JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Neuroscience

Fluorescence Activated Cell Sorting (FACS) and Gene Expression Analysis of Fos-expressing Neurons from Fresh and Frozen Rat Brain Tissue

Published: August 27th, 2016

DOI:

10.3791/54358

1Behavioral Neuroscience Research Branch, Intramural Research Program, NIDA, NIH, DHHS, 2Division of Rheumatology, School of Medicine, Johns Hopkins University
* These authors contributed equally

Here we present a Fluorescence Activated Cell Sorting (FACS) protocol to study molecular alterations in Fos-expressing neuronal ensembles from both fresh and frozen brain tissue. The use of frozen tissue allows FACS isolation of many brain areas over multiple sessions to maximize the use of valuable animal subjects.

The study of neuroplasticity and molecular alterations in learned behaviors is switching from the study of whole brain regions to the study of specific sets of sparsely distributed activated neurons called neuronal ensembles that mediate learned associations. Fluorescence Activated Cell Sorting (FACS) has recently been optimized for adult rat brain tissue and allowed isolation of activated neurons using antibodies against the neuronal marker NeuN and Fos protein, a marker of strongly activated neurons. Until now, Fos-expressing neurons and other cell types were isolated from fresh tissue, which entailed long processing days and allowed very limited numbers of brain samples to be assessed after lengthy and complex behavioral procedures. Here we found that yields of Fos-expressing neurons and Fos mRNA from dorsal striatum were similar between freshly dissected tissue and tissue frozen at -80 ºC for 3 - 21 days. In addition, we confirmed the phenotype of the NeuN-positive and NeuN-negative sorted cells by assessing gene expression of neuronal (NeuN), astrocytic (GFAP), oligodendrocytic (Oligo2) and microgial (Iba1) markers, which indicates that frozen tissue can also be used for FACS isolation of glial cell types. Overall, it is possible to collect, dissect and freeze brain tissue for multiple FACS sessions. This maximizes the amount of data obtained from valuable animal subjects that have often undergone long and complex behavioral procedures.

During learning, animals form associations between complex sets of highly specific stimuli. This high-resolution information is thought to be encoded by alterations within specific patterns of sparsely distributed neurons called neuronal ensembles. Neuronal ensembles have recently been identified by the induction of immediately early genes (IEGs) such as Fos, Arc, and Zif268 and their protein products in neurons that were strongly activated during behavior or cue exposure. Fos-expressing neurons in particular have been shown to play causal roles in context and cue-specific learned behaviors 1-4. Thus, unique molecular neuroadaptat....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

All experiments were performed in accordance with the Institutional Animal Care and Use Committee (IACUC) of the National Institutes of Health Guide for the Care and Use of Laboratory animals 16.

Note: All the steps below use low-binding centrifuge tubes that were kept on ice unless otherwise specified.

1. Preparation Before Tissue Collection

  1. Set the centrifuge to 4 oC.
  2. Fire polish a set of three glass Pasteur pipettes wit.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Sorting Fos-positive and Fos-negative neurons from fresh and frozen dorsal striatum tissue from single rats after acute methamphetamine injections.

The protocol described above was used to sort Fos-positive and Fos-negative neurons from a single rat dorsal striatum 90 min after an intraperitoneal injection of methamphetamine (5 mg/kg). Naïve rats in their home cages were used as controls. Dorsal striatum tissue was processe.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

FACS can be used to sort neurons and other cell types from either fresh or frozen adult brain tissue. As mentioned in the introduction, the ability to use frozen tissue allows optimal utilization of samples from animals that have undergone complex and protracted behavioral procedures, such as self-administration and relapse studies in addiction research. These behavioral procedures usually takes 1 - 2 hr or longer, and require all animals (10 - 20 total) be tested on the same day 13,18. It takes ~ 4 hr to proc.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

This work was supported by the NIDA Intramural Research Program (Bruce T. Hope, Yavin Shaham). F.J.R. was supported by an appointment to the NIDA Research Participation Program sponsored by the National Institutes of Health and administered by the Oak Ridge Institute for Science and Education, and received additional financial support from a Becas-Chile scholarship managed by CONICYT and the Universidad de los Andes, Santiago, Chile. The Johns Hopkins FACS Core facility was supported by Award P30AR053503 from the National Institute of Arthritis and Musculoskeletal and Skin Diseases of the National Institute of Health.

....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Name Company Catalog Number Comments
Brain matrix CellPoint Scientific 69-2160-1 to obtain coronal brain slices
Hibernate A low fluorescence  Brain Bits HA-lf  Buffer A' in the protocol is used for processing tissue and cells from the dissociation to fixation steps
Accutase  Millipore SCR005 Enzyme solution' in the protocol is used for enzymatic digestion of tissue prior to trituration
Protein LoBind Tube 1.5 mL, PCR clean Eppendorf 22431081 to prevent cell lost during the protocol
Cell Strainer, 40 µm BD Falcon 352340 to filter cell suspension
Cell Strainer, 100 µm BD Falcon 352360 to filter cell suspension
Falcon 5 ml round-bottom polystyrene test tube with cell strainer snap cap BD Bioscience 352235 to filter cell suspension before passing though the flow cytometer
Pasteur Pipet, Glass NIH supply 6640-00-782-6008 to do tissue trituration
Milli-Mark Anti-NeuN-PE, Clone A60 (mouse monoclonal) antibody EMD Millipore FCMAB317PE antibody to detect neurons
Phospho-c-Fos (Ser32) (D82C12) XP Rabbit (Alexa Fluor 647 Conjugate)  Cell Signaling Technology  8677 antibody to detect Fos-expressing cells
DAPI Sigma D8417 to label nuclei
PicoPure RNA Isolation Kit Applied Biosystems. KIT0204 The kit includes the RNA extraction buffer for step 6.14. It is used to collect sorted cells
Superscript III first strand cDNA synthesis system Invitrogen 18080-051 to synthesize cDNA from RNA
TaqMan PreAmp Master Mix Applied Biosystems. 4391128 to do targeted-preamplification from cDNA
TaqMan Advance Fast Master  Applied Biosystems. 4444963 to do PCR using TaqMan probes
Fos TaqMan probe Applied Biosystems. Rn00487426_g1 TaqMan probe/primers
NeuN TaqMan probe Applied Biosystems. CACTCCAACAGCGTGAC nucleotide sequence for neuronal gene marker
NeuN Forward primer Applied Biosystems. GGCCCCTGGCAGAAAGTAG nucleotide sequence for neuronal gene marker
NeuN Reverse primer Applied Biosystems. TTCCCCCTGGTCCTTCTGA nucleotide sequence for neuronal gene marker
Gfap TaqMan probe Applied Biosystems. Rn00566603_m1 TaqMan probe/primers for astrocityc gene marker
iba-1 TaqMan probe Applied Biosystems. Rn00574125_g1 TaqMan probe/primers for microglya gene marker
Gapdh TaqMan probe Applied Biosystems. CTCATGACCACAGTCCA nucleotide sequence for reference/housekeeping gene
Gapdh Forward primer Applied Biosystems. GACAACTTTGGCATCGTGGAA nucleotide sequence for reference/housekeeping gene
Gapdh Reverse primer Applied Biosystems. CACAGTCTTCTGAGTGGCAGTGA nucleotide sequence for reference/housekeeping gene
Oligo2 TaqMan probe Applied Biosystems. Rn01767116_m1  TaqMan probe/primers for oligodendrocytic gene marker
P1000 pipettor Rainin 17014382 It is refered to as the pipette with a large tip diameter in steps 3.1 and 3.3 for mild tissue trituration and step 6.7 to resuspend cells
7500 Fast Real-time PCR system Applied Biosystems. 446985 for quantitative PCR
FACSAria I Cell Sorter BD Biosciences for FACS sorting

  1. Bossert, J. M., et al. Ventral medial prefrontal cortex neuronal ensembles mediate context-induced relapse to heroin. Nat Neurosci. 14, 420-422 (2011).
  2. Cruz, F. C., et al. Role of nucleus accumbens shell neuronal ensembles in context-induced reinstatement of cocaine-seeking. J Neurosci. 34, 7437-7446 (2014).
  3. Fanous, S., et al. Role of orbitofrontal cortex neuronal ensembles in the expression of incubation of heroin craving. J Neurosci. 32, 11600-11609 (2012).
  4. Koya, E., et al. Targeted disruption of cocaine-activated nucleus accumbens neurons prevents context-specific sensitization. Nat Neurosci. 12, 1069-1073 (2009).
  5. Cruz, F. C., Rubio, F. J., Hope, B. T. Using c-fos to study neuronal ensembles in corticostriatal circuitry of addiction. Brain Research. 1628, 157-173 (2015).
  6. Kamentsky, L. A., Melamed, M. R. Spectrophotometric cell sorter. Science. 156, 1364-1365 (1967).
  7. Kamentsky, L. A., Melamed, M. R., Derman, H. Spectrophotometer: new instrument for ultrarapid cell analysis. Science. 150, 630-631 (1965).
  8. Lobo, M. K., Karsten, S. L., Gray, M., Geschwind, D. H., Yang, X. W. FACS-array profiling of striatal projection neuron subtypes in juvenile and adult mouse brains. Nat Neurosci. 9, 443-452 (2006).
  9. Lobo, M. K. Molecular profiling of striatonigral and striatopallidal medium spiny neurons past, present, and future. Int Rev Neurobiol. 89, 1-35 (2009).
  10. Guez-Barber, D., et al. FACS purification of immunolabeled cell types from adult rat brain. J Neurosci Methods. 203, 10-18 (2012).
  11. Guez-Barber, D., et al. FACS identifies unique cocaine-induced gene regulation in selectively activated adult striatal neurons. J Neurosci. 31, 4251-4259 (2011).
  12. Fanous, S., et al. Unique gene alterations are induced in FACS-purified Fos-positive neurons activated during cue-induced relapse to heroin seeking. J Neurochem. 124, 100-108 (2013).
  13. Liu, Q. R., et al. Detection of molecular alterations in methamphetamine-activated Fos-expressing neurons from a single rat dorsal striatum using fluorescence-activated cell sorting (FACS). J Neurochem. 128, 173-185 (2014).
  14. Rubio, F. J., et al. Context-induced reinstatement of methamphetamine seeking is associated with unique molecular alterations in Fos-expressing dorsolateral striatum neurons. J Neurosci. 35, 5625-5639 (2015).
  15. Li, X., et al. Incubation of methamphetamine craving is associated with selective increases in expression of Bdnf and trkb, glutamate receptors, and epigenetic enzymes in cue-activated fos-expressing dorsal striatal neurons. J Neurosci. 35, 8232-8244 (2015).
  16. US National Research Council. . Guide for the care and use of laboratory animals. , (2011).
  17. Koya, E., Margetts-Smith, G., Hope, B. T. Daun02 inactivation of behaviourally-activated Fos-expressing neuronal ensembles. Current Protocols. , (2016).
  18. Cruz, F. C., et al. New technologies for examining the role of neuronal ensembles in drug addiction and fear. Nat Rev Neurosci. 14, 743-754 (2013).
  19. Mardones, G., Gonzalez, A. Selective plasma membrane permeabilization by freeze-thawing and immunofluorescence epitope access to determine the topology of intracellular membrane proteins. J Immunol Methods. 275, 169-177 (2003).
  20. Molyneaux, B. J., et al. DeCoN: genome-wide analysis of in vivo transcriptional dynamics during pyramidal neuron fate selection in neocortex. Neuron. 85, 275-288 (2015).
  21. Schwarz, J. M. Using fluorescence activated cell sorting to examine cell-type-specific gene expression in rat brain tissue. J Vis Exp. , e52537 (2015).

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved