to accomplish their specific cellular function. For instance, tetramerization of the ryanodine receptor (RyR) is necessary for the formation of a functional Ca2+ release channel pore. Here, we describe detailed protocols for the assessment of protein self-association, including yeast two-hybrid (Y2H), co-immunoprecipitation (co-IP) and chemical cross-linking assays. In the Y2H system, protein self-interaction is detected by &#946;-galactosidase assay in yeast co-expressing GAL4 bait and target fusions of the test protein. Protein self-interaction is further assessed by co-IP using HA- and cMyc-tagged fusions of the test protein co-expressed in mammalian HEK293 cells. The precise stoichiometry of the protein homo-oligomer is examined by cross-linking and SDS-PAGE analysis following expression in HEK293 cells. Using these different but complementary techniques, we have consistently observed the self-association of the RyR N-terminal domain and demonstrated its intrinsic ability to form tetramers. These methods can be applied to protein-protein interaction and homo-oligomerization studies of other mammalian integral membrane proteins.

Genetic and Biochemical Approaches for In Vivo and In Vitro Assessment of Protein Oligomerization: The Ryanodine Receptor Case Study

Oligomerization of the ryanodine receptor, a homo-tetrameric ion channel mediating Ca2+ release from intracellular stores, is critical for skeletal and cardiac muscle contraction. Here, we present complementary in vivo and in vitro methods to detect protein self-association and determine homo-oligomer stoichiometry.

Genetische und biochemische Ansätze für<em&gt; In Vivo</em&gt; und<em&gt; In Vitro</em&gt; Beurteilung von Protein Oligomerisierung: Der Ryanodinrezeptor Case Study

Oligomerization is often a structural requirement for proteins to accomplish their specific cellular function. For instance, tetramerization of the ...

In Situ Monitoring of Transiently Formed Molecular Chaperone Assemblies in Bacteria, Yeast, and Human Cells

J-domain proteins (JDPs) form the largest and the most diverse co-chaperone family in eukaryotic cells. Recent findings show that specific members of the JDP family could form transient heterocomplexes in eukaryotes to fine-tune substrate selection for the 70 kDa heat shock protein (Hsp70) chaperone-based protein disaggregases. The JDP complexes target acute/chronic stress induced aggregated proteins and presumably help assemble the disaggregases by recruiting multiple Hsp70s to the surface of protein aggregates. The extent of the protein quality control (PQC) network formed by these physically interacting JDPs remains largely uncharacterized in vivo. Here, we describe a microscopy-based in situ protein interaction assay named the proximity ligation assay (PLA), which is able to robustly capture&#160;these transiently formed chaperone complexes in distinct cellular compartments of eukaryotic cells. Our work expands the employment of PLA from human cells to yeast (Saccharomyces cerevisiae) and bacteria (Escherichia coli), thus rendering an important tool to monitor the dynamics of transiently formed protein assemblies in both prokaryotic and eukaryotic cells.

Cognate J-domain proteins cooperate with the Hsp70 chaperone to assist in a myriad of biological processes ranging from protein folding to degradation. Here, we describe an in situ proximity ligation assay, which allows the monitoring of these transiently formed chaperone machineries in bacterial, yeast and human cells.

In Situ-Überwachung von transient gebildeten molekularen Chaperon-Baugruppen in Bakterien, Hefe und menschlichen Zellen

J-domain proteins (JDPs) form the largest and the most diverse co-chaperone family in eukaryotic cells. Recent findings show that specific members of the ...

Lebendzell-Einzelmolekül-Imaging-basierte Quantifizierung von Proteininteraktionen

Single-Molecule Measurement of Protein Interaction Dynamics Within Biomolecular Condensates

Biomolecular condensates formed via liquid-liquid phase separation (LLPS) have been considered critical in cellular organization and an increasing number of cellular functions. Characterizing LLPS in live cells is also important because aberrant condensation has been linked to numerous diseases, including cancers and neurodegenerative disorders. LLPS is often driven by selective, transient, and multivalent interactions between intrinsically disordered proteins. Of great interest are the interaction dynamics of proteins participating in LLPS, which are well-summarized by measurements of their binding residence time (RT), that is, the amount of time they spend bound within condensates. Here, we present a method based on live-cell single-molecule imaging that allows us to measure the mean RT of a specific protein within condensates. We simultaneously visualize individual protein molecules and the condensates with which they associate, use single-particle tracking (SPT) to plot single-molecule trajectories, and then fit the trajectories to a model of protein-droplet binding to extract the mean RT of the protein. Finally, we show representative results where this single-molecule imaging method was applied to compare the mean RTs of a protein at its LLPS condensates when fused and unfused to an oligomerizing domain. This protocol is broadly applicable to measuring the interaction dynamics of any protein that participates in LLPS.

Autor im Rampenlicht: Bewertung der Protein-Kondensat-Dynamik in lebenden menschlichen Zellen

Many intrinsically disordered proteins have been shown to participate in the formation of highly dynamic biomolecular condensates, a behavior important for numerous cellular processes. Here, we present a single-molecule imaging-based method for quantifying the dynamics by which proteins interact with each other in biomolecular condensates in live cells.

Einzelmolekülmessung der Proteininteraktionsdynamik in biomolekularen Kondensaten

Biomolecular condensates formed via liquid-liquid phase separation (LLPS) have been considered critical in cellular organization and an increasing number ...

Messung transzellulärer Wechselwirkungen durch Proteinaggregation in einem heterologen Zellsystem

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Extrazelluläre Protein-Microarray-Technologie für hohen Durchsatz-Erkennung von geringe Affinität-Rezeptor-Ligand-Wechselwirkungen

Eine Fluoreszenz Fluktuation Spektroskopie Assay von Protein-Protein-Wechselwirkungen an den Zell-Zell-Kontakten

Wulst Aggregationsassays zur Charakterisierung von putativen Zelladhäsionsmoleküle

Überwachung der Proteinaggregationskinetik in vivo mittels automatisierter Einschlusszählung bei Caenorhabditis elegans

Pulldown-Assay gekoppelt mit Co-Expression in Bakterienzellen als zeiteffizientes Werkzeug zum Testen anspruchsvoller Protein-Protein-Interaktionen

4D-Bildgebung von Protein Aggregation in lebenden Zellen

Genetische und biochemische Ansätze für

In Situ-Überwachung von transient gebildeten molekularen Chaperon-Baugruppen in Bakterien, Hefe und menschlichen Zellen

Einzelmolekülmessung der Proteininteraktionsdynamik in biomolekularen Kondensaten

Einzelmolekülmessung der Proteininteraktionsdynamik in biomolekularen Kondensaten