Bu çalışma, Ulusal Ruh Sağlığı Enstitüsü'nden (R00MH103531 ve R01MH116901'den J.A.'ya), Ulusal Genel Tıp Enstitüsü'nden (T32GM007635'ten S.R.'ye) doktora öncesi eğitim Hibesi ve Lyda Hill Gilliam İleri Çalışma Bursu (GT11021'den S.R.'a) tarafından desteklendi. Mikroskopla ilgili yardımları için Dr. Kevin Woolfrey'e, epifluoresan mikroskopunun kullanımı için Dr. K Ulrich Bayer'e ve LRRTM2 plazmidi için Thomas Südhof'a (Stanford Üniversitesi) teşekkür ederiz.

1. Hücre kültürü ve transfeksiyon
<ol><li>DMEM, 1x (Dulbecco'nun Eagle's Medium Modifikasyonu) ile 4,5 g/L glikoz, L-glutamin ve sodyum piruvat ve %10 FBS ile desteklenmiş HEK hücre ortamı yapın. Steril filtre.</li>
	<li>Toplama tahlilleri için predetermin uygun ligandlar ve reseptörler. NOT: Bu çalışmada Neurexin3α SS4+/- ve bilinen ligandlarından biri olan LRRTM2 kullanılmıştır. Ligandlar ve ilgi reseptörleri pcDNA3.1'deki cDNA'lardan ifade edildi. Neurexin3α'yı pcDNA3.112'yeyerleştirmek için bir Gibson montajı kullanıldı. Neurexin3α F/R: TTTAAACTTAAGCTTGGTACCGAGCTCGGATCCGCCACCATGAGCTTTACCCTCCACTC/ GAGCGGCCGCCACTGTGCTGGATCTGCAGAATTCTTACATAATACTCCTTGTCCTT.</li>
	<li>HEK293T hücrelerini hazırlayın.<ol>
<li>HEK293T hücrelerini tek bir T-75 şişesinde izdiah etmek için büyütün.</li>
		<li>Birleştiğinde, 2 mL tripsin kullanın ve 2 dakika boyunca 37 °C inkübatöre yerleştirin. Hücreleri yeniden çıkarmak için şişeye 6 mL HEK ortamı ekleyin ve 8 mL'nin tamamını 15 mL konik bir tüpe aktarın.</li>
		<li>5 dakika boyunca 500 x g'da pelet ve toplam 8 mL için HEK hücre medyasında yeniden dirildi.</li>
		<li>Hücreleri sayın ve 6 kuyulu bir plakanın her kuyusuna 735.000 hücre ekleyin. HEK hücre ortamı kullanarak her kuyu için son ses seviyesini 2 mL'ye ayarlayın.</li>
		<li>37 °C inkübatöre yerleştirin ve hücrelerin bir gecede veya% 50-60 izdiah edene kadar büyümesine izin verin.</li>
	</ol></li>
	<li>Kalsiyum fosfat yöntemini kullanarak HEK293T hücrelerini transfect13.<ol>
<li>Well-1'i 3 μg faiz proteini ile transfect ve 1 μg floresan protein (3 μg pcDNA3.1-Neurexin3αWT SS4- ve 1 μg mCherry) ile birlikte transfect.</li>
		<li>1.4.1 adımında olduğu gibi well-2'ye transfect. ancak mutasyona uğramış ilgi proteini ile (pcDNA3.1-Neurexin3αA687T SS4-).</li>
		<li>3 μg faizli ligand ile well-3'ü transfect ve 1 μg başka bir floresan protein (3 μg pcDNA3.1 LRRTM2 ve 1 μg GFP).</li>
		<li>Negatif kontroller olarak hizmet etmek için kuyu-4 ve kuyu-5'i transfect: 1 μg GFP ile well-4 ve 1 μg mCherry ile well-5.</li>
		<li>Ek koşullar veya kontroller (Neurexin3αWT/A687T SS4+) gerekiyorsa başka bir plaka hazırlayın (adım 1.4.1-1.4.4'te olduğu gibi). NOT: Transfeksiyon verimliliği, bir epifluoresans mikroskobu altında transeksiyondan 24 saat sonra analiz edilir ve transektife edildikleri floresan proteini ifade eden hücre sayısı olarak ölçülür. Daha aerodinamik bir yaklaşım, HEK hücrelerinin floresan bir protein ve ilgi alanı için bicistronic vektör kodlaması ile transfectionını içerecektir ve ko-transfection üzerinde şiddetle tavsiye edilir. Bu çalışmada alfa Neurexins ~4.3 kb'dir ve ko-transfeksiyon gerektiren bir bicistronik sistem kullanılarak düşük floresan yoğunluğu gözlenmiştir.</li>
	</ol></li>
	<li>Transfection'dan 48 saat sonra, toplama için hücreleri toplar.<ol>
<li>PBS ile her kuyuya iki kez yıkayın.</li>
		<li>Hücreden hücreye etkileşimleri nazikçe ayırmak ve plakayı 5 dakika boyunca 37 °C'de kuluçkaya yatırmak için her kuyuya PBS'de 1 mL 10 mM EDTA ekleyin. NOT: Çalışmada yapışma moleküllerinin potansiyel proteolitik bölünmesi nedeniyle 1.5.2. adım için tripsin önerilmez. Ayrıca, EDTA eklendikten sonra, hücreler artık ortam koşullarına maruz kalacağından, protokol tamamlanana kadar durdurulmayabilir.</li>
		<li>Hücreleri ayırmak için plakaya hafifçe dokunun ve her kuyuyu ayrı 15 mL konik tüpler halinde hasat edin.</li>
		<li>500 x g'da santrifüj konik tüpler ve 5 dakika oda sıcaklığında.</li>
	</ol></li>
	<li>Hücreler peletlenirken, her mikrosantrifüj tüpünün üstünü her koşulda etiketleyerek 6 kuluçka tüpü hazırlayın. NOT: GFP ve mCherry koşullarının her permütasyonu, tüm deneysel koşulları ve uygun kontrolleri kapsayacak şekilde kullanılmalıdır. Örneğin: 1. GFP/mCherry, 2. mCherry/LRRTM2-GFP 3. GFP/Neurexin3αWT SS4-—mCherry, 4. GFP/Neurexin3αA687T SS4- –mCherry, 5. Neurexin3αWT SS4-—mCherry/LRRTM2—GFP, 6. Neurexin3αA687T SS4- –mCherry/LRRTM2—GFP. Daha fazla koşul ve kontrole uyum sağlamak için ek tüpler yapın.</li>
	<li>10 mM CaCl 2 ve 10 mM MgCl 2 ile 37 °C'yeısıtılmış 500μL HEK ortamdaki süpernatant ve resuspend hücrelerini çıkarın. NOT: CaCl2 ve MgCl2'nin eklenmesi, yapışma moleküllerinin bağlamayı yeniden kurmasını sağlar ve yalnızca söz konusu hücrelerarası etkileşim ortakları yapışma için dalgıç katyonları gerektiriyorsa gereklidir.</li>
	<li>Her 15 mL konik tüpteki hücreleri bir hemositometre ve aliquot 200.000 hücre kullanarak, toplam 500 μL hacimde 1:1 karışım için adım 1.6.1'den uygun tüpe sayın. NOT: Saymak ve aliquot miktarları için koşul başına sadece 5 dakika sürmelidir.</li>
	<li>Tüpleri oda sıcaklığında yavaş bir tüp rotatorunda kuluçkaya yatırın.</li>
</ol>2. Görüntü alımı
<ol><li>Belirli numuneler için mikroskop alma parametrelerini optimize edin. Bu örnekte, görüntüler geniş alan mikroskopunda alınmıştır. 5x hava hedefi kullanın (NA: 0.15; WD: 20000 μm) analiz için yeterince büyük bir alan elde etmek için.</li>
	<li>1.8. adımda HEK hücrelerinin iki koşulunun karıştırılmasından hemen sonra taban çizgisi toplamayı değerlendirin. Bunlar artık 'sıfır zamanı' görüntüleri.<ol>
<li>Pipet 40 μL her örnek karışımın yüklü bir mikroskop slayt ve görüntü floresan altında hem 488 hem de 561 kanallarda.</li>
		<li>Örnek bırakma başına bir odak düzleminden üç farklı görüş alanı elde edin.</li>
	</ol>
</li>
	<li>'Time 60' görüntüsü olarak 60 dakikada son görüntüleri elde edin.<ol>
<li>60 dakikalık bir inkübasyondan sonra karışımın 'time 60' görüntüsünü elde etmek için, dönen tüplerden her durumun 40 μL'lik bir örneğini daha alın ve her numuneyi yüklü bir kaydırağa pipetleyin. Resim adım 2.2.2'deki gibi. NOT: Doygunluk gerçekleşene kadar hücre toplama her 15 dakikada bir kontrol edilmelidir. Toplamanın zamanlaması test edilen proteinlere bağlı olacaktır.</li>
	</ol>
</li>
</ol>3. ImageJ/Fiji Analizi
<ol><li>Fiji/ImageJ kullanarak toplamanın kapsamını ölçmek için analiz dosyalarını kaydedin.<ol>
<li>Sağlanan Ek kodlama dosyalarını bilgisayardaki imageJ makrolar klasörüne kaydedin.</li>
		<li>Sağlanan toplama makrosunu yükleyin (Eklentiler, Makrolar, Yükle ve "AggregationAssay.txt" dosyasını seçin).</li>
	</ol>
</li>
	<li>Eşikleri belirleyin.<ol>
<li>ImageJ'e 'sıfır zaman' .tif dosyası yükleyin ve kanalları bölün (Resim | Renk | Kanalları Böl). NOT: 'Sıfır süresi' görüntüsü, tüm deneme için eşik ve en küçük nokta boyutunu belirlemek için kullanılır.</li>
		<li>Her kanalı maskele (Eklentiler | Makrolar | AggregationAssay_MakeMask). Görüntüden Maske Yap penceresi görünecektir. Görüntü eşiğini belirle ve Histogram'dan Küme Paramlarını Belirle 'nin yanındaki onay kutuları tamam'ı tıklatın.</li>
		<li>Slayt çubuğunu kullanarak görüntünün eşiğini belirleyin, sayıyı slayt çubuğunun sağ kısmına kaydedin ve Tamam 'ıtıklatın.</li>
		<li>Küme Boyutu histogramı görünecektir. Histogramdan denemeye uygun bir küme boyutu seçin, bu sayıyı En Küçük Küme Boyutu: kutusuna yazın ve Tamam 'ıtıklatın. Bu boyutun altındaki kümeler çözümlenmez.</li>
	</ol>
</li>
	<li>Analizi çalıştır.<ol>
<li>ImageJ'de koşul 1'in 'time 60' görüntüsünü açın ve kanalları adım 3.2.1'deki gibi bölün.</li>
		<li>Her kanalı maskeleyin (Eklentiler, Makrolar, AggregationAssay_MakeMask). 3.2.3 ve adım 3.2.4'te belirlenen eşik ve boyutu kullanın. Görüntü eşiğini belirleme ve Histogram'dan Küme Paramlarını Belirleme'nin yanındaki kutuların seçimini kaldırın ve boyutu ve eşikleri uygun alanlara el ile yazın ve Tamam'ı tıklatın.</li>
		<li>Toplama dizinini hesaplama (Eklentiler | Makrolar | AggregationAssay_CalculateOverlap). Karşılaştırılacak maskelenmiş kanalları ve elde edilen dosyaların kaydedileceği dizini seçin.</li>
		<li>Her koşulda her 'zaman 60' görüntüsü için 3.3.1–3.3.3 adımlarını yineleyin. NOT: Toplama dizini, iki kanal alanının toplamına bölünen toplam çakışma alanı eksi örtüşme alanının 100 ile çarpışması olarak tanımlanır (Toplama indeksi = çakışma alanı/[kanal 1 alanı + kanal 2 alanı – örtüşme alanı] x 100). Bu normalleştirme, her iki maskedeki toplam pikselleri temsil eden iki maskelenmiş kanal arasında bir 'OR' işlemidir.</li>
	</ol>
</li>
</ol>

<ol>
	<li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroligins+and+neurexins+link+synaptic+function+to+cognitive+disease.">Neuroligins and neurexins link synaptic function to cognitive disease.</a> Nature. 455 (7215), 903-911 (2008).</li><li>Lakey, J. H., Raggett, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+protein-protein+interactions.">Measuring protein-protein interactions.</a> Current Opinion in Structural Biology. 8 (1), 119-123 (1998).</li><li>Aoto, J., Martinelli, D. C., Malenka, R. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Presynaptic+neurexin-3+alternative+splicing+trans-synaptically+controls+postsynaptic+AMPA+receptor+trafficking.">Presynaptic neurexin-3 alternative splicing trans-synaptically controls postsynaptic AMPA receptor trafficking.</a> Cell. 154 (1), 75-88 (2013).</li><li>Aoto, J., F&#246;ldy, C., Ilcus, S. M. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+circuit-dependent+functions+of+presynaptic+neurexin-3+at+GABAergic+and+glutamatergic+synapses.">Distinct circuit-dependent functions of presynaptic neurexin-3 at GABAergic and glutamatergic synapses.</a> Nature Neuroscience. 18 (7), 997-1007 (2015).</li><li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+Neurexin+Complexes:+A+Molecular+Code+for+the+Logic+of+Neural+Circuits.">Synaptic Neurexin Complexes: A Molecular Code for the Logic of Neural Circuits.</a> Cell. 171 (4), 745-769 (2017).</li><li>Dai, J., Aoto, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+Splicing+of+Presynaptic+Neurexins+Differentially+Controls+Postsynaptic+NMDA+and+AMPA+Receptor+Responses.">Alternative Splicing of Presynaptic Neurexins Differentially Controls Postsynaptic NMDA and AMPA Receptor Responses.</a> Neuron. 102 (5), 993-1008 (2019).</li><li>Restrepo, S., Langer, N. J., Nelson, K. A., Aoto, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+a+Neurexin-3&#945;+Human+Mutation+in+Mouse+Neurons+Identifies+a+Novel+Role+in+the+Regulation+of+Transsynaptic+Signaling+and+Neurotransmitter+Release+at+Excitatory+Synapses.">Modeling a Neurexin-3&#945; Human Mutation in Mouse Neurons Identifies a Novel Role in the Regulation of Transsynaptic Signaling and Neurotransmitter Release at Excitatory Synapses.</a> The Journal of Neuroscience. 39 (46), 9065-9082 (2019).</li><li>Ko, J., Fuccillo, M. V., Malenka, R. C., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Functions+as+a+Neurexin+Ligand+in+Promoting+Excitatory+Synapse+Formation.">LRRTM2 Functions as a Neurexin Ligand in Promoting Excitatory Synapse Formation.</a> Neuron. 64 (6), 791-798 (2009).</li><li>de Wit, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Interacts+with+Neurexin1+and+Regulates+Excitatory+Synapse+Formation.">LRRTM2 Interacts with Neurexin1 and Regulates Excitatory Synapse Formation.</a> Neuron. 64 (6), 799-806 (2009).</li><li>Linhoff, M. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Unbiased+Expression+Screen+for+Synaptogenic+Proteins+Identifies+the+LRRTM+Protein+Family+as+Synaptic+Organizers.">An Unbiased Expression Screen for Synaptogenic Proteins Identifies the LRRTM Protein Family as Synaptic Organizers.</a> Neuron. 61 (5), 734-749 (2009).</li><li>Siddiqui, T. J., Pancaroglu, R., Kang, Y., Rooyakkers, A., Craig, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTMs+and+Neuroligins+Bind+Neurexins+with+a+Differential+Code+to+Cooperate+in+Glutamate+Synapse+Development.">LRRTMs and Neuroligins Bind Neurexins with a Differential Code to Cooperate in Glutamate Synapse Development.</a> Journal of Neuroscience. 30 (22), 7495-7506 (2010).</li><li>Gibson, D. G., Young, L., Chuang, R. -. Y., Venter, J. C., Hutchison, C. A., Smith, H. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nature Methods. 6 (5), 343-345 (2009).</li><li>Bacchetti, S., Graham, F. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfer+of+the+gene+for+thymidine+kinase+to+thymidine+kinase-deficient+human+cells+by+purified+herpes+simplex+viral+DNA.">Transfer of the gene for thymidine kinase to thymidine kinase-deficient human cells by purified herpes simplex viral DNA.</a> Proceedings of the National Academy of Sciences of the United States of America. 74 (4), 1590-1594 (1977).</li><li>Cerchiari, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+strategy+for+tissue+self-organization+that+is+robust+to+cellular+heterogeneity+and+plasticity.">A strategy for tissue self-organization that is robust to cellular heterogeneity and plasticity.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (7), 2287-2292 (2015).</li><li>Burdick, M. M., McCarty, O. J. T., Jadhav, S., Konstantopoulos, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+inflammation+and+cancer+metastasis.">Cell-cell interactions in inflammation and cancer metastasis.</a> IEEE Engineering in Medicine and Biology Magazine. 20 (3), 86-91 (2001).</li><li>Fox, D. A., Gizinski, A., Morgan, R., Lundy, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+rheumatoid+arthritis+synovium.">Cell-cell interactions in rheumatoid arthritis synovium.</a> Rheumatic Diseases Clinics of North America. 36 (2), 311-323 (2010).</li><li>Yamagata, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+insights+into+modulation+and+selectivity+of+transsynaptic+neurexin-LRRTM+interaction.">Structural insights into modulation and selectivity of transsynaptic neurexin-LRRTM interaction.</a> Nature Communications. 9 (1), 3964 (2018).</li><li>Nguyen, T., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binding+properties+of+neuroligin+1+and+neurexin+1beta+reveal+function+as+heterophilic+cell+adhesion+molecules.">Binding properties of neuroligin 1 and neurexin 1beta reveal function as heterophilic cell adhesion molecules.</a> The Journal of Biological Chemistry. 272 (41), 26032-26039 (1997).</li><li>Boucard, A. A., Ko, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Affinity+Neurexin+Binding+to+Cell+Adhesion+G-protein-coupled+Receptor+CIRL1/Latrophilin-1+Produces+an+Intercellular+Adhesion+Complex.">High Affinity Neurexin Binding to Cell Adhesion G-protein-coupled Receptor CIRL1/Latrophilin-1 Produces an Intercellular Adhesion Complex.</a> Journal of Biological Chemistry. 287 (12), 9399-9413 (2012).</li></ol>

Yazarların açıklayacak bir şeyi yok.

Hücre yapışması sırasında transta meydana gelen protein-protein etkileşimlerinin parçalanması, olgunlaşma ve yeniden şekillendirme sırasında sinapsların oluşumu, işlevi ve bakımı da dahil olmak üzere temel hücresel süreçlerin altında bulunan moleküler mekanizmaların daha iyi anlaşılmasına neden olabilir. Hücreden hücreye etkileşimlerin etkileri nörobiyolojinin ötesine genişler ve sinyal transdüksiyonunda, hücre göçünde ve doku gelişiminde daha geniş rollere sahiptir<sup class="xre...

Sinaptik yapışma molekülleri tarafından kolaylaştırılan sinaptik etkileşimler, sinapsların gelişimi, organizasyonu, spesifikasyonu, bakımı ve işlevi ve sinir ağlarının üretimi için temeldir. Bu transsynaptik hücre yapışma moleküllerinin tanımlanması hızla artmaktadır; bu nedenle, bağlayıcı ortakları tanımlamak ve bu yeni yapışma moleküllerinin birbirleriyle nasıl etkileşime girdiğini anlamak temel olarak önemlidir. Ek olarak, genom dizilimi, yaygın olarak çok sayıda nörogelişimsel, nöropsikiyatrik ve bağımlılık bozukluğu ile bağlantılı olan bu yapışma moleküllerinin çoğunda mutasyonlar tanımlamıştır1. Sinaptik hücre yapışma moleküllerini kodlayan genlerdeki mutasyonlar trans etkileşimlerini zararlı bir şekilde değiştirebilir ve sinaps oluşumunda ve bakımında patofizyolojik değişikliklere katkıda bulunabilir.
İzotermal kalorimetre, dairesel dikroizm, yüzey plazmon rezonansı2 gibi protein-protein etkileşimlerini nicel olarak değerlendirmek için birden fazla tahlil mevcuttur ve doğada nicel olmasına rağmen, birkaç sınırlamaları vardır. İlk olarak, bazen uzun ve sıkıcı saflaştırma adımları gerektiren rekombinant protein gerektirirler. İkincisi, sofistike özel ekipman ve teknik uzmanlık gerektirirler. Üçüncüsü, doğal olarak bir membran in vivo'ya bağlı proteinler arasında hem cis hem de trans etkileşimlerine izin verdikleri için bağlamanın kapsamını abartabilirler. Burada sadece trans etkileşimlerini test eden basit ve nispeten hızlı bir test öneriyoruz.
Saflaştırılmış protein testleriyle ilişkili komplikasyonların çoğunu atlatmak için, azaltılmış heterolog hücre sisteminde trans etkileşimlerini yeniden sağlayan hücre bazlı bir protein etkileşimi testini optimize ettik. Bu test daha önce hücrelerarası etkileşimleri incelemek için çeşitli şekillerde kullanılmıştır. Bu yaklaşımda aday hücre yapışma molekülleri HEK293T hücrelerine aktarılır. Fizyolojik koşullarda, HEK293T hücreleri kendi kendine toplama sergilemez, bu da onları bu test için örnek modeller haline getirir. Bununla birlikte, reseptör ve ligand ifade eden HEK hücrelerinin bireysel popülasyonları birleştirildiğinde, reseptörün bağlanması ve ligand HEK hücrelerinin toplanmasına zorlar. Bu toplama sadece trans etkileşimleri tarafından aracılık edilir ve genellikle onlarca dakika içinde gözlemlenebilir. Bu yöntemde protein saflaştırma adımlarına gerek yoktur ve yöntemin verimliliği, kognate yapışma moleküllerini ifade eden HEK hücrelerinin popülasyonlarının birleştirildiği ve sadece on dakika sonra görüntülandığı paradigmasına dayanır. Ek olarak, bu yöntem nispeten ucuzdur, çünkü ne antikorlar ne de pahalı ekipmanlar gereklidir. Verilerin eldei için gerekli olan tek ekipman standart bir floresan mikroskoptur. Bu hücre bazlı testin ek bir avantajı, hastalıkla ilgili nokta mutasyonlarının trans etkileşimleri üzerindeki etkisini hızlı bir şekilde tarama yeteneğidir. Bu, ilgi çekici proteinin mutant varyantlarının cDNA'ları ile HEK hücrelerinin transfecting ile gerçekleştirilerek gerçekleştirilebilir.
Bu protokolde, derin zihinsel engellilik ve epilepsi tanısı alan bir hastada tanımlanan Neurexin3α'daki (Neurexin3αA687T)bir yanlış beyin mutasyonu,lösin bakımından zengin tekrarlayan transmembran protein 2 (LRRTM2) ile trans etkileşimlerini değiştirip değiştirmediğini araştırdığımız bir örnek sunuyoruz. Neurexin3α, evrimsel olarak korunmuş presinaptik hücre yapışma molekülleri ailesinin bir üyesidir ve son çalışmalar sinaps3, 4,5,6,7'debirden fazla rol belirlemiş olsa da, bu molekül ve neüroksin ailesinin tüm üyelerine ilişkin sinaptik anlayışımız eksik kalır. LRRTM2, sinaps oluşumu ve bakımı 8,9,10'akatılan uyarıcı bir postynaptik hücre yapıştırma proteinidir. Daha da önemlisi, LRRTM2 sadece splice bölgesi 4 alternatif eksondan (SS4-) yoksun neurexin izoformları ile etkileşime girer, ancak splice bölgesi 4 alternatif ekson (SS4 +) içeren neurexin izoformları ile etkileşime girmez. Neurexin3α'da tanımlanan insan missense mutasyonu (A687T), evrimsel olarak korunan ve tüm alfa neurexins7arasında korunan, unstudied hücre dışı bir bölgede bulunur. Bu iki molekül arasındaki etkileşimkurulduğundan 8,9,11, şu soruyu ortaya attık: Neurexin3α SS4- to LRRTM2'nin bağlanma kabiliyeti bir A687T nokta mutasyonu ile mi değiştirildi? Bu tahlil, A687T nokta mutasyonunun beklenmedik bir şekilde Neurexin3α'nın toplanmasını LRRTM2'ye artırdığını ve nokta mutasyonunun bulunduğu hücre dışı bölgenin transsinaptik etkileşimlere aracılık etmede rol oynadığını ortaya koydu.

<table border="0" cellpadding="0" cellspacing="0" style="width:788px;" width="787">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="60">
			<td height="60" style="height:60px;width:339px;">1.5 mL disposable microtubes with snap caps</td>
			<td style="width:121px;">VWR</td>
			<td style="width:161px;">89000-028</td>
			<td style="width:167px;">Incubation of mixed population of HEK cells</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">1000 mL Rapid&#8212;Flow Filter Unit, 0.2 um aPES membrane</td>
			<td style="width:121px;">Thermo Fisher</td>
			<td style="width:161px;">567-0020</td>
			<td style="width:167px;">Sterilization of HEK media</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">15 mL SpectraTube centrifuge tubes</td>
			<td style="width:121px;">Ward&#8217;s Science</td>
			<td style="width:161px;">470224-998</td>
			<td style="width:167px;">Harvesting HEK cells</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">6 well sterile tissue culture plates</td>
			<td style="width:121px;">VWR</td>
			<td style="width:161px;">100062-892</td>
			<td style="width:167px;">culturing HEK cells</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:339px;">Calcium Chloride</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">223506-500G</td>
			<td style="width:167px;">Calcium phosphate transfection, HEK cell resuspension</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:45px;width:339px;">Centrifuge- Sorvall Legend RT</td>
			<td style="width:121px;">Kendro Laboratory Products</td>
			<td align="right" style="width:161px;">75004377</td>
			<td style="width:167px;">Harvesting HEK cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:22px;width:339px;">CO2 cell incubator</td>
			<td style="width:121px;">Thermo Scientific</td>
			<td style="width:161px;">HERACELL 150i</td>
			<td style="width:167px;">Incubation of HEK cells during growth</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:339px;">DMEM, 1x (Dulbecco&#39;s Modification of Eagle&#39;s Medium) with 4.5 g/L glucose, L-glutamine &#38; sodium pyruvate</td>
			<td style="width:121px;">Corning</td>
			<td style="width:161px;">10-013-CV</td>
			<td style="width:167px;">HEK cell maintenance</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">Dulbecco&#8217;s Phosphate Buffered Saline PBS (1X)</td>
			<td style="width:121px;">Gibco</td>
			<td style="width:161px;">14190-144</td>
			<td style="width:167px;">Passaging/harvesting HEK cell</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">Ethylenediaminetetraacetic acid</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">ED-500G</td>
			<td style="width:167px;">Harvesting HEK cells</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:339px;">Falcon Vented culture flasks, 75cm2 growth area</td>
			<td style="width:121px;">Corning</td>
			<td style="width:161px;">9381M26</td>
			<td style="width:167px;">Culturing HEK cells</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">Fetal Bovine Serum</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">17L184</td>
			<td style="width:167px;">HEK cell maintenance</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">HEK293T cells</td>
			<td style="width:121px;">ATCC</td>
			<td style="width:161px;"></td>
			<td style="width:167px;">Model system</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">ImageJ</td>
			<td style="width:121px;">NIH</td>
			<td style="width:161px;">V: 2.0.0-rc-69/1.52p</td>
			<td style="width:167px;">Image analysis</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">Magnesium Chloride hexahydrate</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">M9272-500G</td>
			<td style="width:167px;">HEK cell resuspension</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">Sodium phosphate dibasic anhydrous</td>
			<td style="width:121px;">Fisher BioReagents</td>
			<td style="width:161px;">BP332-500</td>
			<td style="width:167px;">Calcium phosphate transfection</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">Trypsin 0.25% (1X) Solution</td>
			<td style="width:121px;">GE Healthcare Life Sciences</td>
			<td style="width:161px;">SH30042.01</td>
			<td style="width:167px;">Passaging HEK cells</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">Tube rotator</td>
			<td style="width:121px;"></td>
			<td style="width:161px;"></td>
			<td style="width:167px;">Incubation of mixed population of HEK cells</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:339px;">UltraClear Microscope slides. White Frosted, Positive Charged</td>
			<td style="width:121px;">Denville Scientific Inc.</td>
			<td style="width:161px;">M1021</td>
			<td style="width:167px;">Image acquisition</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">Wide-field microscope</td>
			<td style="width:121px;">Zeiss</td>
			<td style="width:161px;">Axio Vert 200M</td>
			<td style="width:167px;">Image acquisition</td>
		</tr>
	</tbody>
</table>

measuring transcellular interactions through protein aggregation in a heterologous cell system

Hücresel arayüzlerdeki protein etkileşimleri, doku gelişimi ve kanserin ilerlemesinden sinaps oluşumu ve bakımına kadar çok sayıda biyolojik sonucu belirler. Bu temel etkileşimlerin çoğu transta gerçekleşir ve tipik olarak membran bağlantılı bağlama çiftlerini ifade eden hücreler arasındaki heterofilik veya homofilik etkileşimler tarafından indüklenir. Hastalıkla ilgili mutasyonların bu temel protein etkileşimlerini nasıl bozduğunun aydınlatıcı olması, sayısız hücre biyolojisi alanı hakkında fikir verebilir. Birçok protein-protein etkileşim tahlilleri tipik olarak cis ve trans etkileşimleri arasında ayrım yapmaz, bu da potansiyel olarak in vivo olarak meydana gelen ve protein ve / veya özel izleme ekipmanının emek yoğun saflaştırılmasını içeren bağlama kapsamının aşırı tahmin edilmesine yol açar. Burada, uzun protein saflaştırmalarına veya özel ekipmanlara ihtiyaç duymadan sadece trans etkileşimlerin gözlemlenmesine ve ölçülmesine izin veren optimize edilmiş basit bir protokol sunuyoruz. HEK hücre toplama tahlili, her biri membran bağlı konyak ligandlarını ifade eden iki bağımsız HEK hücresi popülasyonunun karıştırılmasıdır. Kısa bir kuluçka süresinden sonra, örnekler görüntülenir ve elde edilen agregalar ölçülür.

A687T mutasyonu Neurexin3α SS4'ü artırır- LRRTM2 7'ye bağlanma Bilinen iki sinaptik proteinin hücreler arası etkileşimlerinin, zihinsel engelli ve epilepsili bir hastada bulunan bir nokta mutasyonunun ortaya girmesinden nasıl etkilendiğini araştırmak için yukarıdaki HEK hücre toplama testini kullandık (Şekil 1). Hücreler bölüm 1'e göre trans enfekte olmuş ve protokolün 1. ve 2. bölümlerine göre görüntüleme için hazırlanmıştır. ...

Watch this Scientific Journal Video about Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System at JoVE.com

Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Burada, floresan mikroskopisi kullanarak heterolog bir hücre sisteminde transta ligand-reseptör etkileşimlerini hızlı ve yarı niteliksel olarak ölçmek için optimize edilmiş bir protokol sunuyoruz.

Heterolog Hücre Sisteminde Protein Toplama Yoluyla Hücrelerarası Etkileşimlerin Ölçülmesi

Protein interactions at cellular interfaces dictate a multitude of biological outcomes ranging from tissue development and cancer progression to synapse ...

measuring-transcellular-interactions-through-protein-aggregation

Research

JoVE Journal

Neuroscience

3.4K Görüntüleme.  University of Colorado Denver School of Medicine. Burada, floresan mikroskopisi kullanarak heterolog bir hücre sisteminde transta ligand-reseptör etkileşimlerini hızlı ve yarı niteliksel olarak ölçmek için optimize edilmiş bir protokol sunuyoruz.

Video: Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Assaying Surface Expression of Chemosensory Receptors in Heterologous Cells

The vivid world of odors is recognized by the sense of olfaction. Olfaction in mice is mediated by a repertoire of about 1200 G Protein Coupled Receptors (GPCRs) 1 that are postulated to bind volatile odorant molecules and converting the extracellular signal into an intracellular signal by coupling with G protein G&alpha;olf. Binding of the odorants to the receptors is thought to follow a combinatorial rule, that is, one odorant may bind several receptors and one receptor may bind several odorants to varying degrees 2. Biochemical, signaling and ligand binding studies have been conveniently carried out for most GPCRs using heterologous cells. However use of heterologous cells for study of odorant receptors, was precluded for a long time since on transfection they failed to export to the surface. Saito et al have demonstrated single membrane pass Receptor Transporting Protein (RTP) family chaperones show enhanced expression in the olfactory sensory neurons and act as chaperones to traffic odorant receptors to the surface in heterologous cells, when co transfected together 3. To carry out biochemical assays for receptors using heterologous cells, one must first determine if the receptor shows robust surface expression in the cell line. This can be assayed by overexpressing the receptors with the chaperone RTP1S followed by live cell staining to fluorescently label the extracellular domain or a tag in the extracellular domain exclusively. Here we demonstrate a protocol to carry out live cell staining that can be used to detect odorant receptors on the surface of HEK293T cells conveniently. In addition, it may also be used to assay for surface expression of other chemosensory receptors or GPCRs.

Here we demonstrate a protocol to carry out live cell staining that can be used to detect odorant receptors on the surface of HEK293T cells conveniently. In addition, it may also be used to assay for surface expression of other chemosensory receptors or GPCRs.

Heterolog Hücreler kimyasal-duyusal reseptörleri Yüzey İfade Assaying

The vivid world of odors is recognized by the sense of olfaction. Olfaction in mice is mediated by a repertoire of about 1200 G Protein Coupled Receptors ...

Nörobilim

Efficient Derivation of Human Neuronal Progenitors and Neurons from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system (CNS) structure and circuitry in today's healthcare industry. Cell-based therapies hold great promise to restore the lost nerve tissue and function for CNS disorders. However, cell therapies based on CNS-derived neural stem cells have encountered supply restriction and difficulty to use in the clinical setting due to their limited expansion ability in culture and failing plasticity after extensive passaging1-3. Despite some beneficial outcomes, the CNS-derived human neural stem cells (hNSCs) appear to exert their therapeutic effects primarily by their non-neuronal progenies through producing trophic and neuroprotective molecules to rescue the endogenous cells1-3. Alternatively, pluripotent human embryonic stem cells (hESCs) proffer cures for a wide range of neurological disorders by supplying the diversity of human neuronal cell types in the developing CNS for regeneration1,4-7. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity7-10. In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic11-13. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules14 (please see a schematic in Fig. 1). Retinoic acid (RA) does not induce neuronal differentiation of undifferentiated hESCs maintained on feeders1, 14. And unlike mouse ESCs, treating hESC-differentiated embryoid bodies (EBs) only slightly increases the low yield of neurons1, 14, 15. However, after screening a variety of small molecules and growth factors, we found that such defined conditions rendered retinoic acid (RA) sufficient to induce the specification of neuroectoderm direct from pluripotent hESCs that further progressed to neuroblasts that generated human neuronal progenitors and neurons in the developing CNS with high efficiency (Fig. 2). We defined conditions for induction of neuroblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human neuronal cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of neuroblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human neuronal progenitors and neuronal cell types in the developing CNS for neural repair.

Küçük Molekül İndüksiyon Pluripotent İnsan Embriyonik Kök Hücreleri İnsan Nöronal atalarıdır ve Nöronlar Verimli türetilmesi

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system ...

Peering into the Dynamics of Social Interactions: Measuring Play Fighting in Rats

Play fighting in the rat involves attack and defense of the nape of the neck, which if contacted, is gently nuzzled with the snout. Because the movements of one animal are countered by the actions of its partner, play fighting is a complex, dynamic interaction. This dynamic complexity raises methodological problems about what to score for experimental studies. We present a scoring schema that is sensitive to the correlated nature of the actions performed. The frequency of play fighting can be measured by counting the number of playful nape attacks occurring per unit time. However, playful defense, as it can only occur in response to attack, is necessarily a contingent measure that is best measured as a percentage (#attacks defended/total # attacks X 100%). How a particular attack is defended against can involve one of several tactics, and these are contingent on defense having taken place; consequently, the type of defense is also best expressed contingently as a percentage. Two experiments illustrate how these measurements can be used to detect the effect of brain damage on play fighting even when there is no effect on overall playfulness. That is, the schema presented here is designed to detect and evaluate changes in the content of play following an experimental treatment.

Play fighting in the rat involves attack and defense of the nape of the neck, which if contacted, is gently nuzzled with the snout. Because the movements of one animal are countered by the actions of its partner, play fighting is a complex, dynamic interaction. This dynamic complexity raises methodological problems about what to score for experimental studies. We present a scoring schema that is sensitive to the correlated nature of the actions performed. Two experiments illustrate how these measurements can be used to detect the effect of brain damage on play fighting even when there is no effect on overall playfulness. That is, the schema presented here is designed to detect and evaluate changes in the content of play following an experimental treatment.

Sosyal İlişkilerin Dinamikleri içine bakıyor: Ölçme Maçtan Sıçanlarda Mücadele

Play fighting in the rat involves attack and defense of the nape of the neck, which if contacted, is gently nuzzled with the snout. Because the movements ...

Dual Electrophysiological Recordings of Synaptically-evoked Astroglial and Neuronal Responses in Acute Hippocampal Slices

Astrocytes form together with neurons tripartite synapses, where they integrate and modulate neuronal activity. Indeed, astrocytes sense neuronal inputs through activation of their ion channels and neurotransmitter receptors, and process information in part through activity-dependent release of gliotransmitters. Furthermore, astrocytes constitute the main uptake system for glutamate, contribute to potassium spatial buffering, as well as to GABA clearance. These cells therefore constantly monitor synaptic activity, and are thereby sensitive indicators for alterations in synaptically-released glutamate, GABA and extracellular potassium levels. Additionally, alterations in astroglial uptake activity or buffering capacity can have severe effects on neuronal functions, and might be overlooked when characterizing physiopathological situations or knockout mice. Dual recording of neuronal and astroglial activities is therefore an important method to study alterations in synaptic strength associated to concomitant changes in astroglial uptake and buffering capacities. Here we describe how to prepare hippocampal slices, how to identify stratum radiatum astrocytes, and how to record simultaneously neuronal and astroglial electrophysiological responses. Furthermore, we describe how to isolate pharmacologically the synaptically-evoked astroglial currents.

The preparation of acute brain slices from isolated hippocampi, as well as the simultaneous electrophysiological recordings of astrocytes and neurons in stratum radiatum during stimulation of schaffer collaterals is described. The pharmacological isolation of astroglial potassium and glutamate transporter currents is demonstrated.

Akut Hipokampal Dilimler içinde Synaptically-uyarılmış astroglial ve Nöronal Cevaplarının İkili Elektrofizyolojik Kayıtlar

Astrocytes form together with neurons tripartite synapses, where they integrate and modulate neuronal activity. Indeed, astrocytes sense neuronal inputs ...

A Lightweight, Headphones-based System for Manipulating Auditory Feedback in Songbirds

Experimental manipulations of sensory feedback during complex behavior have provided valuable insights into the computations underlying motor control and sensorimotor plasticity1. Consistent sensory perturbations result in compensatory changes in motor output, reflecting changes in feedforward motor control that reduce the experienced feedback error. By quantifying how different sensory feedback errors affect human behavior, prior studies have explored how visual signals are used to recalibrate arm movements2,3 and auditory feedback is used to modify speech production4-7. The strength of this approach rests on the ability to mimic naturalistic errors in behavior, allowing the experimenter to observe how experienced errors in production are used to recalibrate motor output.
Songbirds provide an excellent animal model for investigating the neural basis of sensorimotor control and plasticity8,9. The songbird brain provides a well-defined circuit in which the areas necessary for song learning are spatially separated from those required for song production, and neural recording and lesion studies have made significant advances in understanding how different brain areas contribute to vocal behavior9-12. However, the lack of a naturalistic error-correction paradigm - in which a known acoustic parameter is perturbed by the experimenter and then corrected by the songbird - has made it difficult to understand the computations underlying vocal learning or how different elements of the neural circuit contribute to the correction of vocal errors13.
The technique described here gives the experimenter precise control over auditory feedback errors in singing birds, allowing the introduction of arbitrary sensory errors that can be used to drive vocal learning. Online sound-processing equipment is used to introduce a known perturbation to the acoustics of song, and a miniaturized headphones apparatus is used to replace a songbird's natural auditory feedback with the perturbed signal in real time. We have used this paradigm to perturb the fundamental frequency (pitch) of auditory feedback in adult songbirds, providing the first demonstration that adult birds maintain vocal performance using error correction14. The present protocol can be used to implement a wide range of sensory feedback perturbations (including but not limited to pitch shifts) to investigate the computational and neurophysiological basis of vocal learning.

We describe the design and assembly of miniaturized headphones suitable for replacing a songbird&#x2019;s natural auditory feedback with a manipulated acoustic signal. Online sound processing hardware is used to manipulate song output, introduce real-time errors in auditory feedback via the headphones, and drive vocal motor learning.

Songbirds İşitsel Geribildirim kurgulama için Hafif, Kulaklıklar tabanlı Sistemi

Experimental manipulations of sensory feedback during complex behavior have provided valuable insights into the computations underlying motor control and ...

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Genetic modification of specific regions of the developing mammalian brain is a very powerful experimental approach. However, generating novel mouse mutants is often frustratingly slow. It has been shown that access to the mouse brain developing in utero with reasonable post-operatory survival is possible. Still, results with this procedure have been reported almost exclusively for the most superficial and easily accessible part of the developing brain, i.e. the cortex. The thalamus, a narrower and more medial region, has proven more difficult to target. Transfection into deeper nuclei, especially those of the hypothalamus, is perhaps the most challenging and therefore very few results have been reported. Here we demonstrate a procedure to target the entire hypothalamic neuroepithelium or part of it (hypothalamic regions) for transfection through electroporation. The keys to our approach are longer narcosis times, injection in the third ventricle, and appropriate kind and positioning of the electrodes. Additionally, we show results of targeting and subsequent histological analysis of the most recessed hypothalamic nucleus, the mammillary body.

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Despite the functional and medical importance of the hypothalamus, in utero genetic manipulation of its development has rarely been attempted. We show a detailed procedure for in utero electroporation into the mouse hypothalamus and show representative results of total and partial (regional) hypothalamic transfection.

Fare Genetik Manipülasyon yoluyla Hipotalamus geliştirilmesi<em&gt; Utero olarak</em&gt; Elektroporasyon

Genetic  modification of specific regions of the developing mammalian brain is a very  powerful experimental approach. However, generating novel mouse ...

A Caenorhabditis elegans Model System for Amylopathy Study

Amylopathy is a term that describes abnormal synthesis and accumulation of amyloid beta (A&beta;) in tissues with time. A&beta; is a hallmark of Alzheimer's disease (AD) and is found in Lewy body dementia, inclusion body myositis and cerebral amyloid angiopathy 1-4. Amylopathies progressively develop with time. For this reason simple organisms with short lifespans may help to elucidate molecular aspects of these conditions. Here, we describe experimental protocols to study A&beta;-mediated neurodegeneration using the worm Caenorhabditis elegans. Thus, we construct transgenic worms by injecting DNA encoding human A&beta;42 into the syncytial gonads of adult hermaphrodites. Transformant lines are stabilized by a mutagenesis-induced integration. Nematodes are age synchronized by collecting and seeding their eggs. The function of neurons expressing A&beta;42 is tested in opportune behavioral assays (chemotaxis assays). Primary neuronal cultures obtained from embryos are used to complement behavioral data and to test the neuroprotective effects of anti-apoptotic compounds.

A Caenorhabditis elegans Model System for Amylopathy Study

We describe methods to study aspects of amylopathies in the worm C. elegans. We show how to construct worms expressing human A&beta;42 in neurons and how to test their function in behavioral assays. We further show how to obtain primary neuronal cultures that can be used for pharmacological testing.

Bir<em&gt; Caenorhabditis elegans</emAmylopathy Çalışmaları&gt; Model Sistemi

Amylopathy is a term that describes abnormal synthesis and accumulation of amyloid beta (A&beta;) in tissues with time. A&beta; is a hallmark of ...

Use of a Caspase Multiplexing Assay to Determine Apoptosis in a Hypothalamic Cell Model

The ability to multiplex assays in studies of complex cellular mechanisms eliminates the need for repetitive experiments, provides internal controls, and decreases waste in costs and reagents. Here we describe optimization of a multiplex assay to assess apoptosis following a palmitic acid (PA) challenge in an in vitro hypothalamic model, using both fluorescent and luminescent based assays to measure viable cell counts and caspase-3/7 activity in a 96-well microtiter plate format. Following PA challenge, viable cells were determined by a resazurin-based fluorescent assay. Caspase-3/7 activity was then determined using a luminogenic substrate, DEVD, and normalized to cell number. This multiplexing assay is a useful technique for determining change in caspase activity following an apoptotic stimulus, such as saturated fatty acid challenge. The saturated fatty acid PA can increase hypothalamic oxidative stress and apoptosis, indicating the potential importance of assays such as that described here in studying the relationship between saturated fatty acids and neuronal function.

Multiplex assays can provide beneficial information for basic cellular mechanisms&#160;and eliminate waste of reagents and unnecessary repetitive experiments. We describe here a multiplex caspase-3/7 activity assay, using fluorescent- and luminescent-based methods, to determine cell viability in an in vitro hypothalamic model following oxidative challenge with palmitic acid.

Bir Hipotalamik Hücre Modeli Apoptosisi Belirleyen Bir Kaspaz Çoğullama Testi Kullanımı

The ability to multiplex assays in studies of complex cellular mechanisms eliminates the need for repetitive experiments, provides internal controls, and ...

Inducing Plasticity of Astrocytic Receptors by Manipulation of Neuronal Firing Rates

Close to two decades of research has established that astrocytes in situ and in vivo express numerous G protein-coupled receptors (GPCRs) that can be stimulated by neuronally-released transmitter. However, the ability of astrocytic receptors to exhibit plasticity in response to changes in neuronal activity has received little attention. Here we describe a model system that can be used to globally scale up or down astrocytic group I metabotropic glutamate receptors (mGluRs) in acute brain slices. Included are methods on how to prepare parasagittal hippocampal slices, construct chambers suitable for long-term slice incubation, bidirectionally manipulate neuronal action potential frequency, load astrocytes and astrocyte processes with fluorescent Ca2+ indicator, and measure changes in astrocytic Gq GPCR activity by recording spontaneous and evoked astrocyte Ca2+ events using confocal microscopy. In essence, a &#8220;calcium roadmap&#8221; is provided for how to measure plasticity of astrocytic Gq GPCRs. Applications of the technique for study of astrocytes are discussed. Having an understanding of how astrocytic receptor signaling is affected by changes in neuronal activity has important implications for both normal synaptic function as well as processes underlying neurological disorders and neurodegenerative disease.

Here we describe an adaptation of protocols used to induce homeostatic plasticity in neurons for the study of plasticity of astrocytic G protein-coupled receptors. Recently used to examine changes in astrocytic group I mGluRs in juvenile mice, the method can be applied to measure scaling of various astrocytic GPCRs, in tissue from adult mice in situ and in vivo, and to gain a better appreciation of the sensitivity of astrocytic receptors to changes in neuronal activity.

Nöronal Ateşleme Oranlarının Manipülasyon tarafından Astrositik reseptörleri Plastisite Inducing

Close to two decades of research has established that astrocytes in situ and in vivo express numerous G protein-coupled receptors (GPCRs) that can be ...

Quantitative Cell Biology of Neurodegeneration in Drosophila Through Unbiased Analysis of Fluorescently Tagged Proteins Using ImageJ

With the rising prevalence of neurodegenerative diseases, it is increasingly important to understand the underlying pathophysiology that leads to neuronal dysfunction and loss. Fluorescence-based imaging tools and technologies enable unprecedented analysis of subcellular neurobiological processes, yet there is still a need for unbiased, reproducible, and accessible approaches for extracting quantifiable data from imaging studies. We have developed a simple and adaptable workflow to extract quantitative data from fluorescence-based imaging studies using Drosophila models of neurodegeneration. Specifically, we describe an easy-to-follow, semi-automated approach using Fiji/ImageJ to analyze two cellular processes: first, we quantify protein aggregate content and profile in the Drosophila optic lobe using fluorescent-tagged mutant huntingtin proteins; and second, we assess autophagy-lysosome flux in the Drosophila visual system with ratiometric-based quantification of a tandem fluorescent reporter of autophagy. Importantly, the protocol outlined here includes a semi-automated segmentation step to ensure all fluorescent structures are analyzed to minimize selection bias and to increase resolution of subtle comparisons. This approach can be extended for the analysis of other cell biological structures and processes implicated in neurodegeneration, such as proteinaceous puncta (stress granules and synaptic complexes), as well as membrane-bound compartments (mitochondria and membrane trafficking vesicles). This method provides a standardized, yet adaptable reference point for image analysis and quantification, and could facilitate reliability and reproducibility across the field, and ultimately enhance mechanistic understanding of neurodegeneration.

Quantitative Cell Biology of Neurodegeneration in Drosophila Through Unbiased Analysis of Fluorescently Tagged Proteins Using ImageJ

We have developed a simple and adaptable workflow to extract quantitative data from fluorescence-imaging-based cell biological studies of protein aggregation and autophagic flux in the central nervous system of Drosophila models of neurodegeneration.

Ateş Drosophila ImageJ kullanarak Fluorescently Tagged proteinlerin tarafsız analizi ile yılında niceliksel hücre biyolojisi

With the rising prevalence of neurodegenerative diseases, it is increasingly important to understand the underlying pathophysiology that leads to neuronal ...