Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

Summary

We describe a protocol to measure the antiviral cytokine production in mice infected with a model herpesvirus, murine gamma herpesvirus 68 (γHV68) that is closely-related to human Kaposi’s sarcoma-associated herpesvirus (KSHV) and Epstein-Barr virus (EBV). Utilizing genetically modified mouse strains and mouse embryonic fibroblasts (MEFs), we assessed the antiviral cytokine production both in vivo and ex vivo. “Reconstituting” the expression of innate immune components in knockout embryonic fibroblasts by lentiviral transduction, we further pinpoint specific innate immune molecules and dissect the key signaling events that differentially regulate the antiviral cytokine production.

Abstract

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. Conversely, viruses have evolved intricate strategies to evade and exploit host immune signaling for survival and propagation. Viral immune evasion, entailing host defense and viral evasion, provides one of the most fascinating and dynamic interfaces to discern the host-virus interaction. These studies advance our understanding in innate immune regulation and pave our way to develop novel antiviral therapies.

Murine γHV68 is a natural pathogen of murine rodents. γHV68 infection of mice provides a tractable small animal model to examine the antiviral response to human KSHV and EBV of which perturbation of in vivo virus-host interactions is not applicable. Here we describe a protocol to determine the antiviral cytokine production. This protocol can be adapted to other viruses and signaling pathways.

Recently, we have discovered that γHV68 hijacks MAVS and IKKβ, key innate immune signaling components downstream of the cytosolic RIG-I and MDA5, to abrogate NFΚB activation and antiviral cytokine production. Specifically, γHV68 infection activates IKKβ and that activated IKKβ phosphorylates RelA to accelerate RelA degradation. As such, γHV68 efficiently uncouples NFΚB activation from its upstream activated IKKβ, negating antiviral cytokine gene expression. This study elucidates an intricate strategy whereby the upstream innate immune activation is intercepted by a viral pathogen to nullify the immediate downstream transcriptional activation and evade antiviral cytokine production.

Introduction

Recent studies have outlined the overall signaling cascades in mounting host innate immune responses. Residing within distinct compartments, pattern recognition receptors (PRRs) detect pathogen-associated molecular patterns (PAMPs) of diverse origin to trigger innate immune signaling¹. The retinoic acid-induced gene I (RIG-I) and melanoma differentiation antigen 5 (MDA5) proteins are cytosolic sensors that recognize RNA species with specific structural features². Upon activation, RIG-I interacts with its downstream MAVS (also known as IPS-1, VISA, and CARDIF) adaptor that, in turn, activates the IKK (IKKαβγ) and IKK-related kinase (TBK1 and IKKε, also known as IKKi) complexes^3-6. Activated innate immune kinases phosphorylate key regulators of gene expression, including transcription factors and inhibitors thereof, and enable transcriptional activation of host antiviral genes (e.g. IL6, TNFα, CCL5, and IFNβ). These signaling cascades constitute potent intrinsic innate immune responses that establish an anti-microbial state to restrict pathogen propagation during early stages of infection.

Murine γHV68 is closely related to human oncogenic KSHV and EBV. Thus, γHV68 infection of mice provides a tractable small animal model to examine the host immune response to gamma herpes virus infection in vivo⁷. Using γHV68, our lab has uncovered an intricate strategy whereby γHV68 hijacks host innate immune signaling to enable viral infection. On one hand, γHV68 activates the MAVS-IKKβ pathway to promote viral transcriptional activation via directing activated IKKβ to phosphorylate replication transactivator (RTA), the viral transcription factor key for γHV68 replication⁸. On the other hand, the IKKβ-mediated phosphorylation primes RelA for degradation and terminates NFΚB activation⁹. As such, γHV68 infection effectively avoids antiviral cytokine production. Interestingly, a screening utilizing an expression library of γHV68 identified RTA as an E3 ligase to induce RelA degradation and abrogate NFΚB activation¹⁰. These findings uncover an intricate immune evasion strategy whereby the upstream immune signaling events are harnessed by γHV68 to negate the ultimate antiviral cytokine production.

Here we describe a protocol to measure the antiviral cytokine production in mice infected with γHV68 both in vivo and ex vivo. In the protocol we further explore the "reconstituted" expression of innate immune components in the knockout embryonic fibroblasts by lentiviral transduction, which pinpoints the function of the specific innate immune molecules in regulating the antiviral cytokine production. This protocol can be easily adapted to other viruses and signaling pathways.

Protocol

Ethics Statement: All animal work was performed under strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Southern California.

1. Cytokine Gene Expression by Quantitative Real-time PCR and Secretion by ELISA in γHV68-infected Mice

1. Anesthetize gender-matched, 6-8 week-old C57BL/6 (B6) littermates (8-12 mice/group) via intraperitoneally injecting 1.5 mg of ketamine/0.12 mg of xylazine, and inoculate intranasally with 40 PFU of γHV68 in 40 µl (infection detailed in Dong and Feng¹¹). At different time points post-infection, euthanize the mice by using CO₂ inhalation followed by cervical dislocation.
2. Open the chest with a left lateral cut along the sternum and cut through the ribs with sharp scissors. Collect the lung tissues.
3. Collect half of the lung tissue (left lobe) into sterile 1.5 ml screw-capped tubes containing 500 µl 1.0 mm Zirconia/Silica beads. Add 1 ml of cold serum-free DMEM into the tube and homogenize the lung tissue by bead-beating for 30 sec. Chill tubes on ice for 2 min and repeat this process once.
4. Centrifuge the tubes (15,000 x g for 10 min) at 4 °C, collect the supernatant and measure the cytokine production as described below.
5. Measure cytokines using commercially available cytokine ELISA kits according to the manufacturer's instruction.
6. Collect the other half of the lung tissue (right lobe) into another bead-containing tube and add 1 ml TRIzol. Homogenize and collect supernatant as described in step 1.3 and extract RNA according to the manufacture's instruction. Determine RNA concentration by taking absorbance readings at 260 and 280 nm.
7. Prepare cDNA with 1 µg of total RNA and reverse transcriptase according to the manufacture's instruction (the total final volume was 20 µl). Dilute cDNA 50 times with DNAse- and RNAse-free water and perform quantitative real-time PCR.
8. Perform the program on a quantitative real-time PCR machine. Each reaction contains 0.5 µl of a pair of gene-specific primers or control primers of GAPDH (the working concentration of the primers were 10 µM, CE 500 nM for each primer), 5 µl of the SYBR master mix and 4 µl of the diluted cDNA. Calculate ΔΔCt to determine the relative quantity of mRNA transcripts of antiviral cytokines.

2. MEF Cell Infection and Cytokine Quantification by ELISA and qRT-PCR

1. Grow Mavs^+/+ and Mavs^-/- MEF cells to sub-confluent (approximately 80%) density before plating cells.
2. Split MEF cells into 12-well plates at 100,000 cells/well (the cell density will be around 70% on the second day). Carry out γHV68 infection in triplicates, with a multiplicity of infection (MOI) of 5-10 to synchronize and maximize cytokine induction.
3. Prepare γHV68 suspension in complete DMEM medium containing appropriate amount of virus (1 ml for each well).
4. Remove medium and add γHV68-containing suspension to MEF cells.
5. Place the plate in tissue culture incubator, rock every 30 min, and allow a total of 2 hr of incubation.
6. Remove γHV68-containing medium, wash once with PBS, and replace with fresh complete DMEM.
7. At various time points post-infection, harvest medium into 1.5 ml Eppendorf tubes. Wash cells with cold PBS and collect infected cells by trypsin digestion.
8. Measure antiviral cytokines in medium as described in step 1.5.
9. Extract RNA, prepare cDNA and perform qRT-PCR to determine antiviral cytokine gene expression as described in steps 1.5-1.7.

3. Lentivirus Production, Infection, and Generation of Stable Cell Lines

1. Split 293T cells one day before transfection and allow the cells to reach ~40% confluency at the time of transfection.
2. Transfect 10 cm dish of 293T cells with the packaging plasmids (1.2 µg of pVSV-G and 6 µg of pDR8.9) and 7.2 µg of pCDH-FLAG-MAVS or pCDH control by calcium phosphate precipitation.
3. Replace medium at 6 to 8 hr post-transfection with fresh complete DMEM.
4. At 72 hr post-transfection, collect medium containing lentivirus, centrifuge at 4,000 x g for 15 min, and filter with 0.22 µm membrane. To increase the lentivirus titer, we centrifuge the virus-containing medium at 110,000 x g for 2.5 hr at 4 °C. Carefully resuspend the viral pellet in small volume of medium of interest.
5. Seed Mavs^-/- MEF cells or other knockout MEF cells one day before infection in 6-well plates at ~30-40% confluency.
6. Infect MEF cells with 1 ml lentivirus and 2 ml fresh complete DMEM, supplemented with polybrene to a final concentration of 10 µg/ml.
7. Centrifuge the plate at 500 x g at 30 °C for 30 min and transfer the plate to a tissue culture incubator.
8. Replace medium at 6 hr post-infection with fresh complete DMEM.
9. Split MEF cells at 24 hr post-infection and add puromycin to a final concentration of 1 µg/ml at 48 hr post-infection to select cells stably expressing MAVS.
10. Maintain MEF cells in puromycin-containing medium and verify protein expression by immunoblotting with corresponding antibodies.
11. Cells can be used for viral infection, cytokine gene expression and secretion experiments as described in Protocol 2.

Results

Three representative figures are shown here, including cytokine production in the lung of γHV68-infected Mavs^+/+ and Mavs-^/- mouse, cytokine secretion and gene expression level of γHV68-infected Mavs^+/+ and Mavs^-/- MEFs, and cytokine mRNA levels of γHV68-infected Mavs^-/- MEFs "reconstituted" with MAVS. These representative experiments utilize gene knockout mice to investigate antiviral cytokine produ...

Discussion

Viral immune evasion is one of the most dynamic and fascinating interactions interfacing viral offense and host defense⁹. The host innate immune components are structured such that signal transduction is effectively initiated and faithfully transmitted. Delineating the hierarchy and regulation of signaling cascades is a preeminent topic of innate immunity. Here, we introduce a protocol to identify the regulatory roles of an innate immune component, MAVS, in viral evasion of cytokine production. The protocol co...

Materials

Name	Company	Catalog Number	Comments
Mouse CCL5 ELISA kit	R&D systems	DY478
1.0 mm Zirconia/Silica beads	BioSpec Products	11079110z
TRIzol	Invitrogen	15596-018
SuperScript II Reverse Transcriptase	Invitrogen	18064-014
CCL5 quantitative real-time PCR primers
CCTGCTGCTTTGCCTACCTCTC
ACACACTTGGCGGTTCCTTCGA