이 작품은 국립 정신 건강 연구소 (R00MH103531 및 R01MH1116901 에서 J.A.), 국립 일반 의학 연구소 (T32GM0007635에서 S.R.R.)의 박사 전 교육 보조금, 고급 연구를위한 리다 힐리엄 펠로우십 (GT1101.R.1)의 보조금에 의해 지원되었습니다. 우리는 현미경에 도움을 케빈 울프리 박사, 그의 전형 현미경의 사용에 대한 박사 K 울리히 바이엘, 그리고 토마스 수호프 (스탠포드 대학) LRRTM2 플라스미드에 대한 도움을 감사드립니다.

1. 세포 배양 및 형질
<ol><li>DMEM, 1x (덜벡코의 독수리 매체 수정)로 HEK 세포 미디어를 4.5 g/L 포도당, L 글루타민 및 나트륨 피루바테 및 10% FBS로 보충합니다. 멸균 필터.</li>
	<li>집계 분석에 적합한 리간드 및 수용체를 미리 결정합니다. 참고: Neurexin3α SS4+/-와 알려진 리간드 중 하나인 LRRTM2가 이 연구에서 사용되었습니다. 리간드 및 관심 수용체는 pcDNA3.1에서 cDNA로부터 발현되었다. 깁슨 어셈블리는 neurexin3α를 pcDNA3.112에삽입하는 데 사용되었다. 노이렉신3α F/R: TTTAAACTTAAGTAGTACCTACCGAGCTCGGATCCCACCATGAGCTCTACCCTCCACTCACTC/ GAGCGGCCGCCACTGTGTGTTGATATCTGCAATTCTTACAATAATAATAATAATACTCCTTGTTTCCTTTT.</li>
	<li>HEK293T 셀을 준비합니다.<ol>
<li>HEK293T 세포를 하나의 T-75 플라스크에 합류하게 성장시다.</li>
		<li>일단 컨서블, 트립신의 2 mL을 사용하고 2 분 동안 37 ° C 인큐베이터에 배치합니다. 6mL의 HEK 미디어를 플라스크에 추가하여 세포를 재일시 중단하고 8mL를 모두 15mL 원추형 튜브로 옮기습니다.</li>
		<li>500 x g에서 펠릿5 분 및 총 8 mLHEK 세포 매체에서 재중단.</li>
		<li>세포를 계산하고 6 웰 플레이트의 각 우물에 735,000 세포를 추가합니다. HEK 셀 미디어를 사용하여 각 웰에 대해 최종 볼륨을 2mL로 조정합니다.</li>
		<li>37°C 인큐베이터에 배치하고 세포가 하룻밤 사이에 또는 50-60 % 합류에 도달 할 때까지 성장 할 수 있습니다.</li>
	</ol></li>
	<li>칼슘인산법(13)을이용한 트랜스펙트 HEK293T 세포.<ol>
<li>형광 단백질 1 μg (pcDNA3.1-Neurexin3αWT SS4- 및 mCherry 1 μg의 3 μg)를 가진 관심 및 공동 트랜스펙트의 단백질 3 μg를 가진 Transfect well-1.</li>
		<li>1.4.1 단계에서와 같이 Transfect 잘 -2. 그러나 관심의 돌연변이 단백질 (pcDNA3.1-Neurexin3αA687T SS4-).</li>
		<li>다른 형광 단백질의 1 μg (pcDNA3.1 LRRTM2 및 GFP의 1 μg)의 1 μg와 관심 및 공동 트랜스 펙트의 3 μg와 트랜스펙트 웰 -3.</li>
		<li>트랜스펙트 웰-4와 잘-5 부정적인 컨트롤 역할을: 잘-4 GFP의 1 μg와 잘-5 mCherry의 1 μg.</li>
		<li>추가 조건 이나 컨트롤을 필요로 하는 경우 다른 플레이트를 준비 (단계 1.4.1-1.4.4) 추가 조건 또는 컨트롤을 필요로하는 경우 (Neurexin3αWT / A687T SS4+). 참고: 형광 효율은 상형광 현미경으로 형광 현미경으로 24시간 경과한 후 분석되고, 형광 단백질을 발현하는 세포의 수로 정량화된다. 보다 유선형적인 접근법은 형광 단백질과 관심의 리간드에 대한 비거스트로닉 벡터 코딩을 가진 HEK 세포의 전환을 포함하고 공동 형질 보다 높게 권장됩니다. 이 연구의 경우, 알파 뉴렉신은 ~4.3 kb이며 형광 강도가 낮으며, 동회용을 필요로 하는 이두근시스템을 사용하여 관찰되었다.</li>
	</ol></li>
	<li>이식 후 48시간, 집합을 위해 세포를 수확합니다.<ol>
<li>PBS로 두 번 잘 씻으시면 됩니다.</li>
		<li>PBS에 1mM EDTA1mL을 각 웰에 추가하여 세포 간 상호 작용을 부드럽게 분리하고 37°C에서 5분 동안 배양판을 배양합니다. 참고: 트립신은 연구에서 접착 분자의 잠재적인 단백질 분석 분열로 인해 1.5.2 단계에 권장되지 않습니다. 또한 EDTA 추가 후 세포가 주변 조건에 노출되기 때문에 완료될 때까지 프로토콜이 중지되지 않을 수 있습니다.</li>
		<li>부드럽게 세포를 분리하기 위해 접시를 누르고, 별도의 15 mL 원추형 튜브로 각각을 잘 수확.</li>
		<li>원심분리기 원심분리관은 500 x g, 실온은 5분 동안 드실 수 있습니다.</li>
	</ol></li>
	<li>세포가 펠릿화하는 동안 각 상태의 각 미세 원심 분리기 튜브의 상단을 표시하여 6 개의 배양 튜브를 준비하십시오. 참고: GFP 및 mCherry 조건의 각 순열은 모든 실험 조건과 적절한 제어를 포괄하는 데 사용되어야합니다. 예: 1. GFP/mCherry, 2. mCherry/LRRTM2-GFP 3. GFP/노이렉신3αWT SS4--mCherry, 4. GFP/뉴렉신3αA687T SS4- -mCherry, 5. 뉴렉신3αWT SS4--mCherry/LRRTM2-GFP, 6. 뉴렉신3αA687T SS4- -mCherry/LRRTM2-GFP. 추가 조건 및 제어를 수용할 수 있도록 튜브를 추가로 만듭니다.</li>
	<li>10mM CaCl2 및 10mM MgCl2로 37°C로 따뜻해진 HEK 매체의 500 μL에서 상체 및 재중단 세포를 제거합니다. 참고: CaCl2 및 MgCl2를 추가하면 접착 분자가 결합을 재확립할 수 있으며 문제의 세포간 상호 작용 파트너가 접착을 위해 이원양이온을 필요로 하는 경우에만 필요합니다.</li>
	<li>각 15mL 원문관의 세포를 혈류계와 알리쿼트 200,000개의 세포를 1.6.1 단계부터 적절한 튜브로 사용하여 500 μL의 총 부피에서 1:1 혼합을 계산한다. 참고: 조건당 5분만 계산하고 알리쿼트 금액이 소요됩니다.</li>
	<li>느린 튜브 회전기에서 실온에서 튜브를 배양합니다.</li>
</ol>2. 이미지 수집
<ol><li>특정 샘플에 대한 현미경 획득 매개 변수를 최적화합니다. 이 예에서는, 심상은 넓은 필드 현미경에서 촬영되었습니다. 5배 공기 목표 사용(NA: 0.15; WD: 20000 μm) 분석을 위한 충분한 필드를 얻을 수 있습니다.</li>
	<li>1.8 단계에서 HEK 세포의 두 조건을 혼합한 직후 기준집계를 평가한다. 이제 '시간 제로' 이미지입니다.<ol>
<li>488 및 561 채널 모두에서 형광 하에서 충전 된 현미경 슬라이드 및 이미지에 각 샘플 혼합물의 Pipette 40 μL.</li>
		<li>샘플 드롭당 하나의 포커스 평면에서 세 가지 보기 필드를 획득합니다.</li>
	</ol>
</li>
	<li>'시간 60' 이미지로 60분 만에 최종 이미지를 획득합니다.<ol>
<li>60분 배양 후 혼합물의 '시간 60' 이미지를 얻으려면 각 샘플을 회전 튜브및 파이펫에서 각 피펫에서 각 조건의 40 μL 샘플을 충전된 슬라이드로 가져 가십시오. 2.2.2 단계와 같은 이미지. 참고: 포화가 발생할 때까지 세포 집계는 15분마다 검사해야 합니다. 집계의 타이밍은 테스트되는 단백질에 따라 달라집니다.</li>
	</ol>
</li>
</ol>3. 이미지 J/피지 분석
<ol><li>피지/ImageJ를 사용하여 집계 범위를 정량화하려면 분석 파일을 저장합니다.<ol>
<li>제공된 보충 코딩 파일을 컴퓨터의 imageJ 매크로 폴더에 저장합니다.</li>
		<li>제공된 집계 매크로를 설치합니다(플러그인, 매크로, 설치 및 "집계분석.txt" 파일을 선택합니다.</li>
	</ol>
</li>
	<li>임계값을 결정합니다.<ol>
<li>'시간 제로' .tif 파일을 이미지J로 로드하고 채널을분할(이미지 | 색상 | 분할 채널). 참고: '시간 제로' 이미지는 전체 실험에 대한 임계값과 가장 작은 말장난 크기를 결정하는 데 사용됩니다.</li>
		<li>각채널(플러그인 | 매크로 | AggregationAssay_MakeMask). 이미지 창에서 마스크를 만들면 표시됩니다. 이미지에 대한 임계값 결정 옆에 있는 확인란을 확인하고 히스토그램에서 클러스터 Params를 결정하고 확인을 클릭합니다.</li>
		<li>슬라이드 막대를 사용하여 이미지의 임계값을 결정하고 슬라이드 막대오른쪽에 숫자를 기록하고 확인을 클릭합니다.</li>
		<li>클러스터 크기의 히스토그램이 나타납니다. 실험에 맞는 히스토그램에서 클러스터 크기를 선택하고, 이 숫자를 최소 클러스터 크기: 상자에 입력하고 확인을 클릭합니다. 이 크기 이하의 클러스터는 분석되지 않습니다.</li>
	</ol>
</li>
	<li>분석을 실행합니다.<ol>
<li>이미지J에서 조건 1의 '시간 60' 이미지를 열고 3.2.1 단계와 같이 채널을 분할합니다.</li>
		<li>각 채널(플러그인, 매크로, AggregationAssay_MakeMask)을 마스크합니다. 3.2.3 단계 및 3.2.4 단계에서 결정된 동일한 임계값 및 크기를 사용합니다. 이미지에 대한 임계값 결정 옆에 있는 상자를 선택 취소하고 히스토그램에서 클러스터 Params를 결정하고 크기와 임계값을 해당 필드에 수동으로 입력한 다음 확인을 클릭합니다.</li>
		<li>집계 지수(플러그인 | 계산 매크로 | AggregationAssay_CalculateOverlap). 비교할 마스크채널과 결과 파일이 저장되는 디렉토리를 선택합니다.</li>
		<li>모든 조건에서 '시간 60' 이미지당 3.3.1-3.3단계를 반복합니다. 참고: 집계 인덱스는 100을 곱한 중첩 영역을 뺀 두 채널 영역의 합으로 나눈 총 중첩 영역으로 정의됩니다(집계 인덱스 = 중첩 영역/[채널 1 + 채널 2의 영역 ] 중첩 영역] x 100). 이 정규화는 두 마스크 채널 간의 'OR' 동작으로 두 마스크의 총 픽셀을 나타냅니다.</li>
	</ol>
</li>
</ol>

<ol>
	<li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroligins+and+neurexins+link+synaptic+function+to+cognitive+disease.">Neuroligins and neurexins link synaptic function to cognitive disease.</a> Nature. 455 (7215), 903-911 (2008).</li><li>Lakey, J. H., Raggett, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+protein-protein+interactions.">Measuring protein-protein interactions.</a> Current Opinion in Structural Biology. 8 (1), 119-123 (1998).</li><li>Aoto, J., Martinelli, D. C., Malenka, R. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Presynaptic+neurexin-3+alternative+splicing+trans-synaptically+controls+postsynaptic+AMPA+receptor+trafficking.">Presynaptic neurexin-3 alternative splicing trans-synaptically controls postsynaptic AMPA receptor trafficking.</a> Cell. 154 (1), 75-88 (2013).</li><li>Aoto, J., F&#246;ldy, C., Ilcus, S. M. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+circuit-dependent+functions+of+presynaptic+neurexin-3+at+GABAergic+and+glutamatergic+synapses.">Distinct circuit-dependent functions of presynaptic neurexin-3 at GABAergic and glutamatergic synapses.</a> Nature Neuroscience. 18 (7), 997-1007 (2015).</li><li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+Neurexin+Complexes:+A+Molecular+Code+for+the+Logic+of+Neural+Circuits.">Synaptic Neurexin Complexes: A Molecular Code for the Logic of Neural Circuits.</a> Cell. 171 (4), 745-769 (2017).</li><li>Dai, J., Aoto, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+Splicing+of+Presynaptic+Neurexins+Differentially+Controls+Postsynaptic+NMDA+and+AMPA+Receptor+Responses.">Alternative Splicing of Presynaptic Neurexins Differentially Controls Postsynaptic NMDA and AMPA Receptor Responses.</a> Neuron. 102 (5), 993-1008 (2019).</li><li>Restrepo, S., Langer, N. J., Nelson, K. A., Aoto, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+a+Neurexin-3&#945;+Human+Mutation+in+Mouse+Neurons+Identifies+a+Novel+Role+in+the+Regulation+of+Transsynaptic+Signaling+and+Neurotransmitter+Release+at+Excitatory+Synapses.">Modeling a Neurexin-3&#945; Human Mutation in Mouse Neurons Identifies a Novel Role in the Regulation of Transsynaptic Signaling and Neurotransmitter Release at Excitatory Synapses.</a> The Journal of Neuroscience. 39 (46), 9065-9082 (2019).</li><li>Ko, J., Fuccillo, M. V., Malenka, R. C., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Functions+as+a+Neurexin+Ligand+in+Promoting+Excitatory+Synapse+Formation.">LRRTM2 Functions as a Neurexin Ligand in Promoting Excitatory Synapse Formation.</a> Neuron. 64 (6), 791-798 (2009).</li><li>de Wit, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Interacts+with+Neurexin1+and+Regulates+Excitatory+Synapse+Formation.">LRRTM2 Interacts with Neurexin1 and Regulates Excitatory Synapse Formation.</a> Neuron. 64 (6), 799-806 (2009).</li><li>Linhoff, M. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Unbiased+Expression+Screen+for+Synaptogenic+Proteins+Identifies+the+LRRTM+Protein+Family+as+Synaptic+Organizers.">An Unbiased Expression Screen for Synaptogenic Proteins Identifies the LRRTM Protein Family as Synaptic Organizers.</a> Neuron. 61 (5), 734-749 (2009).</li><li>Siddiqui, T. J., Pancaroglu, R., Kang, Y., Rooyakkers, A., Craig, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTMs+and+Neuroligins+Bind+Neurexins+with+a+Differential+Code+to+Cooperate+in+Glutamate+Synapse+Development.">LRRTMs and Neuroligins Bind Neurexins with a Differential Code to Cooperate in Glutamate Synapse Development.</a> Journal of Neuroscience. 30 (22), 7495-7506 (2010).</li><li>Gibson, D. G., Young, L., Chuang, R. -. Y., Venter, J. C., Hutchison, C. A., Smith, H. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nature Methods. 6 (5), 343-345 (2009).</li><li>Bacchetti, S., Graham, F. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfer+of+the+gene+for+thymidine+kinase+to+thymidine+kinase-deficient+human+cells+by+purified+herpes+simplex+viral+DNA.">Transfer of the gene for thymidine kinase to thymidine kinase-deficient human cells by purified herpes simplex viral DNA.</a> Proceedings of the National Academy of Sciences of the United States of America. 74 (4), 1590-1594 (1977).</li><li>Cerchiari, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+strategy+for+tissue+self-organization+that+is+robust+to+cellular+heterogeneity+and+plasticity.">A strategy for tissue self-organization that is robust to cellular heterogeneity and plasticity.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (7), 2287-2292 (2015).</li><li>Burdick, M. M., McCarty, O. J. T., Jadhav, S., Konstantopoulos, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+inflammation+and+cancer+metastasis.">Cell-cell interactions in inflammation and cancer metastasis.</a> IEEE Engineering in Medicine and Biology Magazine. 20 (3), 86-91 (2001).</li><li>Fox, D. A., Gizinski, A., Morgan, R., Lundy, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+rheumatoid+arthritis+synovium.">Cell-cell interactions in rheumatoid arthritis synovium.</a> Rheumatic Diseases Clinics of North America. 36 (2), 311-323 (2010).</li><li>Yamagata, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+insights+into+modulation+and+selectivity+of+transsynaptic+neurexin-LRRTM+interaction.">Structural insights into modulation and selectivity of transsynaptic neurexin-LRRTM interaction.</a> Nature Communications. 9 (1), 3964 (2018).</li><li>Nguyen, T., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binding+properties+of+neuroligin+1+and+neurexin+1beta+reveal+function+as+heterophilic+cell+adhesion+molecules.">Binding properties of neuroligin 1 and neurexin 1beta reveal function as heterophilic cell adhesion molecules.</a> The Journal of Biological Chemistry. 272 (41), 26032-26039 (1997).</li><li>Boucard, A. A., Ko, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Affinity+Neurexin+Binding+to+Cell+Adhesion+G-protein-coupled+Receptor+CIRL1/Latrophilin-1+Produces+an+Intercellular+Adhesion+Complex.">High Affinity Neurexin Binding to Cell Adhesion G-protein-coupled Receptor CIRL1/Latrophilin-1 Produces an Intercellular Adhesion Complex.</a> Journal of Biological Chemistry. 287 (12), 9399-9413 (2012).</li></ol>

저자는 공개 할 것이 없습니다.

세포 접착 중에 트랜스에서 발생하는 단백질 단백질 상호 작용을 해부하면 성숙 및 리모델링 중에 시냅스의 형성, 기능 및 유지 관리를 포함한 기본 세포 과정의 근본적인 분자 메커니즘을 더 잘 이해할 수 있습니다. 세포 대 세포 상호 작용의 의미는 신경 생물학을 넘어 확장하고 신호 전달, 세포 이동 및 조직 발달에 있는 더 넓은 역할을14. 세포 유착의 수차는 적절한 세포 기능...

시냅스 접착 분자에 의해 촉진되는 시냅스 상호 작용은 시냅스의 개발, 조직, 사양, 유지 보수 및 기능 및 신경망 의 생성을 위한 기초입니다. 이러한 신혈 세포 접착 분자의 식별은 급속히 증가하고 있습니다. 따라서, 결합 파트너를 식별하고 이러한 새로운 접착 분자가 서로 상호 작용하는 방법을 이해하는 것이 근본적으로 중요합니다. 추가적으로, 게놈 순서는 일반적으로 신경 발달, 신경 정신병및 중독무질서1의 다수에 연결되는 이 접착 분자의 많은에서 돌연변이를 확인했습니다. 시냅스 세포 접착 분자에 대 한 코드 유전자에 돌연변이 는 해로운 트랜스 상호 작용을 변경 하 고 시 냅 스 형성 및 유지 보수에 병 리 학적 변경에 기여할 수 있습니다.
여러 분석법은 이소성 열량, 원형 이윤술, 표면 플라스몬 공명2와 같은 단백질 단백질 상호 작용을 정량적으로 평가하기 위해 존재하며 자연에서 정량적이지만 몇 가지 한계가 있습니다. 첫째, 그들은 재조합 단백질을 필요로, 때로는 길고 지루한 정제 단계를 요구. 둘째, 정교한 특수 장비와 기술 전문 지식이 필요합니다. 셋째, 생체 내 막에 자연적으로 테더드되는 단백질 간의 시스 및 트랜스 상호 작용을 모두 허용하므로 결합의 정도를 과대 평가할 수 있습니다. 여기에서 우리는 트랜스 상호 작용을 독점적으로 테스트하는 간단하고 비교적 빠른 분석서를 제안합니다.
정제된 단백질 분석과 관련된 많은 합병증을 우회하기 위해, 우리는 감소된 이종 세포 시스템에서 트랜스 상호 작용을 재구성하는 세포 기지를 둔 단백질 상호 작용 분석서를 최적화했습니다. 이 분석은 이전에 세포 간 상호 작용을 연구하기 위해 다양한 형태로 사용되었습니다. 이 접근법에서, 후보 세포 접착 분자는 HEK293T 세포로 전형된다. 생리학적 조건에서 HEK293T 세포는 자가 응집을 나타내지 않아 이 분석에 대한 모범적인 모델을 만듭니다. 그러나, 수용체와 리간드를 발현하는 HEK 세포의 개별 집단이 결합될 때, 수용체의 결합과 HEK 세포의 리간드 힘 응집이 발생한다. 이 집계는 트랜스 상호 작용에 의해 독점적으로 중재되며 일반적으로 수십 분 안에 관찰 할 수 있습니다. 이 방법에서는 단백질 정화 단계가 필요하지 않으며, 이 방법의 효율은 cognate 접착 분자를 발현하는 HEK 세포의 인구가 결합되고 수십 분 후에 만 이미지되는 패러다임에 의존한다. 또한, 이 방법은 항체나 비용이 많이 드는 장비가 필요하지 않습니다. 데이터 수집에 필요한 유일한 장비는 표준 형광 현미경입니다. 이 세포 기지를 둔 분석기의 추가 이점은 트랜스 상호 작용에 질병 관련 점 돌연변이의 효력을 빨리 검열하는 기능입니다. 이는 관심 있는 단백질의 돌연변이 변이체의 cDNA를 가진 HEK 세포를 배분하여 수행될 수 있다.
이 프로토콜에서, 우리는 우리가 심각한 지적 장애 및 간질로 진단된 환자에서 확인된 Neurexin3α (Neurexin3αA687T)에있는 잘못된 감각 돌연변이가, 류신이 풍부한 반복 막 단백질 2 (LRRTM2)와 트랜스에서 상호 작용을 변경하는지 여부를 조사하는 예를 제시합니다. Neurexin3α는 사전 시냅스 세포 접착 분자의 진화적으로 보존된 가족의 일원이며, 최근 연구는 시냅스3,4,5,6,7,이 분자및 뉴렉신 가족의 모든 구성원에 대한 당사의 시냅스 이해에서 여러 역할을 확인했지만 불완전하다. LRRTM2는 시냅스 형성 및 유지 보수8,9,10에참여하는 흥분포스트 냅틱 세포 접착 단백질이다. 중요 한 것은, LRRTM2 독점적으로 스플라이스 사이트 4 대체 엑슨 (SS4-) 부족 하지만 스플라이스 사이트 4 대체 엑슨을 포함 하는 뉴렉신 등소와 상호 작용 4 대체 엑슨 (SS4+). Neurexin3α에서 확인된 인간 잘못된 감각 돌연변이(A687T)는 진화적으로 보존되고 모든 알파 뉴렉신7사이에 보존되는 연구되지 않은 세포외 지역에 위치한다. 이 두 분자 간의 상호 작용이 확립됨에 따라8,9,11,우리는 질문을 제기 : Neurexin3α SS4- LRRTM2의 결합 능력은 A687T 포인트 돌연변이에 의해 변경? 이 분석서에 따르면 A687T 점 돌연변이는 예기치 않게 Neurexin3α에서 LRRTM2로의 응집을 강화하여 점 돌연변이가 있는 세포외 영역이 신내 상호 작용을 중재하는 역할을 한다는 것을 시사합니다.

<table><tbody><tr><td>1.5 mL disposable microtubes with snap caps</td><td>VWR</td><td>89000-028</td><td>Incubation of mixed population of HEK cells</td></tr><tr><td>1000 mL Rapid&amp;mdash;Flow Filter Unit, 0.2 um aPES membrane</td><td>Thermo Fisher</td><td>567-0020</td><td>Sterilization of HEK media</td></tr><tr><td>15 mL SpectraTube centrifuge tubes</td><td>Ward&amp;rsquo;s Science</td><td>470224-998</td><td>Harvesting HEK cells</td></tr><tr><td>6 well sterile tissue culture plates</td><td>VWR</td><td>100062-892</td><td>culturing HEK cells</td></tr><tr><td>Calcium Chloride</td><td>Sigma</td><td>223506-500G</td><td>Calcium phosphate transfection, HEK cell resuspension</td></tr><tr><td>Centrifuge- Sorvall Legend RT</td><td>Kendro Laboratory Products</td><td>75004377</td><td>Harvesting HEK cells</td></tr><tr><td>CO2 cell incubator</td><td>Thermo Scientific</td><td>HERACELL 150i</td><td>Incubation of HEK cells during growth</td></tr><tr><td>DMEM, 1x (Dulbecco&#039;s Modification of Eagle&#039;s Medium) with 4.5 g/L glucose, L-glutamine &amp;amp; sodium pyruvate</td><td>Corning</td><td>10-013-CV</td><td>HEK cell maintenance</td></tr><tr><td>Dulbecco&amp;rsquo;s Phosphate Buffered Saline PBS (1X)</td><td>Gibco</td><td>14190-144</td><td>Passaging/harvesting HEK cell</td></tr><tr><td>Ethylenediaminetetraacetic acid</td><td>Sigma</td><td>ED-500G</td><td>Harvesting HEK cells</td></tr><tr><td>Falcon Vented culture flasks, 75cm&lt;sup&gt;2&lt;/sup&gt; growth area</td><td>Corning</td><td>9381M26</td><td>Culturing HEK cells</td></tr><tr><td>Fetal Bovine Serum</td><td>Sigma</td><td>17L184</td><td>HEK cell maintenance</td></tr><tr><td>HEK293T cells</td><td>ATCC</td><td></td><td>Model system</td></tr><tr><td>ImageJ</td><td>NIH</td><td>V: 2.0.0-rc-69/1.52p</td><td>Image analysis</td></tr><tr><td>Magnesium Chloride hexahydrate</td><td>Sigma</td><td>M9272-500G</td><td>HEK cell resuspension</td></tr><tr><td>Sodium phosphate dibasic anhydrous</td><td>Fisher BioReagents</td><td>BP332-500</td><td>Calcium phosphate transfection</td></tr><tr><td>Trypsin 0.25% (1X) Solution</td><td>GE Healthcare Life Sciences</td><td>SH30042.01</td><td>Passaging HEK cells</td></tr><tr><td>Tube rotator</td><td></td><td></td><td>Incubation of mixed population of HEK cells</td></tr><tr><td>UltraClear Microscope slides. White Frosted, Positive Charged</td><td>Denville Scientific Inc.</td><td>M1021</td><td>Image acquisition</td></tr><tr><td>Wide-field microscope</td><td>Zeiss</td><td>Axio Vert 200M</td><td>Image acquisition</td></tr></tbody></table>

measuring transcellular interactions through protein aggregation in a heterologous cell system

세포 인터페이스에서 단백질 상호 작용은 조직 발달과 암 진행에서 시냅스 형성 및 유지 보수에 이르기까지 다양한 생물학적 결과를 지시합니다. 이러한 근본적인 상호 작용의 대부분은 트랜스에서 발생하고 일반적으로 막 고정 결합 쌍을 표현하는 세포 사이의 이기성 또는 동종 작용에 의해 유도된다. 질병 관련 돌연변이가 어떻게 이러한 근본적인 단백질 상호 작용을 방해하는지 설명하면 무수한 세포 생물학 분야에 대한 통찰력을 제공할 수 있습니다. 많은 단백질 단백질 상호 작용 소법은 전형적으로 시스와 트랜스 상호 작용 사이에 비약적이지 않으며, 이는 잠재적으로 생체 내에서 발생하는 결합의 정도의 과대 평가로 이어지고 단백질 및 /또는 전문 모니터링 장비의 노동 집약적 정제를 포함합니다. 여기서, 우리는 긴 단백질 정제 또는 특수 장비없이 트랜스 상호 작용의 관찰 및 정량화를 허용하는 최적화 된 간단한 프로토콜을 제시한다. HEK 세포 집계 분석법은 HEK 세포의 2개의 독립적인 인구의 혼합을 관련시킵니다, 각각 막 결합 된 cognate 리간드를 표현합니다. 짧은 잠복기 후에 는 샘플이 이미지화되고 결과 골재가 정량화됩니다.

A687T 돌연변이는 LRRTM2 7에 결합하는 Neurexin3α SS4-결합을 증가시킵니다. 두 개의 알려진 시냅스 단백질의 세포 간 상호 작용이 지적 장애 및 간질을 가진 환자에서 발견되는 포인트 돌연변이의 도입에 의해 어떻게 영향을 받는지 조사하기 위해 위의 HEK 세포 집계분석(도 1)을사용했습니다. 세포는 섹션 1에 따라 전과되었고 프로토콜의 섹션 1 과 2에 따라 ...

Watch this Scientific Journal Video about Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System at JoVE.com

Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

여기서, 우리는 형광 현미경을 사용하여 이종 세포 시스템에서 트랜스에서 리간드 수용체 상호 작용을 신속하고 반정적으로 측정하는 최적화된 프로토콜을 제시한다.

이종 세포 시스템에서 단백질 응집을 통한 세포 간 상호 작용 측정

Protein interactions at cellular interfaces dictate a multitude of biological outcomes ranging from tissue development and cancer progression to synapse ...

measuring-transcellular-interactions-through-protein-aggregation

Research

JoVE Journal

Neuroscience

3.4K 조회수.  University of Colorado Denver School of Medicine. 여기서, 우리는 형광 현미경을 사용하여 이종 세포 시스템에서 트랜스에서 리간드 수용체 상호 작용을 신속하고 반정적으로 측정하는 최적화된 프로토콜을 제시한다.

비디오: Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Extracellular Protein Microarray Technology for High Throughput Detection of Low Affinity Receptor-Ligand Interactions

Secreted factors, membrane-tethered receptors, and their interacting partners are main regulators of cellular communication and initiation of signaling cascades during homeostasis and disease, and as such represent prime therapeutic targets. Despite their relevance, these interaction networks remain significantly underrepresented in current databases; therefore, most extracellular proteins have no documented binding partner. This discrepancy is primarily due to the challenges associated with the study of the extracellular proteins, including expression of functional proteins, and the weak, low affinity, protein interactions often established between cell surface receptors. The purpose of this method is to describe the printing of a library of extracellular proteins in a microarray format for screening of protein-protein interactions. To enable detection of weak interactions, a method based on multimerization of the query protein under study is described. Coupled to this microbead-based multimerization approach for increased multivalency, the protein microarray allows robust detection of transient protein-protein interactions in high throughput. This method offers a rapid and low sample consuming-approach for identification of new interactions applicable to any extracellular protein. Protein microarray printing and screening protocol are described. This technology will be useful for investigators seeking a robust method for discovery of protein interactions in the extracellular space.

Here, we present a protocol to screen extracellular protein microarrays for identification of novel receptor-ligand interactions in high throughput. We also describe a method to enhance detection of transient protein-protein interactions by using protein-microbead complexes.

세포 외 단백질 Microarray 기술은 낮은 친 화력 수용 체 Ligand 상호 작용의 높은 처리량 검색

Secreted factors, membrane-tethered receptors, and their interacting partners are main regulators of cellular communication and initiation of signaling ...

연구

생화학

A Fluorescence Fluctuation Spectroscopy Assay of Protein-Protein Interactions at Cell-Cell Contacts

A variety of biological processes involves cell-cell interactions, typically mediated by proteins that interact at the interface between neighboring cells. Of interest, only few assays are capable of specifically probing such interactions directly in living cells. Here, we present an assay to measure the binding of proteins expressed at the surfaces of neighboring cells, at cell-cell contacts. This assay consists of two steps: mixing of cells expressing the proteins of interest fused to different fluorescent proteins, followed by fluorescence fluctuation spectroscopy measurements at cell-cell contacts using a confocal laser scanning microscope. We demonstrate the feasibility of this assay in a biologically relevant context by measuring the interactions of the amyloid precursor-like protein 1 (APLP1) across cell-cell junctions. We provide detailed protocols on the data acquisition using fluorescence-based techniques (scanning fluorescence cross-correlation spectroscopy, cross-correlation number and brightness analysis) and the required instrument calibrations. Further, we discuss critical steps in the data analysis and how to identify and correct external, spurious signal variations, such as those due to photobleaching or cell movement.
In general, the presented assay is applicable to any homo- or heterotypic protein-protein interaction at cell-cell contacts, between cells of the same or different types and can be implemented on a commercial confocal laser scanning microscope. An important requirement is the stability of the system, which needs to be sufficient to probe diffusive dynamics of the proteins of interest over several minutes.

This protocol describes a fluorescence fluctuation spectroscopy-based approach to investigate interactions among proteins mediating cell-cell interactions, i.e. proteins localized in cell junctions, directly in living cells. We provide detailed guidelines on instrument calibration, data acquisition and analysis, including corrections to possible artefact sources.

셀 연락처에서 단백질 단백질 상호 작용의 형광 변동 분광학 분석 결과

A variety of biological processes involves cell-cell interactions, typically mediated by proteins that interact at the interface between neighboring ...

Bead Aggregation Assays for the Characterization of Putative Cell Adhesion Molecules

Cell-cell adhesion is fundamental to multicellular life and is mediated by a diverse array of cell surface proteins. However, the adhesive interactions for many of these proteins are poorly understood. Here we present a simple, rapid method for characterizing the adhesive properties of putative homophilic cell adhesion molecules. Cultured HEK293 cells are transfected with DNA plasmid encoding a secreted, epitope-tagged ectodomain of a cell surface protein. Using functionalized beads specific for the epitope tag, the soluble, secreted fusion protein is captured from the culture medium. The coated beads can then be used directly in bead aggregation assays or in fluorescent bead sorting assays to test for homophilic adhesion. If desired, mutagenesis can then be used to elucidate the specific amino acids or domains required for adhesion. This assay requires only small amounts of expressed protein, does not require the production of stable cell lines, and can be accomplished in 4 days.

Here we present a simple, rapid method for characterizing the intrinsic adhesive properties of putative cell adhesion molecules. The secreted, epitope-tagged ectodomain of a cell adhesion molecule is captured from the culture medium on small, uniform functionalized beads. These beads can then be used immediately in simple bead aggregation assays.

상상 속의 세포 부착 분자의 특성에 대한 비드 집계 분석 실험

Cell-cell adhesion is fundamental to multicellular life and is mediated by a diverse array of cell surface proteins. However, the adhesive interactions ...

생체공학

Monitoring Protein Aggregation Kinetics In Vivo using Automated Inclusion Counting in Caenorhabditis elegans

Protein aggregation into insoluble inclusions is a hallmark of a variety of human diseases, many of which are age-related. The nematode Caenorhabditis elegans is a well-established model organism that has been widely used in the field to study protein aggregation and toxicity. Its optical transparency enables the direct visualization of protein aggregation by fluorescence microscopy. Moreover, the fast reproductive cycle and short lifespan make the nematode a suitable model to screen for genes and molecules that modulate this process.
However, the quantification of aggregate load in living animals is poorly standardized, typically performed by manual inclusion counting under a fluorescence dissection microscope at a single time point. This approach can result in high variability between observers and limits the understanding of the aggregation process. In contrast, amyloid-like protein aggregation in vitro is routinely monitored by thioflavin T fluorescence in a highly quantitative and time-resolved fashion.
Here, an analogous method is presented for the unbiased analysis of aggregation kinetics in living C. elegans, using a high-throughput confocal microscope combined with custom-made image analysis and data fitting. The applicability of this method is demonstrated by monitoring inclusion formation of a fluorescently labeled polyglutamine (polyQ) protein in the body wall muscle cells. The image analysis workflow allows the determination of the numbers of inclusions at different timepoints, which are fitted to a mathematical model based on independent nucleation events in individual muscle cells. The method described here may prove useful to assess the effects of proteostasis factors and potential therapeutics for protein aggregation diseases in a living animal in a robust and quantitative manner.

Monitoring Protein Aggregation Kinetics In Vivo using Automated Inclusion Counting in Caenorhabditis elegans

Here, a method is presented for the analysis of protein aggregation kinetics in the nematode Caenorhabditis elegans. Animals from an age-synchronized population are imaged at different time points, followed by semiautomated inclusion counting in CellProfiler and fitting to a mathematical model in AmyloFit.

Caenorhabditis elegans에서 자동 포함 계수를 사용하여 생체 내에서 단백질 응집 동역학 모니터링

Protein aggregation into insoluble inclusions is a hallmark of a variety of human diseases, many of which are age-related. The nematode Caenorhabditis ...

Pulldown Assay Coupled with Co-Expression in Bacteria Cells as a Time-Efficient Tool for Testing Challenging Protein-Protein Interactions

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble effectively in vitro. Such complexes may require co-translational assembly and the presence of molecular chaperones; either they form stable oligomers which cannot dissociate and re-associate in vitro or are unstable without a binding partner. To overcome these problems, it is possible to use a method based on the bacterial co-expression of differentially tagged proteins using a set of compatible vectors followed by the conventional pulldown techniques. The workflow is more time-efficient compared to traditional pulldown because it lacks the time-consuming steps of separate purification of interacting proteins and their following incubation. Another advantage is a higher reproducibility due to a significantly smaller number of steps and a shorter period of time in which proteins that exist within the in vitro environment are exposed to proteolysis and oxidation. The method was successfully applied for studying a number of protein-protein interactions when other in vitro techniques were found to be unsuitable. The method can be used for batch testing protein-protein interactions. Representative results are shown for studies of interactions between BTB domain and intrinsically disordered proteins, and of heterodimers of zinc-finger-associated domains.

Here, we describe a method for the bacterial co-expression of differentially tagged proteins using a set of compatible vectors, followed by the conventional pulldown techniques to study protein complexes that cannot assemble in vitro.

까다로운 단백질-단백질 상호작용을 테스트하기 위한 시간 효율적인 도구로서 박테리아 세포의 공동 발현과 결합된 풀다운 분석

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble ...

4D Imaging of Protein Aggregation in Live Cells

One of the key tasks of any living cell is maintaining the proper folding of newly synthesized proteins in the face of ever-changing environmental conditions and an intracellular environment that is tightly packed, sticky, and hazardous to protein stability1. The ability to dynamically balance protein production, folding and degradation demands highly-specialized quality control machinery, whose absolute necessity is observed best when it malfunctions. Diseases such as ALS, Alzheimer's, Parkinson's, and certain forms of Cystic Fibrosis have a direct link to protein folding quality control components2, and therefore future therapeutic development requires a basic understanding of underlying processes. Our experimental challenge is to understand how cells integrate damage signals and mount responses that are tailored to diverse circumstances.
The primary reason why protein misfolding represents an existential threat to the cell is the propensity of incorrectly folded proteins to aggregate, thus causing a global perturbation of the crowded and delicate intracellular folding environment1. The folding health, or "proteostasis," of the cellular proteome is maintained, even under the duress of aging, stress and oxidative damage, by the coordinated action of different mechanistic units in an elaborate quality control system3,4. A specialized machinery of molecular chaperones can bind non-native polypeptides and promote their folding into the native state1, target them for degradation by the ubiquitin-proteasome system5, or direct them to protective aggregation inclusions6-9.
In eukaryotes, the cytosolic aggregation quality control load is partitioned between two compartments8-10: the juxtanuclear quality control compartment (JUNQ) and the insoluble protein deposit (IPOD) (Figure 1 - model). Proteins that are ubiquitinated by the protein folding quality control machinery are delivered to the JUNQ, where they are processed for degradation by the proteasome. Misfolded proteins that are not ubiquitinated are diverted to the IPOD, where they are actively aggregated in a protective compartment.
Up until this point, the methodological paradigm of live-cell fluorescence microscopy has largely been to label proteins and track their locations in the cell at specific time-points and usually in two dimensions. As new technologies have begun to grant experimenters unprecedented access to the submicron scale in living cells, the dynamic architecture of the cytosol has come into view as a challenging new frontier for experimental characterization. We present a method for rapidly monitoring the 3D spatial distributions of multiple fluorescently labeled proteins in the yeast cytosol over time. 3D timelapse (4D imaging) is not merely a technical challenge; rather, it also facilitates a dramatic shift in the conceptual framework used to analyze cellular structure.
We utilize a cytosolic folding sensor protein in live yeast to visualize distinct fates for misfolded proteins in cellular aggregation quality control, using rapid 4D fluorescent imaging. The temperature sensitive mutant of the Ubc9 protein10-12 (Ubc9ts) is extremely effective both as a sensor of cellular proteostasis, and a physiological model for tracking aggregation quality control. As with most ts proteins, Ubc9ts is fully folded and functional at permissive temperatures due to active cellular chaperones. Above 30 &deg;C, or when the cell faces misfolding stress, Ubc9ts misfolds and follows the fate of a native globular protein that has been misfolded due to mutation, heat denaturation, or oxidative damage. By fusing it to GFP or other fluorophores, it can be tracked in 3D as it forms Stress Foci, or is directed to JUNQ or IPOD.

Cellular viability depends on timely and efficient management of protein misfolding. Here we describe a method for visualizing the different potential fates of a misfolded protein: refolding, degradation, or sequestration in inclusions. We demonstrate the use of a folding sensor, Ubc9ts, for monitoring proteostasis and aggregation quality control in live cells using 4D microscopy.

라이브 셀의 단백질 응집체의 4D 영상

One of the key tasks of any living cell is maintaining the proper folding of newly synthesized proteins in the face of ever-changing environmental ...

생물학

Genetic and Biochemical Approaches for In Vivo and In Vitro Assessment of Protein Oligomerization: The Ryanodine Receptor Case Study

Oligomerization is often a structural requirement for proteins to accomplish their specific cellular function. For instance, tetramerization of the ryanodine receptor (RyR) is necessary for the formation of a functional Ca2+ release channel pore. Here, we describe detailed protocols for the assessment of protein self-association, including yeast two-hybrid (Y2H), co-immunoprecipitation (co-IP) and chemical cross-linking assays. In the Y2H system, protein self-interaction is detected by &#946;-galactosidase assay in yeast co-expressing GAL4 bait and target fusions of the test protein. Protein self-interaction is further assessed by co-IP using HA- and cMyc-tagged fusions of the test protein co-expressed in mammalian HEK293 cells. The precise stoichiometry of the protein homo-oligomer is examined by cross-linking and SDS-PAGE analysis following expression in HEK293 cells. Using these different but complementary techniques, we have consistently observed the self-association of the RyR N-terminal domain and demonstrated its intrinsic ability to form tetramers. These methods can be applied to protein-protein interaction and homo-oligomerization studies of other mammalian integral membrane proteins.

Genetic and Biochemical Approaches for In Vivo and In Vitro Assessment of Protein Oligomerization: The Ryanodine Receptor Case Study

Oligomerization of the ryanodine receptor, a homo-tetrameric ion channel mediating Ca2+ release from intracellular stores, is critical for skeletal and cardiac muscle contraction. Here, we present complementary in vivo and in vitro methods to detect protein self-association and determine homo-oligomer stoichiometry.

대한 유전 및 생화학 적 접근<em&gt; 생체</em&gt; 및<em&gt; 체외</em&gt; 단백질 올리고머의 평가 다음 Ryanodine 수용체 사례 연구

Oligomerization is often a structural requirement for proteins to accomplish their specific cellular function. For instance, tetramerization of the ...

In Situ Monitoring of Transiently Formed Molecular Chaperone Assemblies in Bacteria, Yeast, and Human Cells

J-domain proteins (JDPs) form the largest and the most diverse co-chaperone family in eukaryotic cells. Recent findings show that specific members of the JDP family could form transient heterocomplexes in eukaryotes to fine-tune substrate selection for the 70 kDa heat shock protein (Hsp70) chaperone-based protein disaggregases. The JDP complexes target acute/chronic stress induced aggregated proteins and presumably help assemble the disaggregases by recruiting multiple Hsp70s to the surface of protein aggregates. The extent of the protein quality control (PQC) network formed by these physically interacting JDPs remains largely uncharacterized in vivo. Here, we describe a microscopy-based in situ protein interaction assay named the proximity ligation assay (PLA), which is able to robustly capture&#160;these transiently formed chaperone complexes in distinct cellular compartments of eukaryotic cells. Our work expands the employment of PLA from human cells to yeast (Saccharomyces cerevisiae) and bacteria (Escherichia coli), thus rendering an important tool to monitor the dynamics of transiently formed protein assemblies in both prokaryotic and eukaryotic cells.

Cognate J-domain proteins cooperate with the Hsp70 chaperone to assist in a myriad of biological processes ranging from protein folding to degradation. Here, we describe an in situ proximity ligation assay, which allows the monitoring of these transiently formed chaperone machineries in bacterial, yeast and human cells.

박테리아, 효모 및 인간 세포에서 일시적으로 형성된 분자 샤페론 어셈블리의 시투 모니터링

J-domain proteins (JDPs) form the largest and the most diverse co-chaperone family in eukaryotic cells. Recent findings show that specific members of the ...

단백질 상호 작용의 Live Cell Single-Molecule Imaging-Based 정량화

Single-Molecule Measurement of Protein Interaction Dynamics Within Biomolecular Condensates

Biomolecular condensates formed via liquid-liquid phase separation (LLPS) have been considered critical in cellular organization and an increasing number of cellular functions. Characterizing LLPS in live cells is also important because aberrant condensation has been linked to numerous diseases, including cancers and neurodegenerative disorders. LLPS is often driven by selective, transient, and multivalent interactions between intrinsically disordered proteins. Of great interest are the interaction dynamics of proteins participating in LLPS, which are well-summarized by measurements of their binding residence time (RT), that is, the amount of time they spend bound within condensates. Here, we present a method based on live-cell single-molecule imaging that allows us to measure the mean RT of a specific protein within condensates. We simultaneously visualize individual protein molecules and the condensates with which they associate, use single-particle tracking (SPT) to plot single-molecule trajectories, and then fit the trajectories to a model of protein-droplet binding to extract the mean RT of the protein. Finally, we show representative results where this single-molecule imaging method was applied to compare the mean RTs of a protein at its LLPS condensates when fused and unfused to an oligomerizing domain. This protocol is broadly applicable to measuring the interaction dynamics of any protein that participates in LLPS.

저자 스포트라이트: Evaluation of Protein-Condensate Dynamics in Live Human Cells

Many intrinsically disordered proteins have been shown to participate in the formation of highly dynamic biomolecular condensates, a behavior important for numerous cellular processes. Here, we present a single-molecule imaging-based method for quantifying the dynamics by which proteins interact with each other in biomolecular condensates in live cells.

생체 분자 응축물 내 단백질 상호 작용 역학의 단일 분자 측정

Biomolecular condensates formed via liquid-liquid phase separation (LLPS) have been considered critical in cellular organization and an increasing number ...

이종 세포 시스템에서 단백질 응집을 통한 세포 간 상호 작용 측정

요약

더 많은 비디오 탐색

이 비디오의 챕터

세포 외 단백질 Microarray 기술은 낮은 친 화력 수용 체 Ligand 상호 작용의 높은 처리량 검색

셀 연락처에서 단백질 단백질 상호 작용의 형광 변동 분광학 분석 결과

상상 속의 세포 부착 분자의 특성에 대한 비드 집계 분석 실험

Caenorhabditis elegans에서 자동 포함 계수를 사용하여 생체 내에서 단백질 응집 동역학 모니터링

까다로운 단백질-단백질 상호작용을 테스트하기 위한 시간 효율적인 도구로서 박테리아 세포의 공동 발현과 결합된 풀다운 분석

라이브 셀의 단백질 응집체의 4D 영상

대한 유전 및 생화학 적 접근

박테리아, 효모 및 인간 세포에서 일시적으로 형성된 분자 샤페론 어셈블리의 시투 모니터링

생체 분자 응축물 내 단백질 상호 작용 역학의 단일 분자 측정

생체 분자 응축물 내 단백질 상호 작용 역학의 단일 분자 측정