Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella

Summary

In this article, we describe the protocols of protein expression, purification, crystallization and structure determination of the N-terminal domain of ryanodine receptor from diamondback moth (Plutella xylostella).

Abstract

Development of potent and efficient insecticides targeting insect ryanodine receptors (RyRs) has been of great interest in the area of agricultural pest control. To date, several diamide insecticides targeting pest RyRs have been commercialized, which generate annual revenue of 2 billion U.S. dollars. But comprehension of the mode of action of RyR-targeting insecticides is limited by the lack of structural information regarding insect RyR. This in turn restricts understanding of the development of insecticide resistance in pests. The diamondback moth (DBM) is a devastating pest destroying cruciferous crops worldwide, which has also been reported to show resistance to diamide insecticides. Therefore, it is of great practical importance to develop novel insecticides targeting the DBM RyR, especially targeting a region different from the traditional diamide binding site. Here, we present a protocol to structurally characterize the N-terminal domain of RyR from DBM. The x-ray crystal structure was solved by molecular replacement at a resolution of 2.84 Å, which shows a beta-trefoil folding motif and a flanking alpha helix. This protocol can be adapted for the expression, purification and structural characterization of other domains or proteins in general.

Introduction

Ryanodine receptors (RyRs) are specific ion channels, which mediate the permeation of Ca²⁺ ions across the sarcoplasmic reticulum (SR) membranes in muscle cells. Therefore, they play an important role in the excitation contraction coupling process. In its functional form, RyR assembles as a homo-tetramer with a molecular mass of >2 MDa, with each subunit comprising of ~5000 amino acid residues. In mammals, there are three isoforms: RyR1- skeletal muscle type, RyR2- cardiac muscle type and RyR3- ubiquitously expressed in different tissues¹.

In insects there is only one type of RyR, which is expressed in muscular and nervous tissue². Insect RyR is more similar to mammalian RyR2 with a sequence identity of about 47%³. Diamide insecticides targeting RyR of Lepidoptera and Coleoptera have been developed and marketed by major companies like Bayer (flubendiamide), DuPont (chlorantraniliprole) and Syngenta (cyantraniliprole). Since its relatively recent launch, diamide insecticides have become one of the fastest growing class of insecticides. Currently, the sales of these three insecticides annually have crossed 2 billion U.S. dollars with a growth rate of more than 50% since 2009 (Agranova).

Recent studies have reported the development of resistance in insects after a few generations of usage of these insecticides^4,5,6,7,8. The resistance mutations in the transmembrane domain of RyRs from the diamondback moth (DBM), Plutella xylostella (G4946E, I4790M) and the corresponding positions in tomato leafminer, Tuta absoluta (G4903E, I4746M) show that the region might be involved in diamide insecticide binding as this region is known to be critical for gating of the channel^4,8,9. Despite extensive research in this area, the exact molecular mechanisms of diamide insecticides remain elusive. Moreover, it is unclear whether the resistance mutations affect the interactions with diamides directly or allosterically.

Earlier studies have reported the structure of several RyR domains from mammalian species and the structure of full-length mammalian RyR1 and RyR2 by x-ray crystallography and cryo-electron microscopy, respectively^{10,11,12,13,14,15,16,17,18,19,20,21}. But so far, no structure of insect RyR has been reported, which prohibits us from understanding the molecular intricacies of the receptor function as well as the molecular mechanisms of insecticide action and development of insecticide resistance.

In this manuscript, we present a generalized protocol for the structural characterization of N-terminal β-trefoil domain of ryanodine receptor from the diamondback moth, a destructive pest infecting cruciferous crops worldwide²². The construct was designed according to the published rabbit RyR1 NTD crystal structures^23,24and the cryo-EM structural models^{16,17,18,19,20,21}. This is the first high-resolution structure reported for insect RyR, which reveals the mechanism for channel gating and provides an important template for the development of species-specific insecticides using structure-based drug design. For structure elucidation, we employed x-ray crystallography, which is considered as the 'gold standard' for protein structure determination at near atomic resolution. Although the crystallization process is unpredictable and labor intensive, this step-by-step protocol will help researchers to express, purify and characterize other domains of insect RyR or any other proteins in general.

Protocol

1. Gene Cloning, Protein Expression, and Purification

1. PCR amplify DNA corresponding to protein of interest (residues 1-205 of DBM RyR, Genbank acc. no. AFW97408) and clone into pET-28a-HMT vector by Ligation-Independent Cloning (LIC)²⁵. This vector contains a histidine tag, MBP tag and a TEV protease cleavage site at the N-terminus¹⁵.
   1. Design LIC primers for amplification of target gene with LIC-compatible 5’ extensions:
      Forward LIC primer:
      5’ TACTTCCAATCCAATGCAATGGCGGAAGCGGAAGGGG 3’
      Reverse LIC primer:
      5’ TTATCCACTTCCAATGTTATTATATGCCGGTCCCGTACGGC 3’
   2. Combine the reaction components (50 μL): 1 μL of DNA templates (100 ng/μL), 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 0.5 μL of DNA polymerase (NEB), 5 μL of 10x reaction buffer, 1 μL of dNTP (25 mM), 40.5 μL of RNase free ddH₂O.
      1. Place the reaction mixture in a PCR machine and run the following program.
      2. Incubate at 95 °C for 3 min, and then run 30 cycles of (95 °C for 30 s, 58 °C for 15 s, 72 °C for 1 min). Incubate at 72 °C for 5 min and then hold at 4 °C.
      3. Run the entire reaction mix (50 μL) on a 2% agarose gel and extract with a Gel Extraction Kit. Follow manufacturer’s protocol.
   3. Ligation-Independent Cloning (LIC)
      1. Perform SspI digestion (60 μL): 20 μL of vector DNA (50 ng/μL), 6 μL of 10x reaction buffer, 4 μL of SspI, and 30 μL of ddH₂O. Incubate at 37 °C for 3 h. Run the entire reaction mix on 1% agarose gel and extract with a Gel Extraction Kit. Follow manufacturer’s protocol.
      2. Perform T4 DNA Polymerase treatment of the vector and insert DNA. Combine the following: 5 μL of vector or insert DNA (50 ng/μL), 2 μL of 10x T4 DNA Polymerase Buffer, 1 μL of dGTP (25 mM) for vector or 1 μL of dCTP (25 mM) for insert DNA, 1 μL of DTT (100 mM), 0.4 μL of T4 DNA Polymerase (LIC-qualified), and 9.6 μL of ddH₂O. Incubate reactions at room temperature for 40 min. Heat-inactivate enzyme at 75 °C for 20 min.
         Note: The LIC vector and insert DNA must be treated in separate reactions.
      3. Perform the LIC annealing reaction. Combine the following: 2 μL of T4-treated insert DNA, 2 μL of T4-treated LIC vector DNA. Incubate reaction at room temperature for 10 min.
2. Transform BL21 (DE3) E. coli cells with this recombinant plasmid.
   1. Thaw competent cells (50 μL in micro-centrifuge tube) on ice.
   2. Add approximately 1 μL (50 ng) of plasmid into the tube. Mix the cells and DNA by gently flicking the tube 2–3 times. Place the tube on ice for 20 min.
   3. Heat shock at 42 °C for 40 s. Place the tube on ice again for 2 min. Add 1 mL of room temperature LB media to the tube.
   4. Place the mixture tube in the 250 rpm shaker at 37 °C for 45 min. Spread 150–200 µL of the mixture onto the selection plates. Invert the plate and incubate overnight at 37 °C.
3. Pick a single colony and culture the cells in 100 mL 2YT medium containing 50 µg/mL kanamycin at 37 °C overnight. Next morning, inoculate 1 L 2YT medium containing 50 µg/mL kanamycin with 10 mL of overnight culture and incubate in 37 °C shaker incubator at 250 rpm, until the OD₆₀₀ reaches ~0.6. Thereafter induce the culture with IPTG to a final concentration of 0.4 mM and grow for another 5 h at 30 °C.
4. Harvest the cells by centrifugation at 8,000 x g for 10 min at 4 °C, collect the cells and resuspend every 10 g cells in 40 mL lysis buffer (10 mM HEPES pH 7.4, 250 mM KCl, 10 mM β-mercaptoethanol, 25 μg/mL lysozyme, 25 μg/mL DNase, 1 mM PMSF).
   1. Disrupt it by sonication at 65% amplitude for 8 min with 1 s on and 1 s off. Remove the cell debris by centrifugation at 40,000 x g for 30 min at 4 °C. Filter the supernatant by passing through 0.22 μm filter and load it into the sample loop.
5. Purify the fusion protein, cleave the tag and re-purify the target protein.
   1. Purify the fusion protein using Ni-NTA column (binding buffer: 10 mM HEPES pH 7.4, 250 mM KCl; elution buffer: 10 mM HEPES pH 7.4, 250 mM KCl, 500 mM imidazole) and purify by a purification system, with a linear gradient of 20–250 mM imidazole.
   2. Cleave the eluted target protein with TEV protease (1:50 ratio) overnight at 4 °C.
   3. Purify the cleavage reaction mixture by using amylose resin column (binding buffer: 10 mM HEPES pH 7.4, 250 mM KCl; elution buffer: 10 mM HEPES pH 7.4, 250 mM KCl, 10 mM maltose) and Ni-NTA column to remove the tag and TEV protease. The target protein will be in the flow-through fraction of these two columns.
   4. Dialyze the sample against dialysis buffer (10 mM Tris-HCl pH 8.8, 50 mM KCl, 10 mM β-mercaptoethanol to reduce the salt concentration. Purify the sample on a anion exchange column (binding buffer: 10 mM Tris-HCl pH 8.8, 10 mM β-mercaptoethanol; elution buffer: 10 mM Tris-HCl pH 8.8, 1 M KCl, 10 mM β-mercaptoethanol) by a linear gradient of 20–500 mM KCl in the elution buffer.
   5. As a final step in the purification process, concentrate the protein using centrifugal concentrator (10 kDa MWCO) and inject into a Superdex 200 26/600 gel-filtration column to check the homogeneity.
6. Examine the purity of the protein by running it on a 15% SDS PAGE.
   NOTE: All columns are running on a protein purification system with a binding flow rate of 2 mL/min, and an elution flow rate of 4 mL/min except for gel-filtration at 1 mL/min.

2. Protein Preparation and Crystallization

1. Concentrate the purified protein sample to 10 mg/mL using centrifugal concentrator (10 kDa MWCO) and buffer exchange to crystallization buffer before storing at -80 °C.
2. Perform crystallization screening (1:1 ratio, 200 nL of protein and 200 nL of reservoir buffer) by the sitting drop vapor diffusion method at 295 K with several crystallization kits using an automated liquid handling robotic system in a 96-well format.
   NOTE: We used kits from Molecular Dimensions and Hampton research and the Gryphon automated liquid handling system.
3. Seal the 96-well crystallization plate to prevent evaporation and enable the equilibration of the protein drop with the reservoir buffer. Then keep the plates in the crystal incubator at 18 °C.
4. Check the 96-well plates periodically using a light microscope to monitor crystal formation and growth.
5. To differentiate protein crystals from salt crystals, use a protein dye. Add 1 µL of dye to the target drop. Wait for about 1 h and observe under microscope. The protein crystals will turn blue.
6. Use the positive crystallization conditions (1.5 M ammonium sulfate, 0.1 M Tris pH 8.0) to further optimize the crystals using hanging drop vapor-diffusion method in 24-well plates.
   1. Optimize pH from 7.0 to 8.5 with 0.5 pH unit interval every step. Optimize concentration of ammonium sulfate from 1.2 M to 1.7 M with 0.1 M interval every step. (In our case the best condition producing large plate-shaped crystals was 0.1 M HEPES pH 7.0 and 1.6 M ammonium sulfate)

3. Crystal Mounting, X-Ray Data Collection, and Structure Determination

1. Mount crystals in a cryoloop and flash-cool in liquid nitrogen using reservoir solution containing 20% glycerol as cryo-protectant. Place the crystals in unipuck for storage and transportation.
2. Pre-screen protein crystals using a Rigaku in-house X-ray diffractor. Choose the best ones with the highest resolutions for data collection at synchrotron facilities (our dataset was collected from BL17U1 at Shanghai Synchrotron Radiation Facility).
   1. Use the beamline control software BluIce²⁶ to mount and center the crystals by automatic or manual centering function. Perform test exposures to determine the data collection strategy, including starting angle, exposure time, detector distance, frame width and numbers.
   2. Collect dataset accordingly (we collected 180 frames with 1 s exposure time, 1° frame width and the detector distance of 350 mm).
3. Index, integrate and scale the dataset using HKL2000 suite²⁷. First carry out the peak search function to find the diffraction spots, and then index the spots and select the right space group. After peak integration, scale the dataset with the proper error model and save the output .sca file.
4. Solve the phase problem by molecular replacement using Phaser²⁸ in PHENIX²⁹.
   1. Calculate the possible copy number of protein molecules in the asymmetric unit by Xtriage³⁰.
   2. Look for the proper structure templates with high sequence identity and structural similarity as the target protein using known structures from literature or the models generated by structure prediction server such as Phyre2³¹ (we used rabbit RyR1 NTD as a search model, PDB ID 2XOA).
   3. Run Phaser using the diffraction data file, the template structure file and the protein sequence file to find the solution.
5. Perform AutoBuild³² in PHENIX²⁹ to generate the initial model using the output file from Phaser and the sequence file from the target protein.
6. Manually build the structure into the modified experimental electron density using Coot³³ and refine using phenix.refine³⁴ in iterative cycles.
7. Validate the final model using the validation tools in PHENIX¹⁸.

Results

Purification

The N-terminal domain of DBM RyR was expressed as a fusion protein with a hexahistidine tag, a MBP tag and a TEV protease cleavage site. We followed a five-step purification strategy to obtain a highly pure protein, suitable for crystallization purpose. At first, the fusion protein was purified from the soluble fraction of cell lysate by Ni-NTA column (HisTrap HP). Next, the fusion protein was subjected to TEV pro...

Discussion

In this paper, we describe the procedure to recombinantly express, purify, crystallize and determine the structure of DBM RyR NTD. For crystallization, a crucial requirement is to obtain proteins with high solubility, purity and homogeneity. In our protocol, we chose to use pET-28a-HMT vector as it contains a hexahistidine tag and MBP tag, both of which could be utilized for purification to obtain a higher fold purity. Additionally, the MBP tag aids in the solubility of the target protein. We purified the protein by five...

Materials

Name	Company	Catalog Number	Comments
pET-28a-HMT vector			This modified pET vector contains a hexahistidine tag, an MBP fusion protein and a TEV protease cleavage site at the N-terminus (Lobo and Van Petegem, 2009)
E. coli BL21 (DE3) strain	Novagen	69450-3CN
HisTrapHP column (5 mL)	GE Healthcare	45-000-325
Amylose resin column	New England Biolabs	E8021S
Q Sepharose high-performance column	GE Healthcare	17-1154-01
Amicon concentrators (10 kDa MWCO)	Millipore	UFC901008
Superdex 200 26/600 gel-filtration column	GE Healthcare	28-9893-36
Automated liquid handling robotic system	Art Robbins Instruments	Gryphon
96 Well CrystalQuick	Greiner bio-one	82050-494
Uni-Puck	Molecular Dimensions	MD7-601
Mounted CryoLoop - 20 micron	Hampton Research	HR4-955
CryoWand	Molecular Dimensions	MD7-411
Puck dewar loading tool	Molecular Dimensions	MD7-607
Nano drop	Thermo Scientific	NanoDrop One
Crystal incubator	Molecular Dimensions	MD5-605
X-Ray diffractor	Rigaku	FRX
PCR machine	Eppendorf	Nexus GX2
Plasmid mini-prep kit	Qiagen	27104
Gel extraction kit	Qiagen	28704
SspI restriction endonuclease	NEB	R0132S
T4 DNA polymerase	Novagen	2868713
Kanamycin	Scientific Chemical	25389940
IPTG	Genview	367931
HEPES	Genview	7365459
β-mercaptoethanol	Genview	60242
Centrifuge	Thermo Scientific	Sorvall LYNX 6000
Sonnicator	Scientz	II-D
Protein purification system	GE Healthcare	Akta Pure
Light microscope	Nikon	SMZ745
IzIt crystal dye	Hampton Research	HR4-710
Electrophoresis unit	Bio-Rad	1658005EDU
Shaker Incubator	Zhicheng	ZWYR-D2401
Index crystal screen	Hampton Research	HR2-144
Structure crystal screen	Molecular Dimensions	MD1-01
ProPlex crystal screen	Molecular Dimensions	MD1-38
PACT premier crystal screen	Molecular Dimensions	MD1-29
JCSG-plus crystal screen	Molecular Dimensions	MD1-37